The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	19517	72665	2084748	transposase	Bacillus_phage(45.45%)	39	NA	NA
WP_010011610.1|19517_20396_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|20419_20707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003669506.1|23562_23997_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675553.1|24084_25734_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.8	4.1e-110
WP_003675551.1|26078_26786_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	4.3e-40
WP_003675548.1|26799_28665_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.7	5.5e-34
WP_003675546.1|28642_29938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675544.1|29950_30793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496352.1|30810_31617_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.1	5.6e-36
WP_063164302.1|31720_33001_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	6.2e-21
WP_003669518.1|33092_33602_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	51.9	8.2e-41
WP_003675538.1|33910_34897_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035161733.1|35365_35845_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003675532.1|35988_36207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675530.1|36274_36817_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675528.1|37035_38208_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_019251835.1|38275_39052_-	VOC family protein	NA	NA	NA	NA	NA
WP_003675527.1|39053_39866_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063164304.1|40166_41540_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003675522.1|41715_42798_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003675520.1|42799_43498_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	2.6e-37
WP_063164305.1|43484_44720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496365.1|44859_45519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499005.1|45584_46553_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_142499006.1|46676_47627_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003669548.1|47771_48200_-	OsmC family protein	NA	NA	NA	NA	NA
WP_063164307.1|48267_49263_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.2	1.4e-31
WP_016496371.1|49264_50452_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003670244.1|50957_51179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499007.1|51296_53534_+	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	39.4	8.4e-122
WP_003675510.1|54447_57342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079375840.1|57426_58053_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016496373.1|58150_59614_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_016496374.1|59728_63511_+	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_003675503.1|63510_67689_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.2	1.2e-17
WP_142499008.1|67689_68619_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003668074.1|68633_69602_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496376.1|69767_70946_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_142499009.1|71246_72665_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	115771	184196	2084748	tRNA,transposase	unidentified_phage(15.79%)	60	NA	NA
WP_142499013.1|115771_118267_+|transposase	IS3 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.1	4.4e-63
WP_142499014.1|118604_119735_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.7e-34
WP_003668074.1|120369_121338_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675442.1|121620_121872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675440.1|121968_122649_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_142499015.1|122645_123977_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	27.6	5.9e-22
WP_016496397.1|124081_124732_+	Propeptide PepSY amd peptidase M4	NA	NA	NA	NA	NA
WP_003669426.1|126892_127213_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003675433.1|127338_127932_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675432.1|128081_128762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675431.1|128763_129738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675430.1|129971_130844_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	2.1e-52
WP_003675429.1|130946_131432_+	flavodoxin	NA	NA	NA	NA	NA
WP_003675428.1|131490_132360_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675427.1|132470_133007_+	acetyltransferase	NA	NA	NA	NA	NA
WP_003675425.1|133219_134080_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016496402.1|134186_134726_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003675423.1|134768_135299_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675422.1|135274_135901_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003670156.1|136000_137002_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003675421.1|137060_138050_-	asparaginase	NA	NA	NA	NA	NA
WP_003675420.1|139121_140000_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.9	8.0e-52
WP_016496405.1|140100_140679_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016496408.1|141911_142556_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003669411.1|142661_143033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669410.1|143134_143806_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016496409.1|143878_144679_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_016496411.1|145089_146013_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_086120445.1|146043_147153_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	25.0	1.2e-07
WP_003675410.1|147168_147849_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003675409.1|147917_149216_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.5	1.3e-55
WP_016496414.1|149235_150246_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.4	5.5e-65
WP_051111509.1|150622_151240_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_016496416.1|151405_153937_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.2	2.4e-64
WP_003675401.1|154083_154725_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003675399.1|154941_156264_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.0	1.5e-65
