The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023654	Pediococcus acidilactici strain JQII-5 chromosome, complete genome	2085679	1088648	1097213	2085679		Synechococcus_phage(33.33%)	8	NA	NA
WP_008840996.1|1088648_1089230_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	8.8e-23
WP_008840997.1|1089229_1090276_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	38.7	2.7e-54
WP_087116199.1|1090278_1091748_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.8	6.2e-57
WP_141783043.1|1091732_1093937_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.4e-145
WP_065124113.1|1094627_1094888_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_065124114.1|1094874_1095609_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	4.8e-42
WP_141783148.1|1095586_1096750_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_065124116.1|1096730_1097213_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	7.0e-18
>prophage 2
NZ_CP023654	Pediococcus acidilactici strain JQII-5 chromosome, complete genome	2085679	1139153	1146464	2085679	tRNA	Staphylococcus_phage(28.57%)	8	NA	NA
WP_008841054.1|1139153_1139999_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.1e-17
WP_087116156.1|1140172_1140388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087116154.1|1140384_1140867_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	39.1	3.6e-22
WP_087116152.1|1140884_1141835_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.8e-113
WP_141783051.1|1141839_1143735_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.0	1.9e-50
WP_087116148.1|1143737_1144946_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.8	1.9e-43
WP_087116146.1|1145061_1145922_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.7	2.2e-54
WP_002830304.1|1145993_1146464_-	nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	2.7e-14
>prophage 3
NZ_CP023654	Pediococcus acidilactici strain JQII-5 chromosome, complete genome	2085679	1174470	1291453	2085679	protease,integrase,tail,terminase,capsid,head,portal,tRNA,holin	Lactobacillus_phage(52.08%)	116	1218200:1218223	1259842:1259865
WP_087116130.1|1174470_1176543_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002830333.1|1176542_1177442_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002830334.1|1177727_1178489_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002830335.1|1178491_1179406_-	GTPase Era	NA	NA	NA	NA	NA
WP_004165942.1|1179430_1179814_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002830337.1|1179797_1180268_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_087116128.1|1180272_1181241_-	phosphate starvation-inducible protein PhoH	NA	L7TP00	Rhizobium_phage	47.1	9.1e-49
WP_002830339.1|1181252_1181696_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	35.9	1.5e-14
WP_002830340.1|1181754_1181940_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024862306.1|1182139_1182949_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_024862305.1|1182971_1183376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070366192.1|1183608_1184499_-	deoxyribonuclease IV	NA	A0A2L2DJK8	Acanthamoeba_polyphaga_mimivirus	32.3	2.8e-28
WP_070366193.1|1184501_1185707_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_070366194.1|1185699_1186857_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_002830347.1|1186869_1187748_-	YitT family protein	NA	NA	NA	NA	NA
WP_070366195.1|1188030_1189812_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002830351.1|1189827_1191102_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.7	7.8e-24
WP_005917132.1|1191517_1192387_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	38.2	2.9e-22
WP_087116124.1|1192371_1192995_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_065124168.1|1193085_1193535_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_002830361.1|1193544_1195776_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	S4TRQ0	Salmonella_phage	38.5	7.6e-06
WP_002830362.1|1195883_1196213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081351671.1|1196227_1196965_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_087116120.1|1196974_1197922_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_141783054.1|1198247_1199546_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	8.7e-63
WP_002831915.1|1199769_1200000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830367.1|1200817_1201018_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	54.8	1.3e-10
WP_065124172.1|1201554_1202739_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_141783055.1|1202972_1203968_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.4	1.1e-73
WP_008841294.1|1204314_1204773_-	flavodoxin	NA	NA	NA	NA	NA
WP_141783056.1|1204874_1205324_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087116110.1|1205426_1207064_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.7	3.9e-28
WP_065124174.1|1207397_1208135_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002830377.1|1208345_1208723_-	general stress protein	NA	NA	NA	NA	NA
WP_002830378.1|1209316_1209826_+	membrane protein	NA	NA	NA	NA	NA
WP_087116106.1|1209948_1210215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065124175.1|1210382_1211021_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_087116104.1|1211424_1212534_-	lactate oxidase	NA	NA	NA	NA	NA
