The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	116567	125493	5083072	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_001171523.1|116567_116948_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612556.1|116944_117292_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001593684.1|117387_118980_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000624717.1|119010_119361_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|119357_119783_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001360336.1|121995_125493_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
>prophage 2
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	718077	784906	5083072	tRNA,transposase,holin,integrase	Shigella_phage(21.43%)	55	744993:745008	777191:777206
WP_000785722.1|718077_718482_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031415.1|718484_718790_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001295543.1|718827_719196_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_001166764.1|719342_719726_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422149.1|719729_720392_-	DedA family protein	NA	NA	NA	NA	NA
WP_000406495.1|720736_721513_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_001361213.1|721804_722521_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_022646151.1|722550_723051_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000358691.1|723141_725826_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_001298326.1|726991_728290_-	hexuronate transporter ExuT	NA	NA	NA	NA	NA
WP_000187442.1|728772_730185_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_001199369.1|730199_731687_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000128138.1|731769_732321_+	YgjV family protein	NA	NA	NA	NA	NA
WP_000211642.1|732324_733569_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098826.1|733892_734858_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
WP_001385498.1|735140_736127_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000942551.1|736205_736898_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_001295542.1|736974_737478_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000018659.1|737562_738699_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000560269.1|739293_739710_+	type II toxin-antitoxin system antitoxin HigA	NA	NA	NA	NA	NA
WP_022646149.1|739754_741773_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_022646148.1|741998_744350_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_022646147.1|744366_745437_-	protein YgjJ	NA	NA	NA	NA	NA
744993:745008	attL	GCAGGTCATCCAGCGA	NA	NA	NA	NA
WP_001285446.1|745570_747004_-	amino acid permease	NA	NA	NA	NA	NA
WP_001357699.1|747066_747516_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_022646146.1|747512_750605_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
WP_000212433.1|750788_751772_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|751990_752323_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_032140334.1|752364_753744_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.0e-32
WP_000094726.1|754161_755682_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_021581059.1|755778_756402_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_022646145.1|756689_757454_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000290293.1|757750_759067_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.4	5.0e-34
WP_000268404.1|759196_759793_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_032333863.1|759875_761480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265817.1|762259_762487_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001313175.1|762549_763296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300090.1|763577_764078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|764466_765081_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_024176343.1|765108_765675_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_167588549.1|765974_767209_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_000233940.1|767366_768041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077631677.1|768140_768359_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023149493.1|768309_768456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050583671.1|768962_769298_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.3	8.9e-36
WP_023149491.1|769317_770850_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	5.9e-159
WP_001313190.1|771370_771886_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001564126.1|772305_773082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000134227.1|773737_775345_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.5	1.7e-100
WP_000836927.1|775341_776502_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001564125.1|776498_777770_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	24.6	6.2e-13
777191:777206	attR	GCAGGTCATCCAGCGA	NA	NA	NA	NA
WP_138031502.1|777951_780924_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	2.0e-17
WP_085947924.1|781989_783197_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	61.2	1.6e-95
WP_000283011.1|783389_783572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174234662.1|783677_784906_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	4.2e-176
>prophage 3
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	1839201	1848643	5083072		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|1839201_1840128_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|1840132_1840864_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1840844_1840952_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1841011_1841743_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1841964_1843650_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1843646_1844366_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1844412_1844883_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1844923_1845385_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_084818592.1|1845509_1847510_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001329822.1|1847506_1848643_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 4
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	1939215	1945524	5083072		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116131.1|1939215_1940610_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183060.1|1940784_1941678_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|1942050_1943136_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|1943135_1944035_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|1944092_1944971_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|1944975_1945524_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
>prophage 5
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	2495877	2545998	5083072	portal,terminase,protease,tail,lysis	Enterobacteria_phage(46.81%)	63	NA	NA