WP_003675396.1|156413_157589_+	MFS transporter	NA	NA	NA	NA	NA
WP_016496417.1|157600_158914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496420.1|159424_160027_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_016496421.1|160124_160436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675390.1|160563_161220_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003675387.1|161400_161838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003669379.1|161966_162200_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003665104.1|162335_162554_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003675383.1|162566_162812_+	cytochrome b5	NA	NA	NA	NA	NA
WP_016496424.1|162869_164006_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	6.0e-84
WP_003675378.1|164766_165723_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_080637861.1|165906_167301_-	amino acid permease	NA	NA	NA	NA	NA
WP_142499016.1|167613_169269_+	MFS transporter	NA	NA	NA	NA	NA
WP_142499017.1|170576_171428_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	25.2	5.2e-16
WP_011953599.1|171501_173307_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.1	7.8e-86
WP_016496430.1|173635_174319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675365.1|174584_176177_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_003665087.1|176749_177760_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.8	3.1e-07
WP_003675363.1|178021_178534_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675361.1|178544_179603_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003675359.1|179620_180307_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	7.2e-32
WP_016496432.1|180405_182388_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.7	1.9e-32
WP_003675355.1|182612_182849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499018.1|183272_184196_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	1.1e-32
>prophage 3
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	602812	722885	2084748	transposase,holin,terminase,integrase,portal,protease,tail,tRNA,head	Lactobacillus_phage(44.0%)	109	649370:649391	723596:723617
WP_063164433.1|602812_603781_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_142499071.1|603890_605021_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	5.1e-35
WP_142499072.1|605308_607627_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A249Y0X5	Enterococcus_phage	39.8	1.5e-33
WP_081372319.1|607771_608251_+	DUF1828 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	50.0	4.5e-33
WP_142499436.1|608254_608497_+	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_063164438.1|608657_609527_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.1	8.3e-102
WP_003664372.1|609540_610122_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.7	3.2e-33
WP_086132457.1|610133_611174_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.3	3.2e-60
WP_016496659.1|611320_612160_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.1	1.4e-34
WP_142499073.1|612231_614853_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_142499074.1|614924_616043_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_086132228.1|616085_617555_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003668625.1|617741_619319_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.1	6.3e-31
WP_081120426.1|619329_620442_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_142499075.1|624088_626806_+	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	41.6	3.1e-30
WP_142499076.1|627057_630840_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_063164447.1|630981_631365_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142499077.1|631342_632209_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	1.4e-21
WP_063164449.1|632208_632895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496665.1|632953_633679_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_142499078.1|633828_634437_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003674708.1|634488_636693_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.3	6.7e-124
WP_003674706.1|636969_637155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664342.1|637276_637543_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_142499079.1|637542_639273_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.5	2.2e-13
WP_003674701.1|639506_640724_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016496666.1|640726_641755_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003674698.1|641754_642768_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003664336.1|642824_643073_+	YkuJ family protein	NA	NA	NA	NA	NA
649370:649391	attL	GTGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
WP_142499080.1|649611_650736_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	56.2	4.5e-108
WP_142499081.1|651699_652158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499082.1|652219_652861_-	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	50.6	9.0e-45
WP_122481370.1|653009_653228_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEA4	uncultured_Caudovirales_phage	52.1	3.5e-09
WP_142499083.1|653243_653570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086141145.1|653726_653933_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003664313.1|654128_654344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085680553.1|654336_654609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499084.1|654608_655088_+	siphovirus Gp157 family protein	NA	A0A0A1EL06	Lactobacillus_phage	56.6	9.7e-44
WP_142499085.1|655087_656458_+	DEAD/DEAH box helicase family protein	NA	A0A0A1ENT0	Lactobacillus_phage	79.6	4.4e-214
WP_086142725.1|656468_657233_+	AAA family ATPase	NA	A0A0A1ENB5	Lactobacillus_phage	87.8	1.3e-127
WP_142499086.1|657239_657755_+	DUF669 domain-containing protein	NA	A0A0A1ELK1	Lactobacillus_phage	77.2	5.7e-74
WP_142499087.1|657913_658705_+	DNA primase	NA	A0A0A1ERC1	Lactobacillus_phage	82.2	1.3e-122
WP_142499438.1|658706_659921_+	helicase	NA	A0A0A1EL11	Lactobacillus_phage	70.4	2.9e-169
WP_142499088.1|660170_660383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499089.1|660385_660586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499090.1|660585_660939_+	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	86.5	6.4e-53
