The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019734	Alistipes onderdonkii subsp. vulgaris strain 3BBH6	3507492	664613	730574	3507492	integrase,tail,portal	unidentified_phage(61.11%)	60	667894:667953	671303:671382
WP_141417556.1|664613_665849_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141417557.1|665959_666256_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162508116.1|666462_667755_+	hypothetical protein	NA	NA	NA	NA	NA
667894:667953	attL	CAACAATTAGGTAAACACTATTATAATGTAAAGAAGCGGTTGGAATATATTATGTTCCAG	NA	NA	NA	NA
WP_117722017.1|668018_669269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	17.9	1.2e-05
WP_118419102.1|669285_670245_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_117722019.1|670250_671282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.9	9.5e-20
WP_141417559.1|671533_672175_-	hypothetical protein	NA	NA	NA	NA	NA
671303:671382	attR	CTGGAACATAATATATTCCAACCGCTTCTTTACATTATAATAGTGTTTACCTAATTGTTGTTATGTCAATATTTACATAA	NA	NA	NA	NA
WP_141418028.1|672177_672456_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_141417560.1|672700_673720_-	hypothetical protein	NA	H7BUI9	unidentified_phage	49.9	5.4e-100
WP_141417561.1|673755_675168_-|portal	phage portal protein	portal	H7BUJ0	unidentified_phage	61.8	1.4e-170
WP_141417562.1|675674_676109_-	hypothetical protein	NA	A0A1B1IRB1	uncultured_Mediterranean_phage	41.5	2.5e-22
WP_141417563.1|676647_678270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417564.1|678259_678706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417565.1|678787_679225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417566.1|679306_679561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417567.1|679772_680219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417568.1|680309_680741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417569.1|682341_682641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417570.1|682637_682847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417571.1|682954_683572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417572.1|683555_683774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417573.1|683778_684081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417574.1|684077_684257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417575.1|684225_684768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417576.1|684827_685118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417577.1|685127_685892_-	3'-5' exonuclease	NA	H7BUJ3	unidentified_phage	55.0	1.5e-70
WP_162508117.1|685873_686407_-	hypothetical protein	NA	E0YIZ7	Lactococcus_phage	37.6	3.2e-11
WP_141417579.1|686403_688575_-	DNA polymerase III subunit alpha	NA	H7BUJ5	unidentified_phage	58.8	1.0e-257
WP_141417580.1|688571_690281_-	PHP domain-containing protein	NA	H7BUJ7	unidentified_phage	53.9	2.8e-141
WP_141417581.1|690277_691336_-	hypothetical protein	NA	H7BUJ8	unidentified_phage	57.1	3.6e-107
WP_141418029.1|691568_691880_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141417582.1|691890_692979_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_141417583.1|693129_694485_-	hypothetical protein	NA	H7BUJ9	unidentified_phage	52.3	1.1e-135
WP_141417584.1|694481_695099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141418030.1|695073_695676_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_141417585.1|695818_696298_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_141417586.1|696269_698588_-	SMC family ATPase	NA	H7BUK0	unidentified_phage	33.4	1.9e-113
WP_141417587.1|698575_699634_-	phosphoesterase	NA	M4SN99	Cellulophaga_phage	22.2	4.2e-15
WP_141417588.1|699639_700224_-	hypothetical protein	NA	A0A218KBR8	Bacillus_phage	46.9	2.8e-37
WP_141417589.1|700287_701544_-	hypothetical protein	NA	H7BUK1	unidentified_phage	45.4	2.3e-84
WP_141417590.1|701863_702325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417591.1|702439_704998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141418031.1|705000_705555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417592.1|705554_706439_-	hypothetical protein	NA	H7BUK7	unidentified_phage	50.5	3.3e-82
WP_167496244.1|706458_707529_-	hypothetical protein	NA	H7BUK8	unidentified_phage	36.2	1.8e-34
WP_141417593.1|707521_708202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417594.1|708389_709427_+	Fic family protein	NA	NA	NA	NA	NA
WP_141417595.1|709524_710913_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_141417596.1|710916_712341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417597.1|712732_714031_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_141417598.1|714027_714225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141417599.1|714228_714552_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_141417600.1|714570_714852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417601.1|721084_722743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417602.1|722739_723648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417603.1|723886_724111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162508118.1|724101_724413_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_141417605.1|724577_725936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417606.1|725926_726877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141417607.1|726881_730574_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	27.2	1.2e-24
