The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019700	Stella humosa strain ATCC 43930	5832650	1613867	1625988	5832650	protease,tRNA	uncultured_Mediterranean_phage(80.0%)	14	NA	NA
WP_123689229.1|1613867_1614959_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	38.6	1.1e-23
WP_123689228.1|1614972_1615695_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_123689227.1|1615707_1616538_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.0	6.6e-40
WP_123689226.1|1616534_1617197_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	46.6	2.4e-40
WP_123689225.1|1617183_1618302_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.3	3.1e-16
WP_123689224.1|1618412_1618610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123689223.1|1618643_1619207_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_123689222.1|1619219_1620074_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	53.0	2.3e-59
WP_123689221.1|1620117_1621407_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.9	1.6e-96
WP_123689220.1|1621403_1622180_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.3	1.2e-38
WP_123689219.1|1622176_1622833_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.3	4.3e-34
WP_123689858.1|1623342_1624596_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	39.4	6.5e-15
WP_123689218.1|1624546_1625410_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_123689217.1|1625634_1625988_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	57.0	8.8e-18
>prophage 2
NZ_AP019700	Stella humosa strain ATCC 43930	5832650	2572391	2581296	5832650		Staphylococcus_phage(57.14%)	11	NA	NA
WP_123688191.1|2572391_2573099_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.6e-10
WP_123688798.1|2573101_2573446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123688192.1|2573582_2574707_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_123688193.1|2574862_2575312_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	42.6	1.7e-18
WP_123688194.1|2575591_2576041_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_123688195.1|2576095_2577379_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.8	2.7e-101
WP_123688196.1|2577412_2577871_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_123688197.1|2577905_2578997_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.2	3.9e-40
WP_123688198.1|2579124_2579718_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.4	9.3e-20
WP_123688199.1|2579714_2580836_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.9	3.5e-60
WP_123688200.1|2580837_2581296_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	34.0	4.5e-14
>prophage 3
NZ_AP019700	Stella humosa strain ATCC 43930	5832650	4613115	4652044	5832650	head,capsid,integrase,protease,terminase,portal	Burkholderia_virus(25.0%)	37	4637110:4637159	4653762:4653811
WP_123691977.1|4613115_4614144_-|protease	serine protease	protease	NA	NA	NA	NA
WP_123692884.1|4614253_4615348_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_123691979.1|4615501_4615888_+	VOC family protein	NA	NA	NA	NA	NA
WP_123691981.1|4616021_4618085_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_170216570.1|4618109_4623365_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_170216571.1|4623630_4625397_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_123691986.1|4625460_4626762_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_123691988.1|4626907_4628035_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_123691989.1|4628144_4628726_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_123691992.1|4628722_4630042_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_123691993.1|4630147_4630876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123691995.1|4630909_4631314_+	VOC family protein	NA	NA	NA	NA	NA
WP_123691998.1|4631318_4631771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_123691999.1|4631836_4633084_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_123692001.1|4633169_4634360_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_123692003.1|4634463_4635045_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_170216572.1|4635251_4636349_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_123692007.1|4636360_4636681_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_123692009.1|4636667_4636913_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
4637110:4637159	attL	GAAACTGGAGCGGGCGAGGCGATTCGAACGCCCGACCCCAACCTTGGCAA	NA	NA	NA	NA
WP_123692011.1|4637338_4638589_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_142235851.1|4638802_4639684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123692013.1|4639751_4639943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123692015.1|4640485_4640989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123692017.1|4641110_4641557_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_123692019.1|4641823_4642279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123692021.1|4642471_4643110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123692887.1|4643322_4643553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142235852.1|4643565_4643967_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_123692025.1|4643963_4646468_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_170216573.1|4646827_4646986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142235853.1|4647110_4648331_+|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	31.9	1.7e-52
WP_123692031.1|4648327_4648867_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	43.0	6.7e-25
WP_123692034.1|4648869_4650036_+|capsid	phage major capsid protein	capsid	A0A141GEW2	Brucella_phage	33.0	2.6e-34
WP_123692036.1|4650092_4650521_+	hypothetical protein	NA	B0VK34	Azospirillum_phage	61.3	9.9e-40
WP_123692038.1|4650523_4651144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123692040.1|4651158_4651491_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_123692042.1|4651651_4652044_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
4653762:4653811	attR	GAAACTGGAGCGGGCGAGGCGATTCGAACGCCCGACCCCAACCTTGGCAA	NA	NA	NA	NA