WP_085678666.1|660935_661118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499091.1|661136_661538_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142499092.1|661646_661835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499093.1|661837_662059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499094.1|662058_662286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499095.1|662455_662668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499096.1|662667_663108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499097.1|663262_663724_+	ArpU family transcriptional regulator	NA	D2IYV6	Enterococcus_phage	34.3	3.7e-08
WP_142499098.1|663921_664530_+	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	60.9	7.7e-70
WP_142499099.1|664648_665236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499100.1|665274_665709_+|terminase	terminase small subunit	terminase	Q37950	Lactococcus_phage	53.0	1.8e-25
WP_142499101.1|665837_667103_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0A1ELG3	Lactobacillus_phage	81.9	1.8e-209
WP_142499102.1|667114_668551_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	67.3	9.3e-175
WP_142499103.1|668534_669980_+|head	phage head morphogenesis protein	head	A0A0A1EKX3	Lactobacillus_phage	45.2	1.5e-76
WP_142499104.1|670226_670841_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	31.9	2.1e-14
WP_142499105.1|670855_671734_+	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	60.3	9.0e-88
WP_142499106.1|671742_672138_+|head,tail	phage head-tail connector protein	head,tail	A0A0A1ER91	Lactobacillus_phage	62.7	3.0e-35
WP_142499107.1|672115_672430_+	hypothetical protein	NA	A0A0N7IR97	Lactobacillus_phage	46.5	2.1e-15
WP_086131549.1|672413_672821_+	hypothetical protein	NA	A0A0A1ENQ3	Lactobacillus_phage	48.4	5.2e-22
WP_142499108.1|672829_673222_+	DUF3168 domain-containing protein	NA	Q77K20	Lactococcus_phage	31.0	1.2e-07
WP_142499109.1|673234_673822_+|tail	phage tail protein	tail	A0A0A1ELH3	Lactobacillus_phage	51.6	1.1e-46
WP_142499110.1|673836_674172_+	hypothetical protein	NA	A0A0A1ER95	Lactobacillus_phage	45.6	1.3e-15
WP_086131578.1|674267_674591_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	48.5	5.6e-19
WP_142499111.1|674590_677212_+	tape measure protein	NA	A0A1P8BLX4	Lactococcus_phage	46.5	1.3e-89
WP_142499112.1|677208_677988_+|tail	phage tail protein	tail	Q6SEC3	Lactobacillus_prophage	45.1	9.2e-52
WP_142499113.1|677987_680426_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	39.4	1.3e-144
WP_142499114.1|683135_683318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499115.1|683318_683471_+	XkdX family protein	NA	NA	NA	NA	NA
WP_142499116.1|683801_684059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499117.1|684124_684559_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_142499118.1|684558_685518_+	glycoside hydrolase family 25	NA	Q6SE63	Lactobacillus_prophage	40.1	3.1e-57
WP_003675868.1|686409_686964_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016496667.1|687002_688400_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_016496668.1|688793_691028_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	2.3e-249
WP_003675861.1|691093_691672_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	2.8e-53
WP_142499119.1|691683_692574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496669.1|692957_693767_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	71.1	1.1e-23
WP_142499120.1|693922_695623_+	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_003664230.1|695952_696660_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	45.8	5.5e-27
WP_016496673.1|696788_697637_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003664225.1|697769_698201_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_142499121.1|698327_699830_+	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	26.7	1.9e-32
WP_142499122.1|699829_700276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664221.1|702104_702629_-	membrane protein	NA	NA	NA	NA	NA
WP_019251755.1|703120_703732_-	VanZ family protein	NA	NA	NA	NA	NA
WP_142499123.1|703822_705169_+	amino acid permease	NA	NA	NA	NA	NA
WP_003675841.1|705381_705837_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003675840.1|705960_707400_+	MFS transporter	NA	NA	NA	NA	NA
WP_003675838.1|707485_708025_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003670795.1|708185_709373_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	4.7e-148
WP_003675835.1|709694_712115_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.5	0.0e+00
WP_003675833.1|712176_712440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496675.1|712554_714204_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_142499124.1|714268_715129_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_142499125.1|715217_716621_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003675826.1|716645_717158_+	universal stress protein	NA	NA	NA	NA	NA
WP_003675824.1|717246_718293_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A249Y0X5	Enterococcus_phage	32.2	9.0e-10
WP_003664204.1|718327_718960_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_142499126.1|719175_719784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675820.1|719865_720882_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675819.1|720938_721862_+	ribokinase	NA	NA	NA	NA	NA
WP_003668533.1|721978_722224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675817.1|722207_722885_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
723596:723617	attR	GTGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
>prophage 4
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	783258	839634	2084748	terminase,integrase,capsid,portal,tail,tRNA	Lactobacillus_phage(66.67%)	63	784430:784445	834669:834684
WP_142499132.1|783258_784305_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.2	1.0e-29
WP_016496708.1|784311_786729_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
784430:784445	attL	ACGGATTAAAAAAGAT	NA	NA	NA	NA
WP_003675714.1|786914_787553_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	34.1	2.7e-09
WP_003668449.1|787665_788322_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	2.7e-36
