The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	110387	174714	6499434	protease,transposase,integrase	Acanthamoeba_polyphaga_mimivirus(20.0%)	55	108933:108950	172857:172874
108933:108950	attL	ATACATTATTAATATAAC	NA	NA	NA	NA
WP_141408434.1|110387_111560_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_074559355.1|112420_115420_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_004306509.1|115436_116990_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_008777222.1|117218_117791_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008777221.1|117800_118448_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_141408435.1|118509_119202_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_004299178.1|119298_120156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004299177.1|120189_120864_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.3	8.0e-52
WP_118195688.1|120876_121554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004299175.1|121694_122294_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	46.7	3.5e-35
WP_141408436.1|122315_123449_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_141408437.1|123746_124682_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008640050.1|124722_125094_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_141408438.1|125155_125725_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_141408439.1|125798_126671_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_141408440.1|126892_130153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409578.1|130373_131825_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_141408441.1|132180_132585_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008998991.1|132630_133020_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_141408442.1|133353_136440_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_141408443.1|136455_138294_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_087322334.1|138537_139023_+	flavodoxin	NA	NA	NA	NA	NA
WP_022199146.1|139162_139522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164497290.1|139632_139794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049703574.1|139808_140651_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.7	6.1e-17
WP_055235665.1|140647_141178_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.3	3.5e-18
WP_141408444.1|141674_143768_-	DUF3874 domain-containing protein	NA	I6R9L9	Nonlabens_phage	28.2	1.8e-25
WP_141408445.1|144115_144766_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004309081.1|144979_146059_-	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	28.4	2.5e-23
WP_004323539.1|146227_147940_-	GAF domain-containing protein	NA	A0A1V0SGX0	Hokovirus	37.5	1.4e-31
WP_004309079.1|148239_148560_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_032852847.1|148713_149286_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004306433.1|149360_149726_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_141408446.1|149985_152118_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_004299152.1|152221_152698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004299151.1|152752_153598_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004306429.1|153671_154292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004309075.1|154490_154907_+	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_004309074.1|154903_156034_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004306423.1|156065_156536_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_004315537.1|156680_157586_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_008770674.1|158171_159584_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_141408447.1|159575_160772_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004299141.1|161021_161240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008025240.1|161458_162562_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.1	3.2e-13
WP_004315243.1|162660_164034_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004315244.1|164127_164862_-	lipoprotein	NA	NA	NA	NA	NA
WP_004315245.1|164946_165474_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004315246.1|165485_166112_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.0	2.7e-22
WP_004315247.1|166184_166655_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004315248.1|166832_168119_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.2	1.2e-16
WP_004306417.1|168187_168427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004315249.1|168533_169439_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004315250.1|169592_172133_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_008025245.1|172137_174714_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
172857:172874	attR	ATACATTATTAATATAAC	NA	NA	NA	NA
>prophage 2
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	389730	434140	6499434	protease,transposase	Tetraselmis_virus(33.33%)	36	NA	NA
WP_004315537.1|389730_390636_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_008026192.1|391124_392447_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_008022065.1|392590_393949_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008026191.1|394239_396084_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
WP_004296231.1|396231_396741_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	2.3e-27
WP_008026188.1|396793_397174_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004316578.1|397203_397875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008644971.1|397923_399408_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_055235815.1|399546_400920_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_141408494.1|401155_402466_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_008026182.1|402470_402872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008016291.1|403092_404766_-	nucleoside kinase	NA	NA	NA	NA	NA