WP_087116102.1|1213103_1213658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087116100.1|1213685_1214540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087116455.1|1214885_1216049_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_141783057.1|1216218_1216485_-	hypothetical protein	NA	NA	NA	NA	NA
1218200:1218223	attL	AATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
WP_024862287.1|1219322_1219565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024862286.1|1219682_1220042_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	5.4e-15
WP_002830385.1|1220057_1220321_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	82.8	8.8e-31
WP_036672440.1|1220320_1221451_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.4	2.4e-45
WP_002830387.1|1221495_1221855_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	78.2	1.1e-44
WP_002830389.1|1221869_1222118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830391.1|1222159_1222369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830394.1|1222361_1222589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830396.1|1225715_1228100_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	89.9	0.0e+00
WP_141783058.1|1230011_1234796_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P0ZLG0	Lactobacillus_phage	72.4	0.0e+00
WP_002830399.1|1234823_1235009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830400.1|1235053_1235428_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	95.2	1.2e-57
WP_002830401.1|1235503_1236193_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	92.5	4.3e-109
WP_002830403.1|1236206_1236587_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.1	1.2e-60
WP_002830405.1|1236586_1236994_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	92.4	3.2e-64
WP_002830406.1|1236996_1237344_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	72.8	2.7e-43
WP_002830407.1|1237333_1237666_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.2	1.0e-44
WP_141783059.1|1237738_1238971_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.9	2.2e-209
WP_036672383.1|1238970_1239717_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.4	1.5e-123
WP_002830410.1|1239694_1240858_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	92.2	4.4e-207
WP_036672386.1|1240860_1241055_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	89.1	5.9e-24
WP_087116079.1|1241044_1242943_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	95.3	0.0e+00
WP_002830412.1|1242945_1243404_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	9.5e-81
WP_036672389.1|1243562_1243844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830414.1|1243910_1244417_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.6	2.3e-80
WP_002830416.1|1244907_1245369_-	RNA polymerase sigma 70	NA	O03925	Lactobacillus_phage	29.6	6.7e-10
WP_036672393.1|1245825_1246011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036672395.1|1246028_1246301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830418.1|1246484_1246856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830420.1|1246989_1247400_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	56.6	7.3e-40
WP_036672399.1|1247380_1248013_-	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_141783060.1|1248130_1248946_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	46.4	1.1e-58
WP_002830424.1|1248926_1249667_-	hypothetical protein	NA	A7DYC7	Streptococcus_phage	56.0	5.5e-70
WP_036672402.1|1249696_1249921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141783061.1|1249910_1250588_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	67.0	1.8e-83
WP_002830426.1|1250599_1251025_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	61.0	2.8e-42
WP_024863113.1|1251017_1251224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050755615.1|1251216_1251942_-	ERF family protein	NA	A0A2H4JA34	uncultured_Caudovirales_phage	33.5	9.3e-22
WP_141783149.1|1251942_1252395_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_036672405.1|1252623_1252890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036672407.1|1252846_1253104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830431.1|1253203_1253533_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002830432.1|1253546_1254269_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	51.1	2.2e-55
WP_065124225.1|1254282_1254492_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065124226.1|1254747_1255089_+	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	38.1	2.3e-15
WP_036672412.1|1255097_1255505_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	36.1	6.8e-14
WP_002830434.1|1255567_1256695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036672414.1|1256841_1257039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002830435.1|1257445_1258447_+	Abi family protein	NA	M1PS09	Streptococcus_phage	35.7	1.2e-48
WP_002830436.1|1258587_1259703_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	51.9	2.2e-99
WP_141783062.1|1260318_1261767_+	hypothetical protein	NA	NA	NA	NA	NA
1259842:1259865	attR	AATAAGGAGAGTACAGGATTTGAA	NA	NA	NA	NA
WP_005917317.1|1261999_1262383_-	YxeA family protein	NA	NA	NA	NA	NA
WP_141783150.1|1262611_1262827_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005917322.1|1263068_1263665_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_005917323.1|1263982_1265308_-	Na+/H+ antiporter NhaC, nhaC	NA	NA	NA	NA	NA
