The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041125	Serratia marcescens strain WVU-004 chromosome, complete genome	5307451	1130161	1208314	5307451	capsid,lysis,terminase,tRNA,tail,transposase,head,holin,integrase,protease,portal	Salmonella_phage(39.58%)	93	1147187:1147202	1200873:1200888
WP_050438932.1|1130161_1130803_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004940192.1|1130770_1131457_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.5	4.4e-05
WP_060440543.1|1131453_1133886_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043146773.1|1133955_1135023_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_073529319.1|1135019_1135544_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_060440541.1|1135693_1136416_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004940183.1|1136426_1136921_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_038875101.1|1137230_1138616_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	34.7	2.9e-40
WP_049278727.1|1138677_1138890_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004940177.1|1138900_1139767_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	9.0e-32
WP_077267529.1|1139999_1140182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958154.1|1140696_1141818_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	75.2	8.1e-166
WP_141958157.1|1142051_1142243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958159.1|1142239_1142449_-	hypothetical protein	NA	E5AGD4	Erwinia_phage	50.0	3.6e-11
WP_141958161.1|1142441_1142663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958163.1|1142733_1142988_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.3	8.5e-23
WP_060429108.1|1142997_1143258_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	56.6	2.2e-18
WP_141958165.1|1143315_1143933_-	hypothetical protein	NA	R9W0X9	Serratia_phage	46.8	1.5e-36
WP_141958168.1|1144102_1144324_-	hypothetical protein	NA	K4F9X1	Cronobacter_phage	52.2	3.8e-11
WP_141958170.1|1144325_1144751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958172.1|1144740_1144941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958174.1|1144937_1145153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958176.1|1145145_1145406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958178.1|1145398_1146295_-	phosphoadenosine phosphosulfate reductase family protein	NA	S4TN48	Salmonella_phage	79.0	2.5e-141
WP_141960596.1|1146281_1146800_-	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	73.5	2.0e-63
WP_141960598.1|1146814_1147480_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	50.7	4.5e-31
1147187:1147202	attL	TTCATATTTGCCCTGA	NA	NA	NA	NA
WP_072274585.1|1147578_1147758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958180.1|1147766_1148099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958182.1|1148126_1148582_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	66.7	1.1e-52
WP_141958185.1|1148582_1149209_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	66.0	1.5e-68
WP_141958187.1|1149497_1149629_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	60.5	1.2e-07
WP_141958189.1|1149785_1150025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958191.1|1150144_1150342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071883557.1|1150359_1150608_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	36.7	1.6e-05
WP_141958193.1|1151231_1151966_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNG6	Salmonella_phage	65.8	4.9e-87
WP_060430772.1|1152083_1152311_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	76.0	4.0e-24
WP_004940137.1|1152420_1152699_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	56.7	9.6e-20
WP_141958195.1|1152884_1153784_+	DNA replication protein	NA	E7C9R4	Salmonella_phage	74.9	5.6e-117
WP_141958197.1|1153770_1155183_+	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	61.3	8.9e-162
WP_141958199.1|1155206_1155446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958201.1|1155449_1155689_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	60.6	2.8e-20
WP_141958203.1|1155691_1156144_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	51.7	8.0e-40
WP_141958206.1|1156140_1156311_+	NinE family protein	NA	NA	NA	NA	NA
WP_141958208.1|1156307_1156499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958210.1|1156858_1156987_+	protein ninF	NA	NA	NA	NA	NA
WP_141958212.1|1156979_1157561_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	43.5	1.3e-34
WP_141958214.1|1157908_1158400_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	79.8	9.5e-71
WP_042784831.1|1158827_1159154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004940112.1|1159150_1159483_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	74.3	1.0e-44
WP_141958216.1|1159466_1159901_+	glycoside hydrolase family protein	NA	Q5G8R3	Enterobacteria_phage	71.0	6.7e-52
WP_141958218.1|1159897_1160365_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	69.7	1.2e-54
WP_141958220.1|1160376_1160625_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	53.8	1.2e-13
WP_141958222.1|1160698_1160935_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	56.8	7.9e-15
WP_141958224.1|1161584_1161917_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_141958226.1|1161919_1162360_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	89.7	9.8e-75
WP_141958228.1|1162356_1163769_+|terminase	PBSX family phage terminase large subunit	terminase	Q9AZ00	Salmonella_phage	93.4	1.2e-264
WP_141958230.1|1163771_1165898_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	89.1	0.0e+00
WP_141958232.1|1165911_1166796_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	74.1	7.2e-101
WP_141958234.1|1166807_1168082_+|head	head protein	head	Q716H0	Shigella_phage	92.2	1.8e-222
WP_141958236.1|1168121_1168307_+	hypothetical protein	NA	Q716G9	Shigella_phage	78.7	3.4e-21
WP_004940081.1|1168281_1168764_+|head	head DNA stabilization protein	head	Q716G8	Shigella_phage	83.6	7.4e-76
WP_141958238.1|1168771_1170199_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	70.3	3.5e-206
WP_141958240.1|1170201_1170696_+	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	46.6	1.2e-33
WP_141958242.1|1170692_1171604_+|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	55.8	2.5e-32