WP_008644967.1|404848_406546_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_004306971.1|406704_406869_-	rubredoxin	NA	NA	NA	NA	NA
WP_087323313.1|407092_408268_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.6	1.2e-23
WP_015531659.1|408358_411064_+	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	34.6	7.8e-114
WP_008026174.1|411053_411677_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_008026172.1|411687_412668_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_008026168.1|412807_413587_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004316653.1|413602_414028_-	SufE family protein	NA	NA	NA	NA	NA
WP_004316652.1|414050_415046_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_015531658.1|415116_416025_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_008026160.1|416242_417202_+	phosphate butyryltransferase	NA	NA	NA	NA	NA
WP_008018575.1|417227_418289_+	butyrate kinase	NA	NA	NA	NA	NA
WP_008022065.1|418602_419961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008018576.1|420147_421905_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004316645.1|421934_422408_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008644935.1|422627_422891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004311937.1|423387_425514_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_141408495.1|425710_426862_+	DUF4369 domain-containing protein	NA	NA	NA	NA	NA
WP_032811363.1|427043_427508_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_141408496.1|427559_427952_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_141408497.1|428088_428988_-	EamA family transporter	NA	NA	NA	NA	NA
WP_120144590.1|428991_430308_-	MFS transporter	NA	NA	NA	NA	NA
WP_008022065.1|431265_432624_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004297445.1|433138_434140_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	2133186	2226274	6499434	transposase	Trichoplusia_ni_ascovirus(11.11%)	59	NA	NA
WP_008025715.1|2133186_2134122_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_008640050.1|2134162_2134534_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_008024540.1|2135199_2136870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141408833.1|2137093_2140081_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_008024544.1|2140093_2141665_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_008997879.1|2141678_2142842_+	SusF/SusE family outer membrane protein	NA	NA	NA	NA	NA
WP_087318191.1|2142858_2144421_+	SusF/SusE family outer membrane protein	NA	NA	NA	NA	NA
WP_141408834.1|2144449_2145814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008024552.1|2145826_2147239_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_008997877.1|2147291_2148737_+	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_141408835.1|2148781_2150986_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_008024558.1|2151387_2151624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141408836.1|2151777_2152368_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004299904.1|2152384_2153131_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	2.1e-21
WP_004299905.1|2153140_2153812_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_008771523.1|2153856_2155164_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074708887.1|2155465_2157736_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_167509087.1|2158037_2159198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304956.1|2159694_2161140_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_061448197.1|2161199_2162357_-	hydrolase	NA	NA	NA	NA	NA
WP_061448198.1|2162411_2163362_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_073343648.1|2163415_2165698_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_141408837.1|2165908_2169949_+	response regulator	NA	NA	NA	NA	NA
WP_122136137.1|2170137_2172111_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_008018369.1|2172129_2173377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004313036.1|2173391_2174783_+	glycosyl hydrolase family 76	NA	NA	NA	NA	NA
WP_004299917.1|2174819_2178065_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004299918.1|2178078_2180007_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_004310443.1|2180043_2181615_+	LamG domain-containing protein	NA	A0A0A7RU14	Clostridium_phage	43.8	3.1e-06
WP_117684362.1|2181734_2182001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117684363.1|2182275_2183832_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	24.9	1.0e-17
WP_141408838.1|2184047_2185421_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_141408839.1|2185508_2186348_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_141408840.1|2186353_2187592_+	insulinase family protein	NA	NA	NA	NA	NA
WP_049701794.1|2187676_2189035_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_141408841.1|2189069_2191388_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.0	5.4e-31
WP_167509089.1|2191502_2196014_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_009040283.1|2196016_2198359_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_004299937.1|2198883_2199795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141408842.1|2199937_2201893_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.9e-54
WP_004299939.1|2202102_2204139_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	33.0	2.2e-92
WP_004299940.1|2204290_2205814_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	S4VT61	Pandoravirus	39.6	6.6e-54