WP_075140071.1|1265713_1266889_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_005917328.1|1266994_1267411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065124230.1|1267407_1267851_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141783063.1|1268063_1269524_-	catalase	NA	A0A2K9L572	Tupanvirus	49.7	2.1e-105
WP_141783064.1|1269707_1270484_-	ABC transporter	NA	NA	NA	NA	NA
WP_002831937.1|1271378_1271573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141783065.1|1271920_1277599_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_002830449.1|1278216_1278735_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.3	4.0e-27
WP_087116032.1|1278735_1281057_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.1	5.0e-85
WP_008841319.1|1281074_1281860_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	35.1	7.0e-07
WP_002830452.1|1281918_1282845_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_070366210.1|1282975_1283278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002831941.1|1283345_1284641_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_005917359.1|1284680_1286465_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005917362.1|1286630_1287374_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	1.9e-30
WP_087116454.1|1287373_1288861_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_087116030.1|1289221_1289512_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	46.9	2.9e-19
WP_002830460.1|1289514_1290102_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_087116028.1|1290196_1291453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	6.5e-140
>prophage 4
NZ_CP023654	Pediococcus acidilactici strain JQII-5 chromosome, complete genome	2085679	1529131	1568225	2085679	protease,integrase,tail,holin,capsid,portal,head,terminase	Erysipelothrix_phage(73.91%)	40	1529393:1529419	1535554:1535580
WP_141783081.1|1529131_1529221_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_141783082.1|1529368_1529854_+	hypothetical protein	NA	NA	NA	NA	NA
1529393:1529419	attL	GCTTGGGAACAGCGGAAGTTGGGGGAA	NA	NA	NA	NA
WP_141783083.1|1529850_1530780_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	47.4	6.9e-78
WP_141783084.1|1530797_1531262_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_141783085.1|1531327_1534423_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_141783086.1|1534485_1535643_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1535554:1535580	attR	TTCCCCCAACTTCCGCTGTTCCCAAGC	NA	NA	NA	NA
WP_141783087.1|1535642_1538222_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.5	2.1e-108
WP_141783088.1|1538238_1538460_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	70.5	7.9e-17
WP_141783089.1|1538473_1541089_-	helicase	NA	NA	NA	NA	NA
WP_141783090.1|1541093_1542413_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_141783091.1|1542788_1543316_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_141783092.1|1543411_1543618_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	40.4	2.4e-07
WP_141783093.1|1543604_1543937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783094.1|1543920_1545063_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	54.6	1.8e-112
WP_141783095.1|1545040_1545616_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	71.7	3.8e-71
WP_141783096.1|1545666_1547601_+	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	58.3	7.8e-225
WP_081509838.1|1547695_1548094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783097.1|1548096_1550343_+	DNA primase	NA	E4ZFK6	Streptococcus_phage	48.6	1.9e-211
WP_141783098.1|1550536_1550839_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	54.4	4.3e-21
WP_141783099.1|1550798_1552181_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.7	1.7e-157
WP_081509815.1|1552149_1552620_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_141783100.1|1552754_1553132_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.0	3.3e-31
WP_087448601.1|1553254_1553797_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.6	2.7e-58
WP_141783101.1|1553796_1555026_+	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	62.4	5.8e-149
WP_141783102.1|1555099_1555732_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	39.0	3.1e-37
WP_003672638.1|1555724_1555931_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_141783103.1|1555996_1557598_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.3	9.8e-250
WP_141783104.1|1557927_1558089_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_141783151.1|1558211_1559402_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	64.7	1.4e-152
WP_141783105.1|1559398_1560061_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	56.5	6.4e-54
WP_141783106.1|1560081_1561260_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	59.0	9.8e-130
WP_081509824.1|1561273_1561552_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	41.1	4.5e-09
WP_003672649.1|1561552_1561933_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_141783107.1|1561922_1562345_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	64.2	3.7e-39
WP_003672653.1|1562455_1562644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141783108.1|1562705_1564259_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	35.1	7.9e-87
WP_141783109.1|1564245_1564650_+	recombinase	NA	NA	NA	NA	NA
WP_141783110.1|1564636_1566223_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	46.9	1.3e-124
WP_012846556.1|1566276_1566540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141783111.1|1566854_1568225_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.5	4.2e-124