WP_003664064.1|788385_788862_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003675710.1|789770_790160_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_003675709.1|790227_792843_-	YfhO family protein	NA	NA	NA	NA	NA
WP_142499133.1|793052_795152_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003664049.1|795290_795440_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003675704.1|795576_796131_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003668441.1|796680_796920_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_003675699.1|796944_797916_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003672480.1|797929_798349_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003675697.1|798509_798686_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003675695.1|798800_799724_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003675693.1|799893_801237_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003675691.1|801478_802984_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	31.9	1.3e-09
WP_003675688.1|803096_804278_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003675687.1|804963_805815_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142499134.1|805928_807134_-|integrase	tyrosine-type recombinase/integrase	integrase	A9D9I9	Lactobacillus_prophage	39.8	3.9e-65
WP_142499135.1|807216_807588_-	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	51.7	2.4e-26
WP_142499136.1|807599_808103_-	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	51.6	1.3e-27
WP_142499137.1|808197_808635_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	37.6	2.7e-16
WP_142499138.1|808647_809121_-	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	43.4	7.9e-22
WP_019251658.1|809263_809467_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034540199.1|809705_810086_-	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	42.4	1.0e-24
WP_142499139.1|810639_810870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499140.1|811003_811207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499141.1|811203_811383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499142.1|811592_811871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499143.1|812764_813625_+	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	46.7	6.0e-68
WP_142499144.1|813636_814485_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_142499145.1|814488_814818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499146.1|814814_815333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499147.1|815329_816022_+	phage regulatory protein	NA	E9LUT0	Lactobacillus_phage	52.0	5.4e-27
WP_142499148.1|816035_816533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499149.1|816522_816738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499092.1|816734_816923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499150.1|816925_817147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499151.1|817146_817341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499152.1|817618_817810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499153.1|817919_818435_+	hypothetical protein	NA	A0A0A1EL23	Lactobacillus_phage	32.0	5.8e-10
WP_142499154.1|819448_820147_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_142499155.1|820149_820575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499156.1|820588_820972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499157.1|820985_821771_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	42.7	1.8e-15
WP_142499158.1|821865_822369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499159.1|822337_823642_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	65.7	1.1e-174
WP_142499160.1|823692_824478_+	DUF2116 family Zn-ribbon domain-containing protein	NA	A0A0P0HRI2	Lactobacillus_phage	38.9	1.7e-21
WP_142499161.1|824529_826089_+|portal	phage portal protein	portal	U3PCP8	Lactobacillus_phage	49.0	3.5e-135
WP_142499162.1|826091_827243_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	50.9	3.9e-91
WP_142499163.1|827342_827912_+	scaffolding protein	NA	L0P7B0	Lactobacillus_phage	29.3	8.1e-13
WP_142499164.1|827929_828796_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	62.5	1.6e-97
WP_142499165.1|828965_829391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499166.1|829371_829719_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	49.6	1.5e-25
WP_142499167.1|829718_830150_+	hypothetical protein	NA	O03933	Lactobacillus_phage	50.0	1.6e-13
WP_142499168.1|830103_830532_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_142499442.1|830624_831080_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	54.9	1.9e-36
WP_142499169.1|831131_831584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499170.1|831586_832192_+	hypothetical protein	NA	O03936	Lactobacillus_phage	38.8	5.3e-31
WP_142499444.1|832381_836680_+	tape measure protein	NA	O03937	Lactobacillus_phage	32.0	2.0e-23
834669:834684	attR	ACGGATTAAAAAAGAT	NA	NA	NA	NA
WP_142499171.1|836679_837498_+|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	49.3	2.2e-72
WP_142499172.1|837507_839634_+	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	40.2	1.8e-129
>prophage 5
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	889118	1017127	2084748	protease,tRNA,integrase,transposase	Streptococcus_phage(28.0%)	105	960458:960517	978851:979929
WP_003663813.1|889118_889877_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003675627.1|889887_891318_+	amino acid permease	NA	NA	NA	NA	NA
WP_003675625.1|891440_891800_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003675622.1|892407_892632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161845.1|892781_893114_+	DNA-binding protein	NA	M5AWB2	Nitratiruptor_phage	42.2	3.8e-15
WP_003675618.1|893116_893944_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.0	1.4e-98
WP_003675615.1|893995_894475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499187.1|894775_896152_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	2.3e-29
WP_063164563.1|896219_897200_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016496734.1|897280_898180_+	prenyltransferase	NA	NA	NA	NA	NA