WP_004299941.1|2205829_2206852_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004299942.1|2206859_2207705_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004314401.1|2207701_2208199_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004324644.1|2208201_2210064_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_008024621.1|2210044_2211502_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004319780.1|2211594_2211951_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004312010.1|2211954_2212320_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004312011.1|2212395_2214069_+|transposase	IS66-like element ISBf10 family transposase	transposase	A0A218MNE7	uncultured_virus	28.9	2.1e-37
WP_141408843.1|2214034_2214925_-	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
WP_004314398.1|2214902_2216402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008024625.1|2216417_2217542_-	DNA polymerase III subunit	NA	NA	NA	NA	NA
WP_004304907.1|2217543_2218497_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_004304906.1|2218683_2219196_-	ferritin	NA	NA	NA	NA	NA
WP_118219981.1|2219441_2221538_-	DUF3874 domain-containing protein	NA	I6R9Q6	Nonlabens_phage	28.1	2.4e-22
WP_004304904.1|2221675_2222113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141408845.1|2222629_2224297_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_004315537.1|2225368_2226274_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	2427870	2494638	6499434	transposase,tRNA	Klosneuvirus(11.11%)	43	NA	NA
WP_004315537.1|2427870_2428776_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_009041301.1|2428956_2430558_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_008642045.1|2430652_2431003_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_009041302.1|2430990_2431380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141408879.1|2432199_2434470_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004315134.1|2434574_2436881_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_167509093.1|2436925_2437933_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_004310994.1|2437967_2438525_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_141409606.1|2438552_2440790_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004315136.1|2441313_2443932_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	42.5	1.5e-98
WP_004305395.1|2444103_2445072_+	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	40.1	4.4e-19
WP_004301384.1|2445092_2445437_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009039031.1|2445473_2447714_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.0	1.2e-11
WP_004315140.1|2447786_2449082_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	42.5	5.7e-14
WP_004315141.1|2449115_2450003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301392.1|2450003_2450894_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.3	3.3e-13
WP_004301394.1|2450909_2451674_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.3	7.5e-22
WP_008020629.1|2452029_2452797_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.1	4.7e-32
WP_009039034.1|2452889_2454026_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_141408880.1|2454120_2454921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008642078.1|2455027_2455876_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_008642079.1|2455892_2458046_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G9E4U6	Ostreococcus_lucimarinus_virus	42.6	1.0e-108
WP_004310984.1|2458055_2458415_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_008025715.1|2458887_2459823_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_008640050.1|2459863_2460235_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_004301408.1|2460539_2462393_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_004312092.1|2462478_2463819_-	magnesium transporter	NA	NA	NA	NA	NA
WP_004312093.1|2463880_2464681_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_004315816.1|2464797_2465784_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_141408881.1|2465905_2467363_+	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_087321590.1|2468739_2470407_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_167509095.1|2470760_2476505_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_004301426.1|2476730_2477798_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_004320987.1|2477809_2478901_+	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_004315635.1|2478992_2479910_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004312099.1|2480032_2480896_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004315637.1|2480918_2481947_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_032849615.1|2482065_2483325_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004315639.1|2483359_2484256_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_117683340.1|2484282_2485848_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_141408882.1|2489051_2490260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141408883.1|2490452_2493263_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.4	3.8e-31
WP_008771523.1|2493330_2494638_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	3196968	3258527	6499434	tRNA,transposase,integrase	Erysipelothrix_phage(12.5%)	58	3202019:3202033	3210482:3210496
WP_117860485.1|3196968_3197772_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	24.1	3.4e-09
WP_119979479.1|3197676_3198303_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_167509115.1|3198297_3199434_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_119979480.1|3199533_3199938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117860476.1|3199972_3200914_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_117860475.1|3200903_3201212_-	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_117860474.1|3201351_3202431_-	hypothetical protein	NA	NA	NA	NA	NA