WP_000836037.1|2495877_2496897_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2496954_2497083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2497084_2498365_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|2498399_2498651_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024946566.1|2498723_2501195_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2501287_2501479_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|2501475_2501664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|2502166_2502367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241299.1|2502335_2502713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2502712_2502865_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2503057_2503465_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2503542_2503770_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2503753_2504275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|2504255_2505221_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|2505261_2505663_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|2505862_2506885_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|2507747_2507855_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|2507899_2508112_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2508328_2508580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|2508646_2508925_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|2508926_2509976_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|2509988_2510345_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|2510359_2511181_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|2512076_2512208_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|2512574_2513003_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2513174_2513549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|2513800_2514016_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_000196128.1|2514020_2514332_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_001092966.1|2514328_2514862_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2514858_2515356_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2515719_2515932_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2515942_2516131_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2516278_2516434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2516606_2516780_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2517075_2517282_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_022645722.1|2517834_2518329_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934102.1|2518328_2520431_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|2520427_2520640_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2520639_2522148_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|2522092_2524120_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|2524205_2524529_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_022645721.1|2524521_2524797_+	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_000677120.1|2524808_2525399_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|2525395_2525797_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|2525807_2526551_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|2526611_2526998_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|2527006_2527324_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|2527307_2530373_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|2530372_2530702_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2530711_2531410_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|2531415_2532159_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|2532056_2532704_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_022645716.1|2532764_2536244_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001228249.1|2536311_2536911_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_001546831.1|2536975_2539348_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|2539344_2539623_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546829.1|2539633_2540674_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546828.1|2540716_2541010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2541237_2541828_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2542144_2542378_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2542446_2542560_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|2543164_2544448_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|2544537_2545998_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
>prophage 6
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	2715385	2767855	5083072	terminase,tRNA,lysis,tail	Escherichia_phage(47.92%)	59	NA	NA
WP_077250922.1|2715385_2717734_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_024173375.1|2717798_2718398_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	3.8e-106
WP_050496112.1|2722004_2722607_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.7	3.4e-86
WP_021520058.1|2722543_2723287_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	4.0e-145
WP_001578255.1|2723292_2723991_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.9e-128
WP_000024051.1|2723990_2724329_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_012565075.1|2728027_2728387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2728537_2729500_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2729526_2729919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063814927.1|2729915_2730296_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.5e-18
WP_000524260.1|2730296_2730680_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_096855981.1|2730666_2731074_-	protein singed	NA	NA	NA	NA	NA
WP_000908084.1|2731077_2731254_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|2731296_2732436_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_063814926.1|2732534_2733299_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	63.8	2.6e-83
WP_001351715.1|2733403_2734516_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763704.1|2734499_2735906_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_063814925.1|2735908_2737210_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	4.7e-149
WP_000089447.1|2737190_2738285_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|2738288_2738540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2738475_2739408_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2739400_2740192_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2740329_2741787_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2741983_2742169_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_000992105.1|2742385_2742919_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370551.1|2743024_2743297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|2743262_2743607_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839599.1|2743611_2743827_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_162721299.1|2743859_2744003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233158.1|2744139_2744649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562591.1|2744649_2745690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032342160.1|2745970_2746792_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	2.6e-81
WP_053289978.1|2746788_2747163_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.7e-35
WP_053289977.1|2747175_2748225_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.4e-106
WP_023141427.1|2748226_2748499_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2748666_2748822_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|2749743_2749920_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|2749912_2750095_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2750188_2750545_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2750602_2751025_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000450662.1|2751040_2751802_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.2e-117
WP_000788970.1|2751824_2752571_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000693797.1|2753446_2753869_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2753891_2754188_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2754311_2754788_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_053289980.1|2755107_2755263_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_001312793.1|2755259_2755748_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2756189_2756411_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2756410_2756581_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2756655_2756931_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000166319.1|2759624_2760434_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2760490_2760685_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_063814942.1|2760677_2760887_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	1.8e-26
