The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022310	Streptomyces asterosporus strain DSM 41452 chromosome, complete genome	7766581	3780242	3822263	7766581	integrase,plate,tail	Streptomyces_phage(37.5%)	41	3805110:3805157	3822343:3822390
WP_142232362.1|3780242_3781802_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.4	1.1e-67
WP_142194167.1|3781837_3782278_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_142232363.1|3782274_3782772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540787.1|3782768_3782927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232364.1|3783990_3786057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142194164.1|3786143_3786569_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_142194163.1|3786624_3787347_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142194162.1|3787343_3789167_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_142232365.1|3789341_3789659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232366.1|3789658_3790081_+	GPW/gp25 family protein	NA	A0A1D8KT65	Synechococcus_phage	31.2	5.8e-08
WP_142232367.1|3790080_3792054_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_142232368.1|3792091_3792655_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_142232369.1|3792659_3793898_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_167530055.1|3793936_3794554_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_142232371.1|3794921_3796211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232372.1|3796295_3797483_-	peptidase S1 and S6	NA	A0A0A0RLZ4	Streptomyces_phage	68.8	2.6e-29
WP_142194153.1|3797857_3798166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142232373.1|3798325_3799321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142194151.1|3799454_3799889_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_142232374.1|3799892_3801191_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.3	4.8e-53
WP_142232375.1|3801721_3802156_+	NfeD family protein	NA	NA	NA	NA	NA
WP_142232376.1|3802185_3803286_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_142194147.1|3803825_3804659_-	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
3805110:3805157	attL	TGGAGCGGGTGACGAGAATCGAACTCGCGCTCTCAGCTTGGGAAGCTG	NA	NA	NA	NA
WP_142232377.1|3805342_3805807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167530056.1|3806646_3808050_+	N-6 DNA methylase	NA	A0A220A2U5	Liberibacter_phage	29.5	9.2e-18
WP_142232379.1|3808172_3809666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232380.1|3809662_3811225_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_142232381.1|3812452_3813550_-	DUF1152 domain-containing protein	NA	NA	NA	NA	NA
WP_142232382.1|3813694_3814435_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_142232383.1|3814712_3815153_+	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	36.3	4.6e-08
WP_142232384.1|3815239_3815968_+	UTRA domain-containing protein	NA	A0A291LID1	Streptomyces_phage	61.3	6.7e-20
WP_142232385.1|3816100_3816451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232386.1|3816456_3817830_+	conjugal transfer protein TraS	NA	NA	NA	NA	NA
WP_142232387.1|3817910_3818567_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_104783024.1|3818585_3818777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232388.1|3818776_3818968_+	Mobile element transfer	NA	NA	NA	NA	NA
WP_037765200.1|3818977_3819172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142232389.1|3819198_3819456_+	SpdD protein	NA	NA	NA	NA	NA
WP_142232390.1|3819586_3820888_+	replication initiation protein	NA	NA	NA	NA	NA
WP_142232391.1|3820884_3821097_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_142232392.1|3821096_3822263_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BXY4	Mycobacterium_phage	34.4	4.9e-49
3822343:3822390	attR	TGGAGCGGGTGACGAGAATCGAACTCGCGCTCTCAGCTTGGGAAGCTG	NA	NA	NA	NA