3202019:3202033	attL	GATGTGCCAACCTTG	NA	NA	NA	NA
WP_117860483.1|3202509_3203886_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_015532562.1|3203894_3204263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015532563.1|3204610_3205690_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_117860473.1|3205692_3206817_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015532565.1|3207055_3207943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015532566.1|3208125_3208485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117860472.1|3208493_3209600_-|integrase	site-specific integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	25.6	1.1e-05
WP_117860471.1|3209684_3210587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3210482:3210496	attR	CAAGGTTGGCACATC	NA	NA	NA	NA
WP_141409019.1|3210836_3212234_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_141409020.1|3212368_3214276_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.9	3.9e-35
WP_167509172.1|3214367_3215018_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004302019.1|3215135_3216014_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_004304885.1|3216170_3217172_-	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_009040378.1|3217194_3217665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141409021.1|3217681_3219103_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009040380.1|3219286_3220033_+	adenine nucleotide alpha hydrolase family protein	NA	A0A0U2S5Z2	Escherichia_phage	32.5	4.1e-25
WP_004302024.1|3220048_3220420_+	DMT family protein	NA	NA	NA	NA	NA
WP_004309770.1|3220496_3221510_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004302038.1|3221540_3222122_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_004309771.1|3222128_3222878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004309772.1|3222861_3223446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004309773.1|3223467_3224418_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	30.6	9.3e-22
WP_015532571.1|3224450_3225008_-	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_008640050.1|3225547_3225919_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_008025715.1|3225959_3226895_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_004309775.1|3227110_3227584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141409022.1|3227986_3229267_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	72.9	1.3e-172
WP_008644437.1|3229446_3230109_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004309778.1|3230139_3230517_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_004309779.1|3230874_3233034_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_004302052.1|3233198_3234608_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_141409023.1|3234760_3235984_+	peptidase T	NA	NA	NA	NA	NA
WP_120079044.1|3236045_3237131_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_008644441.1|3237281_3239555_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_120079045.1|3239604_3240030_+	HIT family protein	NA	NA	NA	NA	NA
WP_008021285.1|3240301_3240724_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_032855967.1|3240838_3241405_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004309786.1|3241541_3242132_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_004309787.1|3242269_3242671_-	PUR family DNA/RNA-binding protein	NA	NA	NA	NA	NA
WP_008021289.1|3242839_3243766_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004302063.1|3243805_3244129_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_004313972.1|3244150_3245164_+	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_117684308.1|3245153_3245768_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_004313967.1|3245792_3246221_+	DUF5606 domain-containg protein	NA	NA	NA	NA	NA
WP_004313964.1|3246840_3249429_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.5	7.4e-122
WP_141409024.1|3249662_3251291_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	28.0	7.4e-19
WP_004313961.1|3251461_3252046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118194702.1|3252106_3253003_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008021301.1|3253003_3254725_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_141409025.1|3255017_3256685_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_087321590.1|3256859_3258527_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	4584402	4599265	6499434	portal	unidentified_phage(81.82%)	17	NA	NA
WP_141409289.1|4584402_4585758_+	hypothetical protein	NA	H7BUJ9	unidentified_phage	99.8	1.1e-262
WP_115484561.1|4585759_4586803_+	hypothetical protein	NA	H7BUJ8	unidentified_phage	98.3	9.7e-198
WP_141409290.1|4586799_4588509_+	PHP domain-containing protein	NA	H7BUJ7	unidentified_phage	97.8	7.5e-264
WP_108912208.1|4588511_4588709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008768550.1|4588715_4590017_+	AAA family ATPase	NA	H7BUJ6	unidentified_phage	99.8	9.4e-251
WP_141409291.1|4590023_4592219_+	DNA polymerase III subunit alpha	NA	H7BUJ5	unidentified_phage	99.6	0.0e+00
WP_008647879.1|4592215_4592743_+	ATP-binding cassette domain-containing protein	NA	A0A0E3X9J6	Bacillus_phage	39.7	1.6e-10
WP_008647882.1|4592744_4593518_+	hypothetical protein	NA	H7BUJ3	unidentified_phage	100.0	1.3e-143
WP_008647883.1|4593521_4593803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008647884.1|4593875_4594361_+	hypothetical protein	NA	H7BUJ2	unidentified_phage	100.0	6.2e-14
