The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	974509	1006619	4734883	integrase,transposase,tRNA	unidentified_phage(40.0%)	30	966925:966984	998814:998891
966925:966984	attL	TAACAAAAAAACCCACTAAAACTTGCGATTTTAGTGGGTTTTTAGCTGCAATTAGCTGTA	NA	NA	NA	NA
WP_141981345.1|974509_974893_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008670537.1|975009_976239_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.2	1.5e-24
WP_005825818.1|976266_977478_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.1	3.3e-16
WP_005641696.1|977544_977838_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074668675.1|977850_978054_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057253621.1|978337_979924_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004294670.1|980004_980370_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004294671.1|980353_980788_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005825814.1|981140_981353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165859734.1|982811_983072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141981347.1|983169_987135_-	response regulator	NA	W8CYM9	Bacillus_phage	31.2	9.9e-09
WP_008643590.1|987330_987501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117700270.1|988065_988308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077153709.1|988408_988687_+	DNA methylase	NA	NA	NA	NA	NA
WP_077153708.1|988895_990023_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_117512134.1|990221_991316_+	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_117589731.1|991332_992220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117589737.1|992240_993128_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_117589730.1|993162_994725_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_117689034.1|994747_996454_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_141981349.1|997589_998705_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141981351.1|999074_1000367_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	40.2	2.9e-74
998814:998891	attR	TAACAAAAAAACCCACTAAAACTTGCGATTTTAGTGGGTTTTTAGCTGCAATTAGCTGTATCGTAGTTGGACTACCAG	NA	NA	NA	NA
WP_005831054.1|1000474_1001140_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005831056.1|1001136_1001358_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	57.6	1.3e-16
WP_009037549.1|1001354_1001771_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_005834069.1|1001962_1002715_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005831062.1|1002719_1003451_-	DUF4271 domain-containing protein	NA	NA	NA	NA	NA
WP_034526017.1|1003447_1004035_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_008662365.1|1004335_1005157_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_008666211.1|1005455_1006619_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	1500034	1538961	4734883	integrase,transposase	Nonlabens_phage(50.0%)	25	1529158:1529171	1539214:1539227
WP_005824461.1|1500034_1500988_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_141981478.1|1501149_1502253_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_117588588.1|1502284_1503226_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_022401131.1|1503228_1503555_-	hipA domain-containing protein	NA	NA	NA	NA	NA
WP_005824474.1|1503554_1503779_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005824477.1|1504236_1504632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005824483.1|1508256_1509204_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_117681198.1|1509541_1512853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005825747.1|1512943_1513285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005825750.1|1513449_1514577_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005833614.1|1514920_1515154_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_141981479.1|1515718_1516672_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167498128.1|1517108_1520318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008666211.1|1520526_1521690_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005825841.1|1521745_1522084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005825839.1|1522259_1522883_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_118132344.1|1523283_1525374_+	DUF3874 domain-containing protein	NA	I6R9Q6	Nonlabens_phage	27.1	3.7e-23
WP_008661891.1|1525370_1525832_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_141981482.1|1525853_1528319_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_057281913.1|1528776_1531761_-	hypothetical protein	NA	NA	NA	NA	NA
1529158:1529171	attL	TGTGATTTCAGTAT	NA	NA	NA	NA
WP_005833603.1|1533315_1533687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157132528.1|1533679_1533808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008661927.1|1533931_1536814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141982151.1|1537250_1537580_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141981483.1|1537731_1538961_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	29.3	5.4e-22
1539214:1539227	attR	ATACTGAAATCACA	NA	NA	NA	NA
>prophage 3
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	1653141	1703850	4734883	integrase,transposase	Streptococcus_phage(44.44%)	56	1644541:1644555	1659253:1659267
1644541:1644555	attL	CATCCAAGCGTATGT	NA	NA	NA	NA
WP_005812874.1|1653141_1654389_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.2	1.4e-12
WP_007837349.1|1654625_1655354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004320284.1|1655487_1655856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005812869.1|1655899_1656241_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005812867.1|1656243_1657350_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005812865.1|1657550_1658450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005812863.1|1658606_1659578_+	hypothetical protein	NA	NA	NA	NA	NA
1659253:1659267	attR	ACATACGCTTGGATG	NA	NA	NA	NA
WP_005812861.1|1659565_1660345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007837351.1|1660341_1661112_+	serine/threonine protein phosphatase	NA	A0A067XQN2	Caulobacter_phage	26.9	2.0e-14
WP_005812857.1|1661333_1661786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005812854.1|1661782_1662115_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_007837354.1|1662173_1662539_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
WP_005816074.1|1662587_1662887_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