WP_000079604.1|2760965_2761181_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|2761182_2762418_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|2762469_2763405_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_022645642.1|2763533_2764907_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
WP_000387388.1|2765384_2766368_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2766622_2767855_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	3627258	3692956	5083072	tRNA,transposase,head,portal,protease,terminase,tail,integrase,lysis,capsid	Enterobacteria_phage(54.55%)	75	3635667:3635713	3682759:3682805
WP_022645324.1|3627258_3628395_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_022645323.1|3628592_3630830_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_063815185.1|3630816_3633789_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645321.1|3633789_3634680_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177457.1|3634862_3635624_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3635667:3635713	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_084818532.1|3636136_3637090_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3637339_3638089_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_041983107.1|3638991_3639618_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046201517.1|3639672_3640257_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.0e-103
WP_084818583.1|3640256_3643220_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	91.5	2.9e-53
WP_084818531.1|3643284_3643884_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	2.8e-109
WP_084818530.1|3643953_3647367_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_000090891.1|3647427_3648060_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_141927173.1|3647996_3648740_-	C40 family peptidase	NA	K7PLW1	Enterobacteria_phage	95.1	9.8e-144
WP_044861874.1|3648745_3649444_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	6.2e-132
WP_000847345.1|3649443_3649773_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_084818528.1|3649769_3652331_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000459457.1|3652323_3652758_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479155.1|3652739_3653162_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_047624866.1|3653177_3653918_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.6	9.5e-131
WP_000683117.1|3653925_3654321_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_053270660.1|3654317_3654896_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_084818527.1|3654907_3655261_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	5.8e-62
WP_000158868.1|3655272_3655668_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_032140162.1|3655709_3656735_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	3.8e-186
WP_001338090.1|3656790_3657123_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_022645599.1|3657132_3658452_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	8.1e-234
WP_022645598.1|3658432_3660034_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_000198149.1|3660030_3660237_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_084818526.1|3660233_3662159_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453611.1|3662133_3662679_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001307652.1|3663067_3663262_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738421.1|3663622_3663916_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3664006_3664189_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_072795876.1|3664405_3664903_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.3e-88
WP_000839597.1|3664902_3665118_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000737280.1|3665690_3666788_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204780.1|3666977_3667361_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971071.1|3667446_3667587_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|3667583_3667946_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|3667942_3668233_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224907.1|3668225_3668396_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001054340.1|3668395_3668851_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3668847_3668949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3669065_3669863_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3669872_3670424_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_084818524.1|3670888_3672415_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|3672472_3672622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084818523.1|3673070_3673337_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	81.5	1.5e-33
WP_060615751.1|3673333_3674035_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	4.2e-128
WP_000147955.1|3674031_3675051_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_001400028.1|3675047_3675587_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_000184665.1|3675617_3675845_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712396.1|3675955_3676648_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_084818522.1|3676714_3677578_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	61.8	1.6e-92
WP_123057602.1|3677974_3678265_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995455.1|3678340_3678637_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_000100847.1|3678642_3679428_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_084818521.1|3679424_3680105_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.1e-130
WP_084818520.1|3680101_3680284_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	4.5e-26
WP_000548537.1|3680256_3680448_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3680458_3680740_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|3680838_3681057_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3681104_3681383_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001350488.1|3681581_3682745_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000805428.1|3683078_3683711_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3682759:3682805	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255235.1|3683713_3684229_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_084818519.1|3684239_3685247_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_022645304.1|3685259_3687869_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_022645303.1|3687899_3688592_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3688811_3689354_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729155.1|3689825_3690692_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3690693_3690906_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143564.1|3691013_3691535_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3691570_3692956_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 8
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	4614727	4660145	5083072	tRNA,tail,plate	Burkholderia_phage(30.0%)	47	NA	NA