WP_008647885.1|4594369_4594573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409292.1|4594574_4595255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032846307.1|4595259_4595688_+	hypothetical protein	NA	A0A2I7RVN5	Vibrio_phage	27.8	1.9e-06
WP_008647889.1|4595684_4596200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008768544.1|4596249_4596576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008647899.1|4596668_4598246_+|portal	phage portal protein	portal	H7BUJ0	unidentified_phage	100.0	0.0e+00
WP_141409293.1|4598248_4599265_+	hypothetical protein	NA	H7BUI9	unidentified_phage	99.1	6.3e-194
>prophage 7
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	4680252	4693648	6499434	protease	unidentified_phage(85.71%)	12	NA	NA
WP_004325867.1|4680252_4681974_-	hypothetical protein	NA	H7BUT1	unidentified_phage	98.3	0.0e+00
WP_004325866.1|4681933_4682614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004325865.1|4682594_4682939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004325864.1|4682913_4683588_-	site-specific DNA-methyltransferase	NA	H9YP98	environmental_Halophage	33.6	2.0e-26
WP_004325863.1|4683744_4684692_-	hypothetical protein	NA	H7BUS8	unidentified_phage	96.2	2.3e-161
WP_004325862.1|4684806_4685613_-	hypothetical protein	NA	H7BUS7	unidentified_phage	97.8	5.4e-148
WP_004325861.1|4685671_4687876_-	hypothetical protein	NA	H7BUS6	unidentified_phage	97.8	0.0e+00
WP_004303397.1|4687900_4688767_-|protease	protease	protease	H7BUS5	unidentified_phage	97.2	2.9e-163
WP_017142804.1|4688828_4689230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303399.1|4689350_4689839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004303400.1|4690433_4690748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004325859.1|4690744_4693648_-	hypothetical protein	NA	H7BUS3	unidentified_phage	99.2	0.0e+00
>prophage 8
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	5763118	5818195	6499434	integrase,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	52	5805704:5805763	5813809:5813928
WP_008022065.1|5763118_5764477_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_141409439.1|5764788_5765733_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_004314511.1|5765901_5766627_-	DUF4858 domain-containing protein	NA	NA	NA	NA	NA
WP_008644616.1|5766838_5767363_-	DUF4943 family protein	NA	NA	NA	NA	NA
WP_141409440.1|5767374_5768424_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_004300758.1|5768407_5768959_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004314515.1|5769184_5770033_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_008025787.1|5770025_5770418_-	DUF4783 domain-containing protein	NA	NA	NA	NA	NA
WP_004314516.1|5770545_5771019_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_008644609.1|5771038_5771638_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_004311349.1|5771592_5771892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004311350.1|5771969_5772611_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_008644607.1|5772648_5773104_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	64.4	3.1e-47
WP_004311351.1|5773683_5774343_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.1e-57
WP_004311352.1|5774351_5775032_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	37.1	1.4e-32
WP_008644602.1|5775266_5776271_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	42.1	4.1e-60
WP_032851668.1|5776500_5777007_-	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	30.6	9.4e-13
WP_008644596.1|5777170_5778460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074705501.1|5778577_5779987_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_074705499.1|5780197_5781199_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	44.4	2.0e-59
WP_004314524.1|5781262_5781967_+	pirin family protein	NA	NA	NA	NA	NA
WP_074705496.1|5782010_5782658_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_009041224.1|5782724_5783456_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_120144337.1|5783469_5784615_+	DUF4468 domain-containing protein	NA	NA	NA	NA	NA
WP_004304308.1|5784629_5785007_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_008774710.1|5785318_5785786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004300779.1|5785790_5785976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120144339.1|5786071_5786803_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_141409441.1|5786948_5787551_-	redoxin family protein	NA	NA	NA	NA	NA
WP_087323662.1|5787770_5788658_-	DMT family transporter	NA	NA	NA	NA	NA
WP_141409442.1|5788815_5789349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141408677.1|5789561_5790497_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008640050.1|5790537_5790909_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_004312937.1|5791175_5791391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008774741.1|5791387_5793874_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_141409443.1|5794019_5795300_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_074705482.1|5795284_5796121_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_015532994.1|5796357_5798616_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_162613011.1|5798902_5800369_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_008025832.1|5800641_5801964_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004312925.1|5802068_5803391_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004312924.1|5803597_5804479_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.7	2.1e-28
WP_141409444.1|5804475_5805630_+	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	28.9	2.7e-39
5805704:5805763	attL	AGTTCAGTTGGTTAGAGCGTCAGATTGTGGTTCTGAATGTCGCCGGTTCGAGTCCGGTCT	NA	NA	NA	NA