WP_086132096.1|898215_898917_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_086132095.1|898937_900173_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675605.1|900291_901170_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003667006.1|901315_901585_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_142499188.1|901815_902508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675599.1|902578_903241_+	serine dehydratase	NA	NA	NA	NA	NA
WP_003675597.1|903250_904132_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_142499189.1|904232_904796_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_142499190.1|904809_906477_+	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	41.7	8.0e-53
WP_003667025.1|908056_909460_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_142499191.1|909598_911428_+	potassium transporter	NA	NA	NA	NA	NA
WP_003663508.1|911510_911696_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_142499192.1|911830_913333_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_117115167.1|913377_913890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496813.1|913981_915358_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_086131836.1|915417_915654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499193.1|915663_916239_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_142499194.1|916455_916674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035167654.1|916789_917188_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.9e-46
WP_016496758.1|917187_918363_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	1.9e-117
WP_142499195.1|919336_920332_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086132580.1|920352_921225_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_142499196.1|921237_921981_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	34.7	1.1e-22
WP_142499197.1|922000_922930_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.4	2.5e-48
WP_142499198.1|922945_923602_+	sugar transferase	NA	NA	NA	NA	NA
WP_142499199.1|923601_924705_+	glycosyltransferase	NA	L7RCM8	Acanthamoeba_polyphaga_moumouvirus	22.8	5.2e-08
WP_142499200.1|924704_925832_+	EpsG family protein	NA	NA	NA	NA	NA
WP_142499201.1|925840_926350_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_142499202.1|926336_927572_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_142499203.1|927578_928577_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_142499204.1|928573_929776_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_142499205.1|930283_931252_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_142499206.1|931953_932727_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_098039597.1|932739_933489_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.0	3.9e-23
WP_098047036.1|933518_934139_+	sugar transferase	NA	NA	NA	NA	NA
WP_142499207.1|934135_935308_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_142499446.1|935319_936309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499208.1|936317_937232_+	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_072574933.1|937231_938380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078009533.1|938369_939899_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_063164027.1|939905_940646_+	hypothetical protein	NA	F2Y1U7	Organic_Lake_phycodnavirus	24.3	4.3e-06
WP_142499209.1|940642_941623_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.0	5.8e-11
WP_142499210.1|941619_942594_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_142499211.1|942607_943726_+	glycosyltransferase	NA	A0A1C9C5J4	Heterosigma_akashiwo_virus	23.9	6.2e-09
WP_142499212.1|943843_945616_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_072574940.1|945697_946738_+	acyltransferase	NA	NA	NA	NA	NA
WP_142499213.1|946914_951774_+	dextransucrase	NA	NA	NA	NA	NA
WP_142499214.1|951972_953259_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_142499215.1|953455_954730_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079376176.1|954965_960293_+	dextransucrase	NA	NA	NA	NA	NA
960458:960517	attL	ACGCCGTTTGTAAAATTAAGTTAGAAAAATAAAAAGCCATTTGTGATAGACTTTTGAATA	NA	NA	NA	NA
WP_142499054.1|960547_961516_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003672587.1|961601_962183_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.9	5.3e-20
WP_086118423.1|962301_962940_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142499216.1|962936_964553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003570727.1|964539_965457_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	9.9e-21
WP_117115192.1|965864_966746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117115193.1|966748_967336_+|integrase	site-specific integrase	integrase	A0A141E0P1	Streptococcus_phage	33.0	3.3e-17
WP_081538463.1|967474_968089_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081538464.1|968270_969188_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	1.3e-41
WP_117115194.1|969180_969930_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003668074.1|969980_970949_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_142499217.1|971041_971839_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003672620.1|972008_972596_+|integrase	site-specific integrase	integrase	A0A141E0P1	Streptococcus_phage	33.5	3.9e-18
WP_003672622.1|972739_973102_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_056994890.1|973104_973380_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142499448.1|973421_973814_+	replication protein	NA	NA	NA	NA	NA
WP_003672437.1|974106_976224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672439.1|977059_977518_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_003672440.1|977561_978704_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_142499054.1|978940_979909_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_142499218.1|980429_981362_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