WP_001298868.1|4614727_4615765_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_022646425.1|4616126_4617131_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_000416263.1|4617448_4617964_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|4618005_4618215_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001361471.1|4618330_4619656_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4619728_4620337_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4620446_4620815_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4620985_4623409_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|4623563_4624436_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|4624448_4624946_-	chorismate lyase	NA	NA	NA	NA	NA
WP_022646424.1|4625168_4626749_-	SopA family protein	NA	NA	NA	NA	NA
WP_000783444.1|4626976_4627897_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973665.1|4628139_4629480_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|4629551_4630667_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695389.1|4631031_4632222_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_022646423.1|4632375_4633920_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|4633934_4634825_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000202902.1|4634918_4635329_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001295279.1|4635542_4635821_+	periplasmic protein	NA	NA	NA	NA	NA
WP_084818499.1|4635867_4637964_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_022646421.1|4637963_4638701_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|4638697_4639336_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|4639449_4639692_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_022646420.1|4640046_4641696_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022646419.1|4642220_4643570_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000619864.1|4643624_4643972_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4644509_4644797_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4644799_4645405_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4645417_4645732_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4645876_4646332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4646328_4646526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4646515_4647940_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4647939_4648464_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4648514_4648832_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4648791_4648920_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646414.1|4649021_4651397_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_022646413.1|4651396_4652350_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4652349_4652559_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_084818498.1|4652546_4653587_+	phage late control D family protein	NA	R9U464	Rhizobium_phage	31.7	3.4e-33
WP_000679403.1|4653596_4654298_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646411.1|4654396_4654756_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|4654746_4655862_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|4655854_4656571_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4656573_4658184_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_063815108.1|4658180_4658888_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	50.4	5.5e-27
WP_022646406.1|4658884_4659340_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4659353_4660145_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 9
NZ_CP041300	Escherichia coli O1:H42 strain CLSC36 chromosome, complete genome	5083072	4786045	4838293	5083072	head,portal,protease,terminase,tail,integrase,lysis,capsid,holin,plate	Escherichia_phage(35.42%)	66	4801943:4801989	4835505:4835551
WP_000208242.1|4786045_4786576_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4786585_4787917_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001305044.1|4787983_4788910_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4789002_4789488_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4789572_4789818_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4790242_4791088_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4791110_4792619_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4792753_4793764_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796322.1|4793860_4794607_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4794611_4795040_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4795066_4795366_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4795577_4796018_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4796118_4796718_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4796825_4797593_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4797647_4798403_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4798509_4799499_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4799818_4800781_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|4800961_4801864_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4801943:4801989	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4802100_4802319_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047629917.1|4802400_4803564_-	phage late control D family protein	NA	M1SV93	Escherichia_phage	98.4	1.7e-203
WP_001471798.1|4803563_4804043_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_073534974.1|4804057_4806505_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_053879341.1|4806497_4806617_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	4.0e-15
WP_001031303.1|4806649_4806925_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4806981_4807500_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286680.1|4807512_4808703_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_000014361.1|4809022_4809922_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000972099.1|4810137_4810665_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_000104681.1|4810666_4812688_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	3.5e-260
WP_001285325.1|4812698_4813229_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121500.1|4813221_4814130_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	6.3e-161
WP_000127163.1|4814134_4814482_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093714.1|4814478_4815114_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_060621266.1|4815197_4815983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4816054_4816507_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917174.1|4816499_4816967_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001440152.1|4816929_4817103_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040662.1|4817074_4817500_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_000736589.1|4817487_4817913_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	93.6	1.4e-57
WP_001144101.1|4817927_4818425_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4818424_4818706_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846415.1|4818709_4818913_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
WP_000988633.1|4818912_4819422_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203422.1|4819521_4820265_-|terminase	terminase endonuclease subunit	terminase	Q94MG8	Enterobacteria_phage	100.0	2.8e-122
WP_001248571.1|4820268_4821342_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	2.5e-201
WP_001085948.1|4821400_4822255_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156845.1|4822428_4824201_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000038165.1|4824200_4825235_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_000368931.1|4825650_4826724_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_001350076.1|4826728_4827754_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_001143634.1|4827750_4828689_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4828931_4829138_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001696366.1|4829137_4829590_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.0e-79