WP_141409445.1|5805910_5807185_+|integrase	site-specific integrase	integrase	H7BVW5	unidentified_phage	54.5	1.1e-70
WP_141409446.1|5807572_5808100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409447.1|5808260_5810201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409448.1|5810891_5811908_+	DUF3871 family protein	NA	NA	NA	NA	NA
WP_032812064.1|5812945_5813317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008641868.1|5814415_5814790_+	hypothetical protein	NA	NA	NA	NA	NA
5813809:5813928	attR	AGTTCAGTTGGTTAGAGCGTCAGATTGTGGTTCTGAATGTCGCCGGTTCGAGTCCGGTCTTCCACCCAACAAAAACCCTTGTAAGTTAAGTACTTATGAGGGTTTTCTTTTTGTGGGTAG	NA	NA	NA	NA
WP_004316244.1|5814783_5815116_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_141409449.1|5815223_5816993_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.8	9.8e-33
WP_004313273.1|5817031_5818195_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP041230	Bacteroides xylanisolvens strain H207 chromosome, complete genome	6499434	5919187	5988913	6499434	transposase,tRNA	Tupanvirus(12.5%)	56	NA	NA
WP_004300862.1|5919187_5920207_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.2	1.0e-26
WP_141409471.1|5920355_5921555_+	MFS transporter	NA	NA	NA	NA	NA
WP_008644887.1|5921551_5922229_+	endonuclease III	NA	NA	NA	NA	NA
WP_004300866.1|5922322_5923582_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_118195832.1|5923699_5924677_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004314227.1|5924701_5925745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004314226.1|5925875_5927060_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_118195830.1|5927070_5929275_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_087322459.1|5929417_5929999_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_008026011.1|5930069_5930591_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_141409472.1|5930571_5931366_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_008026007.1|5931373_5931709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008771322.1|5931711_5932248_-	NAD(P)H nitroreductase	NA	A0A1V0E011	Clostridioides_phage	32.8	3.9e-17
WP_008026002.1|5932428_5932653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409473.1|5932742_5933285_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_141409474.1|5933435_5934434_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004311398.1|5934609_5935014_+	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_004300890.1|5935042_5936596_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_008644873.1|5936627_5937548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004300895.1|5937572_5938004_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_004300899.1|5938005_5939166_+	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_141409475.1|5939460_5940801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008644872.1|5940885_5941890_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_004300906.1|5942323_5942578_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004300908.1|5942658_5943873_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004300910.1|5944066_5944474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141409476.1|5945206_5945635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008777519.1|5946141_5947755_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	31.6	6.4e-47
WP_004323560.1|5947824_5948334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004304417.1|5949021_5950077_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_141409477.1|5950143_5953176_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_008644859.1|5953224_5954496_+	TolC family protein	NA	NA	NA	NA	NA
WP_004304421.1|5954666_5954930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004300937.1|5955033_5956269_-	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004314195.1|5956268_5958104_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_004300941.1|5958130_5958391_-	OadG family protein	NA	NA	NA	NA	NA
WP_008640050.1|5958716_5959088_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_008025715.1|5959128_5960064_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_141409478.1|5960826_5961666_-	histidine kinase	NA	NA	NA	NA	NA
WP_008771523.1|5961951_5963259_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_141409479.1|5963778_5965353_-	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	26.5	4.2e-35
WP_141409480.1|5965436_5966303_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	38.0	2.5e-34
WP_008651846.1|5966303_5966849_-	DUF4924 family protein	NA	NA	NA	NA	NA
WP_004314184.1|5966860_5967514_-	LysE family transporter	NA	NA	NA	NA	NA
WP_118418171.1|5967773_5971478_+	phosphoribosylformylglycinamidine synthase	NA	A0A0S0BVK5	Lymphocryptovirus	25.8	5.2e-36
WP_141409481.1|5971746_5975757_+	response regulator	NA	W8CYM9	Bacillus_phage	35.9	5.9e-09
WP_004300957.1|5975753_5976296_+	chromate transporter	NA	NA	NA	NA	NA
WP_004300958.1|5976421_5976970_+	chromate transporter	NA	NA	NA	NA	NA
WP_008022065.1|5977155_5978514_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032810880.1|5978800_5980309_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_141409482.1|5980403_5983175_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	44.5	2.1e-223
WP_087323871.1|5983272_5983758_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_004300962.1|5983762_5983993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118407255.1|5983989_5985420_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_141409483.1|5985529_5986996_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_004297445.1|5987911_5988913_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