WP_141958244.1|1171603_1172062_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	83.7	2.0e-70
WP_141958246.1|1172072_1172771_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	49.2	4.9e-36
WP_141958249.1|1172770_1174225_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	72.5	7.5e-172
WP_141958251.1|1174224_1176012_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	51.5	2.0e-126
WP_141958253.1|1176202_1176679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958255.1|1176681_1177083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958257.1|1177082_1177322_-	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	74.4	2.9e-25
WP_141958260.1|1180436_1181642_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.0	2.8e-132
WP_141958262.1|1182045_1184262_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077038822.1|1184276_1184735_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_038880661.1|1184746_1186051_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_077038925.1|1186467_1187589_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_141958265.1|1187608_1190704_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.2	5.3e-50
WP_141958267.1|1190715_1192143_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_126171419.1|1192242_1193211_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_141958270.1|1193379_1195032_+	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	27.5	2.7e-08
WP_141958272.1|1195216_1195801_+	LysE family transporter	NA	NA	NA	NA	NA
WP_141958274.1|1196909_1198103_+	gluconolaconase	NA	NA	NA	NA	NA
WP_141958276.1|1198240_1198768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958278.1|1198703_1199708_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_141958280.1|1200207_1200756_+	fimbrial protein	NA	NA	NA	NA	NA
WP_141960600.1|1200839_1201385_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
1200873:1200888	attR	TTCATATTTGCCCTGA	NA	NA	NA	NA
WP_141958282.1|1201449_1204089_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_126171449.1|1204188_1204941_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_126171429.1|1205004_1205664_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_126171430.1|1205674_1206178_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171431.1|1206191_1206692_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171432.1|1206702_1207275_+	fimbrial protein	NA	NA	NA	NA	NA
WP_126171433.1|1207267_1208314_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041125	Serratia marcescens strain WVU-004 chromosome, complete genome	5307451	2092047	2135592	5307451	terminase,plate,tail,head,holin,integrase	Pectobacterium_phage(64.1%)	59	2091946:2091969	2140456:2140479
2091946:2091969	attL	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
WP_141958829.1|2092047_2093130_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.6	1.1e-98
WP_072022390.1|2093104_2093377_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.2	3.4e-09
WP_060444327.1|2093452_2093956_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.9	1.5e-34
WP_141958831.1|2093952_2096085_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	5.2e-97
WP_141958833.1|2096099_2096420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958835.1|2096741_2096975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141958836.1|2097111_2097423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116286447.1|2097435_2097609_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_082245749.1|2097631_2097829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116286446.1|2098092_2098536_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.3	1.3e-05
WP_116286445.1|2098603_2098840_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.9	1.6e-15
WP_141958838.1|2098859_2099324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958840.1|2099338_2099566_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_141958842.1|2099605_2100604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082245762.1|2100619_2101003_+	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	58.7	2.3e-40
WP_141958844.1|2101018_2101444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958846.1|2101481_2102309_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	43.1	2.9e-56
WP_141958848.1|2102305_2102713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958850.1|2102705_2103008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958852.1|2103169_2104276_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.5	5.4e-21
WP_141958854.1|2104282_2106541_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_060444338.1|2107034_2107631_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	53.5	5.2e-55
WP_116286438.1|2107627_2107915_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	64.5	1.5e-28
WP_141958856.1|2107911_2108562_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	29.3	2.4e-21
WP_141958858.1|2108818_2109142_+|holin	phage holin, lambda family	holin	Q8LTF0	Salmonella_phage	46.5	3.4e-16
WP_141958860.1|2109134_2109524_+	M15 family metallopeptidase	NA	S4TRL9	Salmonella_phage	69.8	1.4e-48
WP_141958862.1|2109520_2109904_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_141958864.1|2109842_2110061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033638085.1|2110387_2110606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958866.1|2110990_2111500_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	48.4	1.3e-35
WP_141958868.1|2111496_2112111_+	protein Mom	NA	C9E2P8	Enterococcus_phage	61.6	7.5e-65
WP_033638087.1|2112113_2112371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958870.1|2112378_2113374_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.8	1.8e-60
WP_141958872.1|2113373_2115014_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	79.6	5.3e-267
WP_141958874.1|2115016_2116417_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	67.0	4.2e-180
WP_141960647.1|2116466_2117219_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	68.7	1.8e-92
WP_141958876.1|2117227_2118409_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	64.8	8.9e-107
WP_141958878.1|2118408_2118936_+	hypothetical protein	NA	H9C195	Pectobacterium_phage	58.4	8.7e-46
WP_060444351.1|2118989_2119928_+	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	72.4	7.8e-130