WP_084818495.1|4829589_4831875_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_000027674.1|4831864_4832140_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113271.1|4832136_4832361_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_074417161.1|4832360_4832663_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	2.7e-44
WP_047335237.1|4832662_4832887_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
WP_000217670.1|4832950_4833451_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_024210514.1|4833447_4833645_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
WP_000453534.1|4833620_4833893_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4834045_4834339_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4834408_4835389_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4835574_4836075_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4835505:4835551	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4836224_4836923_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4836919_4838293_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP041299	Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence	195702	23765	142795	195702	bacteriocin,integrase,tRNA,transposase,protease	Salmonella_phage(11.54%)	80	103091:103105	145779:145793
WP_000911333.1|23765_24164_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450520.1|24163_24391_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000205749.1|29763_30510_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000704513.1|30568_31429_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139315.1|31531_32092_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|32227_32440_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351576.1|33063_33270_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|33553_33811_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|34042_34117_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001273588.1|34109_34592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019842754.1|34584_35442_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001323889.1|35738_37316_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|37625_38186_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_138031477.1|38189_41156_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_001132900.1|42050_42302_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222760.1|42298_42586_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.3e-19
WP_000255956.1|43461_44484_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001513481.1|44483_45263_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000661609.1|47838_48801_-	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_141927140.1|48827_50378_-	xanthine permease	NA	NA	NA	NA	NA
WP_000084168.1|50490_51909_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000027750.1|51908_53456_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000531854.1|53415_54264_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000066154.1|54349_54955_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
WP_001084376.1|55342_56272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001334006.1|56945_57266_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.0	3.5e-13
WP_000536047.1|59024_59690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633743.1|59747_60038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000567766.1|61809_62175_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
WP_000595317.1|62426_62816_-	cytochrome B562	NA	NA	NA	NA	NA
WP_000470711.1|63249_64140_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024188138.1|64217_65441_-	cytosine permease	NA	NA	NA	NA	NA
WP_001696803.1|65463_65853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696801.1|65869_66826_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001093931.1|66818_68243_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000865634.1|68239_69799_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001442105.1|69893_70754_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000155780.1|70759_71428_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001442107.1|74106_74295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000451769.1|74813_75047_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000412701.1|75047_75305_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000020503.1|76625_77387_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_000110581.1|77386_78424_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000756335.1|78423_79422_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000086538.1|79776_80367_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_000487120.1|80944_81955_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
WP_000124098.1|82421_82787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029402714.1|82908_84060_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_000612591.1|91333_91681_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_024210439.1|91677_92058_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000379710.1|93109_93379_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001323890.1|94318_94555_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|94532_94844_+	colicin V	NA	NA	NA	NA	NA
WP_001183603.1|95013_97128_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	4.8e-34
WP_000489608.1|97102_98377_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001324224.1|99058_99256_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|99252_99435_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|99533_99842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190233.1|100401_101436_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
103091:103105	attL	GCCAGGGGAATATCT	NA	NA	NA	NA
WP_000271277.1|104501_105458_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001442133.1|106874_110534_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_001318220.1|110673_111789_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|114933_115227_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_164994192.1|115933_117161_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.7e-175
WP_000450493.1|117616_118810_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001610305.1|119444_120842_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001610304.1|121073_121343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610303.1|121342_121810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610302.1|121852_122224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610298.1|124565_126830_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_001610297.1|126831_127608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696614.1|130003_131374_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001610286.1|131377_133318_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001696612.1|133314_134502_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001595315.1|136216_136633_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_000280980.1|137905_138859_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001696610.1|139290_140400_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001312822.1|140468_141371_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001312821.1|141745_141934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|142054_142795_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
145779:145793	attR	AGATATTCCCCTGGC	NA	NA	NA	NA