WP_008021336.1|1663009_1665715_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_007837399.1|1665965_1668476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816118.1|1668490_1669216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816119.1|1669243_1670008_+	DUF5045 domain-containing protein	NA	NA	NA	NA	NA
WP_005816120.1|1670051_1670882_+	hypothetical protein	NA	A0A1Q1PVU2	Staphylococcus_phage	41.5	3.1e-53
WP_005816121.1|1670897_1671299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816122.1|1671298_1672429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816123.1|1672494_1672896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816126.1|1672899_1673514_+	conjugative transposon protein TraK	NA	NA	NA	NA	NA
WP_005816127.1|1673526_1673946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816128.1|1673929_1675072_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_005816133.1|1675141_1675987_+	conjugative transposon protein TraN	NA	NA	NA	NA	NA
WP_005816135.1|1675986_1676532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007837400.1|1676528_1677194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816138.1|1677260_1678169_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_005816140.1|1678249_1680439_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_005816141.1|1680492_1680990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005816149.1|1681078_1682287_+	putative resistance-associated DNA invertase	NA	NA	NA	NA	NA
WP_117741745.1|1682744_1683365_+	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
WP_008021343.1|1683465_1684668_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	29.9	3.9e-09
WP_005816213.1|1684711_1685833_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007837417.1|1685829_1688943_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005816221.1|1688943_1690302_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_007837420.1|1690523_1690865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074909365.1|1690762_1691089_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_007750450.1|1691188_1692478_-|transposase	IS1380-like element IS614 family transposase	transposase	NA	NA	NA	NA
WP_004295325.1|1692825_1694172_+|transposase	IS1380-like element IS616 family transposase	transposase	NA	NA	NA	NA
WP_141981496.1|1694487_1695222_+	23S ribosomal RNA methyltransferase Erm	NA	E4ZFQ0	Streptococcus_phage	50.0	1.3e-58
WP_007897440.1|1695400_1695595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007897433.1|1695575_1695926_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_008144451.1|1695980_1696187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_007897432.1|1696143_1697499_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.2	8.0e-35
WP_007897431.1|1698011_1698197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007897429.1|1698189_1698444_+	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	58.5	9.4e-06
WP_007897428.1|1698466_1699336_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	89.3	3.7e-150
WP_007897427.1|1699316_1700057_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	91.0	3.6e-130
WP_141981498.1|1700094_1700589_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_007837436.1|1700638_1700824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007664626.1|1700748_1701201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007664625.1|1701241_1701544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008021364.1|1701781_1702276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007837439.1|1702209_1702410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007664617.1|1702563_1703850_-|transposase	IS1380-like element ISBaov1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	2839288	2876987	4734883	protease,capsid,head,tail,transposase,tRNA,portal,terminase	Burkholderia_virus(22.22%)	46	NA	NA
WP_008666211.1|2839288_2840452_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_141982168.1|2842090_2843338_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_005827864.1|2843351_2844227_+	DUF3869 domain-containing protein	NA	NA	NA	NA	NA
WP_005827866.1|2844267_2845407_+	OmpA family protein	NA	NA	NA	NA	NA
WP_034523133.1|2845534_2846287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005827870.1|2846402_2846828_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005827872.1|2846871_2847429_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	33.3	1.2e-13
WP_141981708.1|2847546_2849607_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005836068.1|2849686_2851627_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.5	5.2e-120
WP_005827878.1|2851747_2852350_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.6	1.9e-12
WP_005827880.1|2852417_2852615_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004289896.1|2852715_2853066_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005827882.1|2853604_2854912_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_009036846.1|2854942_2855524_-	indolepyruvate oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_005827886.1|2855528_2857121_-	indolepyruvate ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_117681625.1|2857197_2858235_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_117681632.1|2858300_2859212_-	TolB family protein	NA	NA	NA	NA	NA
WP_165859505.1|2859406_2859565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118274140.1|2860724_2861030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118274138.1|2861101_2861350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167498136.1|2861402_2862119_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_117959339.1|2862265_2862529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167498137.1|2862571_2862742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959338.1|2862777_2862963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959350.1|2862973_2863195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959336.1|2863616_2864123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959335.1|2864103_2864946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959334.1|2864964_2865414_+	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_117959348.1|2865469_2865805_+	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	49.6	5.1e-15
WP_118274136.1|2865959_2866616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959333.1|2866609_2867188_+	hypothetical protein	NA	S4U0J1	uncultured_phage	27.8	2.8e-05