978851:979929	attR	ACGCCGTTTGTAAAATTAAGTTAGAAAAATAAAAAGCCATTTGTGATAGACTTTTGAATAACCACAAACAAAAGTAAAGGAACATCACAAATGACTTATAAACATCTTACCACACGTGAACTAACCCTCATAGCTAATTTTTGGCACCAAGGTACGAAGGCTTATCAAGCTGCTAAACTGCTTAAACGAAGCCAAGAAACTATTTACCGAGTCTATCGATTTCTTGATAGCGGTAAGACCATTGCACAGTATCTTAAGGCTTACCAACGGAATAAGCAGCGTTGTGGTCGTAAGCAGGCTCAGCTAGCCAAAGATGAGATCAGCTACATCAATGAGCAGGTTAAAGCGGGCTGGACACCTGATACGATCATTGGTCGAGCAGAACGGACAATTAGCTGTAGTATGCGGACACTTTATCGGATGTTTGCTCGTGGACAGTACAATTTTGCCGTCCAGCAATTACCGATGAAAGGCAAGCGACACCCCAATGGCTATGTCGAACGACGTGGTAAGGCGGGGCATCTCGGTCGGAGTATTTACCAGCGATACCATGATTTTCCTCACTACCAACACGAGTTTGGTCACTTTGAAGCTGATACTGTTCAAGGAAAAGCTCATCGTGGTGCGGTCATGACCTTGGTGGAACGTCAATCTAAGGTGATGATTGTGCTTAACGTTCATCGTAAAACTGATGAAGCAGTTAACTATCACTTGGATAAATGGCTTTCTAAAATGCCTCGTCATTTCGTTAAGTCGATTACCTTTGATAATGGTAAGGAATTCGCGGGCTGGCGTGAGATTGCCAATAAGCATGACCTTCATACTTATTTTGCGGAGGTTGGAGCGCCCAATCAACGCGGCCTGAATGAAAACAATAATGGCATCTTACGTCGTGACGGTCTCAGTAAACGATTAGACTTCCGTAATTTACCAGATGAACTAATCATCCAGCTGATGCACAAACGAAATACTATTCCACGGAAGTCACTTCACTACCGCACACCACTTGAAGTATTCCTAAGTCACGTCACAGATGAACAGCTTTCAACATTTTTCTAATTTAAATTGACATTTCGGGA	NA	NA	NA	NA
WP_016496795.1|981354_982758_+	amino acid permease	NA	NA	NA	NA	NA
WP_016496796.1|982836_983094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041816984.1|983492_983891_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_016496797.1|983890_985066_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	5.9e-119
WP_003672329.1|985427_985670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499219.1|985851_987702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499220.1|987766_991252_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.9	9.0e-38
WP_003676694.1|991347_992124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499221.1|992110_992320_+	hypothetical protein	NA	A0A0A1ERA5	Lactobacillus_phage	54.5	5.5e-12
WP_003676691.1|992472_993591_+	exonuclease SbcCD subunit D	NA	J9PM68	Bacillus_phage	25.7	4.2e-05
WP_142499222.1|993592_996694_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_142499223.1|997146_998118_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003676686.1|998269_998725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496805.1|998753_999245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496806.1|1005090_1005732_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003673972.1|1005874_1008181_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003673974.1|1008338_1009598_+	chloride channel protein	NA	NA	NA	NA	NA
WP_003668074.1|1009638_1010607_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_035161361.1|1010861_1011509_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_086141641.1|1011505_1012324_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016496809.1|1012316_1013126_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003673979.1|1013405_1013711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499224.1|1013711_1015613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|1015996_1017127_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
>prophage 6
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	1114506	1171851	2084748	holin,transposase	Staphylococcus_phage(31.25%)	53	NA	NA
WP_142499018.1|1114506_1115430_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	1.1e-32
WP_003667869.1|1116005_1116377_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_003667871.1|1116439_1117012_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_050802151.1|1117082_1117745_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	9.7e-26
WP_003674120.1|1117756_1120021_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003674121.1|1120098_1121016_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003666188.1|1121038_1121743_-	DnaD domain protein	NA	A0T2N5	Geobacillus_phage	31.5	1.5e-05
WP_003674123.1|1121826_1122345_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_003674125.1|1122438_1125303_-	DEAD/DEAH box helicase	NA	A0A1X9I5C8	Streptococcus_phage	35.9	1.9e-62
WP_016496863.1|1125518_1126469_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_003674128.1|1126468_1127440_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003666183.1|1127467_1128595_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_142499239.1|1128610_1129657_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003674130.1|1129717_1130206_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_142499238.1|1130301_1131588_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003674131.1|1131771_1133961_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_003674132.1|1134124_1135144_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003674133.1|1135265_1136144_+	ROK family protein	NA	NA	NA	NA	NA
WP_142499240.1|1136324_1137299_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003666171.1|1137326_1138067_-|holin	antiholin	holin	NA	NA	NA	NA
WP_003666169.1|1138059_1138479_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003674135.1|1138680_1139412_-	response regulator	NA	NA	NA	NA	NA
WP_142499241.1|1139392_1141156_-	GAF domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	29.8	1.0e-58
WP_003674137.1|1141156_1142023_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_016496868.1|1142041_1143409_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_079376032.1|1143553_1144366_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003666157.1|1144423_1144660_-	cytochrome b5	NA	NA	NA	NA	NA
WP_142499242.1|1145127_1145799_+	response regulator	NA	NA	NA	NA	NA
WP_086120414.1|1145993_1146884_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003667917.1|1146900_1147233_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003674143.1|1147265_1148675_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003674144.1|1148667_1149129_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_142499243.1|1149115_1150354_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.6	1.0e-105
WP_003674148.1|1150334_1151624_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003666143.1|1151635_1152433_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FFL6	Cedratvirus	26.4	2.8e-11
WP_003674151.1|1152659_1152863_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_142499244.1|1152864_1154856_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003667936.1|1154862_1155021_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_142499245.1|1155086_1156508_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.4	3.2e-74
WP_003667939.1|1156522_1157344_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_003674156.1|1157376_1157751_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003667942.1|1158098_1158674_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003667944.1|1158879_1160064_-	MFS transporter	NA	NA	NA	NA	NA