WP_050596002.1|2119928_2120270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958880.1|2120329_2120752_+	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	61.0	2.4e-38
WP_033638095.1|2120748_2121216_+	hypothetical protein	NA	H9C199	Pectobacterium_phage	83.2	5.7e-65
WP_033638096.1|2121218_2121638_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	80.7	8.2e-63
WP_141958882.1|2121637_2122174_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	50.8	9.5e-40
WP_141958884.1|2122189_2123440_+	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	62.3	1.5e-144
WP_033638099.1|2123446_2123851_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	79.1	3.5e-55
WP_141958886.1|2123850_2124249_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	60.5	1.4e-35
WP_072022396.1|2124509_2124716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958888.1|2124770_2125262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958890.1|2125326_2126997_+	glycoside hydrolase family protein	NA	H9C1A7	Pectobacterium_phage	43.0	1.5e-107
WP_141958892.1|2126996_2127695_+	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	40.6	2.7e-34
WP_141960649.1|2127699_2127981_+	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	59.6	8.5e-24
WP_141958894.1|2127973_2128873_+	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	48.5	2.7e-79
WP_141958896.1|2128880_2129483_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	51.4	1.9e-57
WP_033638104.1|2129497_2129848_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	70.4	1.9e-41
WP_141958898.1|2129847_2131053_+|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	62.7	1.8e-142
WP_141958900.1|2131045_2131900_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	53.5	4.1e-77
WP_141958902.1|2131925_2133557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141958904.1|2133609_2135592_+|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	37.0	8.0e-92
2140456:2140479	attR	AGGAATCGTATTCGGTCTTTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP041125	Serratia marcescens strain WVU-004 chromosome, complete genome	5307451	2300315	2341285	5307451	coat,protease	Moraxella_phage(25.0%)	38	NA	NA
WP_141959028.1|2300315_2301734_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|2301880_2302090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|2302866_2303259_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060419277.1|2303263_2303863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100396313.1|2303918_2304158_-	YebV family protein	NA	NA	NA	NA	NA
WP_060440091.1|2304293_2305226_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_141960660.1|2305245_2307588_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_049201714.1|2307739_2308507_-	molecular chaperone	NA	NA	NA	NA	NA
WP_141959029.1|2308528_2309071_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_038877669.1|2309064_2309568_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060440090.1|2309570_2310107_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_060419268.1|2310381_2310918_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_141959031.1|2311190_2312627_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_087763559.1|2312729_2315360_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049198592.1|2315328_2316576_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_126180031.1|2316831_2317329_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|2317425_2318136_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|2318155_2320204_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_038877656.1|2320271_2321117_-	DMT family transporter	NA	NA	NA	NA	NA
WP_141959033.1|2321113_2322421_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_060440085.1|2322413_2323211_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_087763515.1|2323198_2323984_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	8.8e-10
WP_060440083.1|2323980_2325021_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_089185885.1|2325023_2326115_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638291.1|2326485_2327364_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_102984783.1|2327414_2328809_-	MFS transporter	NA	NA	NA	NA	NA
WP_049274096.1|2329039_2329831_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_141959035.1|2329877_2330681_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_141959037.1|2330683_2331547_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_141959039.1|2331548_2332685_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	7.4e-26
WP_141959041.1|2332681_2333692_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102984780.1|2333866_2334586_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_141959043.1|2334741_2335845_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_141959045.1|2335854_2336664_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_089185892.1|2336728_2338126_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_141959047.1|2338301_2338850_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_049198577.1|2339274_2339940_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_141959049.1|2340004_2341285_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP041125	Serratia marcescens strain WVU-004 chromosome, complete genome	5307451	4071799	4132382	5307451	tRNA,tail	Enterobacteria_phage(13.04%)	63	NA	NA
WP_015378796.1|4071799_4072306_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.2	4.5e-07
WP_070914449.1|4072423_4073476_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_141959967.1|4073523_4074180_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_070914445.1|4074183_4075551_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_087762398.1|4075569_4076463_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_033654299.1|4076630_4077479_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141960711.1|4077730_4079167_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_025303942.1|4079258_4079519_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
WP_019452319.1|4079564_4079945_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_141959969.1|4079944_4080676_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004929165.1|4080747_4081479_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004929162.1|4081485_4082394_-	GTPase Era	NA	NA	NA	NA	NA