WP_117959332.1|2867192_2867519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959331.1|2867563_2867884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959330.1|2867876_2868068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959329.1|2868064_2868250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959327.1|2868724_2868991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117959326.1|2869266_2869503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959325.1|2869513_2869774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959324.1|2869770_2870100_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_117959323.1|2870234_2871152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117959322.1|2871431_2871788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117959321.1|2871777_2873481_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	30.7	2.2e-50
WP_117959320.1|2873485_2874730_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	27.8	4.5e-32
WP_118274132.1|2874751_2875330_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	33.1	1.0e-15
WP_117959318.1|2875332_2876463_+|capsid	phage major capsid protein	capsid	S0A3Y1	Cellulophaga_phage	24.6	6.1e-12
WP_167498138.1|2876546_2876987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 5
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	2909668	2966418	4734883	integrase,transposase,protease	unidentified_phage(20.0%)	47	2958640:2958659	2966303:2966322
WP_117713978.1|2909668_2910580_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_057256087.1|2910597_2912733_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_008663017.1|2912865_2913429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034528967.1|2913421_2915332_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.3	2.4e-24
WP_005827948.1|2915358_2917104_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_009036859.1|2917149_2917488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009036860.1|2917639_2919964_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_009036861.1|2920038_2920917_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005827959.1|2920979_2921741_+	creatininase family protein	NA	NA	NA	NA	NA
WP_005827961.1|2921928_2922351_-	hypothetical protein	NA	A0A2H4JDQ6	uncultured_Caudovirales_phage	50.0	5.4e-14
WP_005827963.1|2922390_2923707_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005827964.1|2923736_2924984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005827966.1|2925025_2925736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005827968.1|2925729_2926839_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3I398	Synechococcus_phage	67.1	4.1e-130
WP_005827970.1|2926871_2927591_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_005827972.1|2927744_2928845_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	44.7	6.4e-83
WP_005827975.1|2928881_2930000_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_167498150.1|2931060_2931297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141981712.1|2931542_2932772_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	32.2	7.5e-24
WP_004311260.1|2932791_2934003_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.4	8.8e-17
WP_004311261.1|2934067_2934361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083810220.1|2934373_2934577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005651718.1|2934710_2934902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015547181.1|2935238_2939027_+	restriction endonuclease	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.3	2.7e-11
WP_005680425.1|2939988_2940597_-	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	70.1	3.6e-67
WP_004297199.1|2942060_2943086_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015547183.1|2943949_2944183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011203107.1|2944179_2945109_-	hypothetical protein	NA	A0A1B1IN52	uncultured_Mediterranean_phage	36.5	2.8e-31
WP_004329591.1|2945255_2946044_-	ParA family protein	NA	NA	NA	NA	NA
WP_004329592.1|2946071_2946458_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_118431870.1|2947334_2947547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071823590.1|2947795_2948068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004289236.1|2947996_2948563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004289235.1|2948559_2949318_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.1	4.5e-11
WP_011203111.1|2949314_2950295_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011203112.1|2950295_2951435_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004311295.1|2951446_2953525_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_004289231.1|2953543_2954548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141981714.1|2954672_2956763_-	epidermal growth-factor receptor (EGFR) L domain protein	NA	NA	NA	NA	NA
WP_004289229.1|2956777_2958523_-	cell surface protein	NA	NA	NA	NA	NA
WP_007567599.1|2958623_2959541_-	DUF4465 domain-containing protein	NA	NA	NA	NA	NA
2958640:2958659	attL	TCATCAATACAGATATAAGC	NA	NA	NA	NA
WP_004289226.1|2960274_2960604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011203113.1|2960650_2961544_-	tyrosine recombinase	NA	NA	NA	NA	NA
WP_141981716.1|2961973_2962738_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005828036.1|2962882_2963467_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_057256076.1|2963554_2964904_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005837189.1|2965497_2966418_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
2966303:2966322	attR	TCATCAATACAGATATAAGC	NA	NA	NA	NA
>prophage 6
NZ_AP019724	Bacteroides uniformis strain NBRC 113350	4734883	4170457	4178752	4734883	integrase	Paenibacillus_phage(16.67%)	6	4169129:4169142	4183276:4183289
4169129:4169142	attL	TTTGCTTCCGAAGA	NA	NA	NA	NA
WP_007571726.1|4170457_4173163_+	DEAD/DEAH box helicase family protein	NA	A0A2I7SC38	Paenibacillus_phage	23.1	1.6e-13
WP_141982039.1|4173167_4174601_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	32.2	7.7e-28
WP_007571730.1|4174606_4175767_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	26.4	8.7e-22
WP_095231461.1|4175828_4177265_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	34.8	3.7e-14
WP_057258663.1|4177295_4178099_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	30.8	9.6e-20
WP_095231476.1|4178218_4178752_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	35.0	1.6e-07
4183276:4183289	attR	TTTGCTTCCGAAGA	NA	NA	NA	NA