WP_086142795.1|1160232_1163121_+	YfhO family protein	NA	NA	NA	NA	NA
WP_086142796.1|1163194_1163920_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	45.4	1.9e-27
WP_016496878.1|1163965_1164424_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.0	7.9e-27
WP_003674164.1|1164426_1165608_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.4	8.1e-92
WP_086142797.1|1165607_1166210_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.5	1.4e-31
WP_142499450.1|1166202_1167270_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.8e-42
WP_016496813.1|1167356_1168733_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_072575011.1|1169094_1170039_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_142499246.1|1170277_1171453_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.2	8.6e-118
WP_041816984.1|1171452_1171851_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
>prophage 7
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	1178053	1237470	2084748	transposase,integrase,capsid,terminase,portal,tail,head	Lactobacillus_phage(47.37%)	56	1172770:1172784	1195234:1195248
1172770:1172784	attL	GAATAGTCATAATTA	NA	NA	NA	NA
WP_035157478.1|1178053_1178989_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.3	1.4e-83
WP_065867984.1|1179030_1180104_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065867986.1|1180280_1180574_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	42.4	5.1e-11
WP_086142405.1|1180589_1180874_-	plasmid maintenance system killer	NA	A0A222YWE2	Escherichia_phage	40.5	3.6e-06
WP_065867987.1|1180945_1182130_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_086142815.1|1182122_1183772_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	46.9	5.6e-115
WP_142499249.1|1183784_1186895_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_142499250.1|1187102_1187594_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003666104.1|1187654_1187930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667978.1|1188126_1188357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499251.1|1188496_1188808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499252.1|1188854_1189388_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142499253.1|1189614_1191144_+	gluconate kinase	NA	NA	NA	NA	NA
WP_142499254.1|1191156_1192500_+	gluconate permease	NA	NA	NA	NA	NA
WP_142499255.1|1192582_1193602_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_142499256.1|1193652_1195182_+	gluconate kinase	NA	NA	NA	NA	NA
WP_142499257.1|1195363_1195909_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
1195234:1195248	attR	TAATTATGACTATTC	NA	NA	NA	NA
WP_003666092.1|1195923_1196115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674201.1|1196132_1196516_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016496900.1|1196677_1197172_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668066.1|1197199_1197379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674203.1|1197466_1197790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674205.1|1197854_1198259_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_142499258.1|1198408_1199785_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	1.8e-29
WP_003674209.1|1199857_1200793_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003674211.1|1200901_1201369_-	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	38.5	8.9e-18
WP_003674213.1|1201385_1203851_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.0	3.7e-94
WP_016496905.1|1203869_1205879_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.3	8.6e-126
WP_003666074.1|1206104_1206734_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_079376010.1|1206775_1207690_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_063164116.1|1207787_1209908_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.6	8.8e-97
WP_142499259.1|1210404_1210650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499260.1|1210753_1211143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499261.1|1211165_1211660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499262.1|1211703_1214250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499263.1|1214823_1217358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499452.1|1217375_1218569_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	57.1	4.4e-85
WP_142499264.1|1218710_1219124_-	hypothetical protein	NA	A0A0M7REJ4	Lactobacillus_phage	40.3	1.0e-04
WP_142499265.1|1219107_1219470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499266.1|1219485_1220775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499267.1|1220793_1221096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499268.1|1221125_1223399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499269.1|1223422_1224364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499270.1|1224383_1227980_-	hypothetical protein	NA	A8YQJ9	Lactobacillus_phage	36.0	2.0e-64
WP_142499271.1|1227999_1228272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499272.1|1228243_1228624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499273.1|1228723_1229329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499274.1|1229347_1229725_-	DUF806 family protein	NA	A8YQJ6	Lactobacillus_phage	45.5	1.4e-24
WP_142499275.1|1229727_1230183_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	43.6	3.3e-17
WP_142499276.1|1230182_1230563_-|head	phage head closure protein	head	A0A0M7RFE1	Lactobacillus_phage	32.5	2.5e-10
WP_142499277.1|1230541_1230871_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_142499278.1|1230896_1232834_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	48.9	7.8e-116
WP_142499279.1|1232805_1234062_-|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	37.5	5.8e-64
WP_142499280.1|1234086_1236021_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.2	1.3e-147
WP_142499281.1|1236038_1236596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499282.1|1236993_1237470_-	HNH endonuclease	NA	Q9AZM8	Lactococcus_phage	36.0	2.6e-20
>prophage 8
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	1247490	1343640	2084748	transposase,plate,integrase,capsid,terminase,portal,protease,tail,tRNA,head	Lactobacillus_phage(48.94%)	103	1262066:1262083	1327039:1327056