WP_004929158.1|4082390_4083071_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.3	9.6e-21
WP_033644122.1|4083306_4084284_-	signal peptidase I	NA	NA	NA	NA	NA
WP_033648940.1|4084316_4086116_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	3.2e-23
WP_141959971.1|4086634_4087471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141959972.1|4087467_4087944_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_141959973.1|4087943_4088900_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_049200771.1|4088899_4089553_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004929136.1|4089583_4090159_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_043128468.1|4090337_4091975_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_141959975.1|4092013_4092793_-	methyltransferase	NA	NA	NA	NA	NA
WP_016929798.1|4092892_4094215_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	3.6e-40
WP_141959977.1|4094267_4095023_-	ankyrin repeat domain-containing protein	NA	Q9JMM8	Wolbachia_phage	39.2	8.2e-05
WP_141959979.1|4095015_4095978_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_004929114.1|4096161_4096545_-	autonomous glycyl radical cofactor GrcA	NA	C3V1I5	Escherichia_virus	70.2	6.1e-33
WP_033635636.1|4096891_4097575_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.9	2.5e-53
WP_025303955.1|4097630_4098215_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_019452304.1|4098340_4099219_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_089186358.1|4099305_4100967_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004929101.1|4101207_4101546_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_087762394.1|4101664_4101949_-	RnfH family protein	NA	NA	NA	NA	NA
WP_086016675.1|4101941_4102430_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004929094.1|4102537_4103020_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	4.1e-26
WP_141959981.1|4103567_4104704_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_046687688.1|4104713_4105058_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_041036393.1|4105096_4105750_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_085337239.1|4105885_4106821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141960713.1|4106876_4108490_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_141959983.1|4108609_4109020_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_141959985.1|4109138_4109591_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141959987.1|4109691_4110426_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	43.2	1.8e-52
WP_141959989.1|4110487_4110985_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141959991.1|4111070_4111997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141959993.1|4111991_4112507_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_025303973.1|4112627_4112810_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_047730014.1|4112842_4113121_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016929825.1|4113122_4113353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016929826.1|4113544_4113958_+	DoxX family protein	NA	NA	NA	NA	NA
WP_141959995.1|4114036_4115983_-	hypothetical protein	NA	W6ATR4	Escherichia_phage	58.5	4.0e-43
WP_141959997.1|4116104_4118138_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	44.8	2.6e-29
WP_141959999.1|4118195_4123949_-	DUF1983 domain-containing protein	NA	M9P0D8	Enterobacteria_phage	55.8	6.4e-291
WP_060441078.1|4123967_4124588_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	53.2	1.4e-55
WP_141960001.1|4124584_4125295_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	56.6	1.7e-81
WP_141960004.1|4125297_4126050_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	57.0	5.9e-88
WP_141960006.1|4126058_4126400_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	42.0	6.1e-16
WP_141960008.1|4126474_4128919_-|tail	phage tail tape measure protein	tail	A0A1W6DXJ0	Citrobacter_phage	30.3	1.8e-85
WP_141960715.1|4128974_4129208_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	60.6	1.4e-16
WP_019455561.1|4129276_4129630_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	54.3	5.0e-29
WP_019455562.1|4129703_4130366_-|tail	tail protein	tail	I6PBN6	Cronobacter_phage	64.5	6.8e-72
WP_141960010.1|4130492_4131002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123892442.1|4131168_4131537_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	56.7	6.1e-30
WP_019455565.1|4131710_4132382_+	hypothetical protein	NA	U5P0T5	Shigella_phage	67.3	6.7e-83
>prophage 5
NZ_CP041125	Serratia marcescens strain WVU-004 chromosome, complete genome	5307451	4372470	4384953	5307451	integrase,tRNA	Morganella_phage(30.0%)	15	4366687:4366703	4383215:4383231
4366687:4366703	attL	TGGAGCGGGTGAAGGGA	NA	NA	NA	NA
WP_141960153.1|4372470_4373775_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	27.5	2.3e-26
WP_141960735.1|4373774_4374407_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	70.0	2.8e-54
WP_110147368.1|4374459_4374927_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	73.0	1.1e-60
WP_141960155.1|4375601_4377737_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	60.1	5.4e-203
WP_141960736.1|4377794_4378196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110147377.1|4378318_4378543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960157.1|4378539_4378734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960160.1|4378717_4379533_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	55.8	1.8e-18
WP_141960738.1|4379513_4379699_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_141960162.1|4379701_4380307_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.4	2.7e-51
WP_141960740.1|4380320_4380752_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	3.0e-28
WP_141960164.1|4380751_4380949_-	AlpA family phage regulatory protein	NA	G8DCP6	Silicibacter_phage	37.9	1.6e-05
WP_141960166.1|4381087_4381690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141960168.1|4381835_4383050_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	1.6e-143
WP_033649459.1|4383435_4384953_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.2	7.7e-87
4383215:4383231	attR	TGGAGCGGGTGAAGGGA	NA	NA	NA	NA