WP_142499296.1|1247490_1248687_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	29.1	2.6e-37
WP_003674225.1|1249647_1250418_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	36.1	1.7e-21
WP_003674227.1|1250410_1251283_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003670906.1|1251303_1251525_-	YozE family protein	NA	NA	NA	NA	NA
WP_003674228.1|1251543_1252146_-	YpmS family protein	NA	NA	NA	NA	NA
WP_003674230.1|1252148_1253075_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_142499297.1|1253248_1254091_-	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	1.8e-16
WP_003666062.1|1254269_1254914_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_142499298.1|1254902_1255391_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	2.1e-22
WP_003668102.1|1255406_1256369_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.2	2.5e-115
WP_016496907.1|1256387_1258298_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.8e-56
WP_003674237.1|1258299_1259511_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003674239.1|1259636_1260902_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003666054.1|1261037_1261313_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_003666051.1|1261522_1262836_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
1262066:1262083	attL	ATCATCAATTGCCCGCAT	NA	NA	NA	NA
WP_016496909.1|1263065_1264316_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003674242.1|1264388_1265075_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_016496910.1|1265148_1265721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674244.1|1265805_1267245_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.8	1.3e-62
WP_016496911.1|1267234_1268260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499299.1|1268360_1268939_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003674248.1|1269309_1270023_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003674249.1|1270022_1270628_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.5e-12
WP_003674251.1|1270590_1271382_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003674254.1|1271374_1271731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674256.1|1271744_1272638_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.6	2.5e-21
WP_003674257.1|1272637_1273519_-	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_003665875.1|1273660_1275082_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003674259.1|1275267_1278615_-	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.6	2.2e-150
WP_041821711.1|1278697_1278943_+	YjzD family protein	NA	NA	NA	NA	NA
WP_142499300.1|1279402_1280566_-	hypothetical protein	NA	A0A2R2ZGJ6	Clostridioides_phage	40.2	9.1e-11
WP_142499301.1|1280684_1281797_-	LysM peptidoglycan-binding domain-containing protein	NA	U3PJ04	Lactobacillus_phage	43.2	9.5e-42
WP_142499302.1|1281798_1282206_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	45.2	1.5e-16
WP_142499303.1|1282180_1282360_-	hypothetical protein	NA	A0A0A1ENA2	Lactobacillus_phage	54.9	2.1e-07
WP_142499304.1|1282366_1282747_-	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	56.0	8.8e-32
WP_142499305.1|1282920_1283073_-	XkdX family protein	NA	NA	NA	NA	NA
WP_142499306.1|1283065_1283257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499307.1|1283257_1285561_-|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	51.7	1.2e-59
WP_142499308.1|1285560_1285878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499454.1|1285894_1288414_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	44.3	1.2e-164
WP_142499309.1|1288441_1289284_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	55.6	3.1e-85
WP_142499310.1|1289287_1293787_-|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	60.5	4.4e-271
WP_003670997.1|1293982_1294324_-	hypothetical protein	NA	E9LUJ0	Lactobacillus_phage	42.1	6.1e-16
WP_142499311.1|1294376_1295006_-|tail	phage tail protein	tail	E9LUI9	Lactobacillus_phage	72.9	1.5e-76
WP_142499312.1|1295005_1295425_-	hypothetical protein	NA	D2KRB3	Lactobacillus_phage	52.9	2.8e-39
WP_003663710.1|1295421_1295796_-	HK97 gp10 family phage protein	NA	E9LUI7	Lactobacillus_phage	63.2	5.8e-36
WP_142499313.1|1295779_1296133_-|head	phage head closure protein	head	E9LUI6	Lactobacillus_phage	64.9	2.2e-37
WP_142499314.1|1296035_1296449_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUI5	Lactobacillus_phage	63.8	2.4e-30
WP_142499315.1|1296590_1297730_-|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	73.7	1.1e-146
WP_142499316.1|1297730_1298384_-|head,protease	HK97 family phage prohead protease	head,protease	D2KRA8	Lactobacillus_phage	70.3	2.4e-61
WP_142499317.1|1298322_1299582_-|portal	phage portal protein	portal	D2KRA7	Lactobacillus_phage	75.5	3.0e-177
WP_086131867.1|1299588_1299744_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_142499318.1|1299910_1300132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499319.1|1300112_1301822_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	83.7	9.7e-288
WP_085680634.1|1301818_1302286_-|terminase	phage terminase small subunit P27 family	terminase	E9LUH9	Lactobacillus_phage	65.4	9.1e-47
WP_142499320.1|1302469_1303264_-	AAA family ATPase	NA	E9LUN5	Lactobacillus_phage	71.9	3.6e-112
WP_142499456.1|1303931_1304477_-	hypothetical protein	NA	A0A191KBR1	Streptococcus_virus	29.5	1.4e-06
WP_142499321.1|1304491_1305415_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_142499322.1|1306242_1306758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499323.1|1307011_1307317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085681283.1|1307309_1307528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066035353.1|1307663_1307846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099979603.1|1307845_1308592_-	hypothetical protein	NA	A0A1L2JZ42	Aeribacillus_phage	42.9	1.9e-38
WP_142499324.1|1308595_1309021_-	replication terminator protein	NA	M1I9V9	Streptococcus_phage	50.0	6.2e-26
WP_085681297.1|1309013_1309361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499325.1|1309370_1309835_-	HNH endonuclease	NA	X2KPF7	Streptococcus_phage	32.4	1.9e-12
WP_085649873.1|1309806_1310067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085681277.1|1310056_1310533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499326.1|1310532_1311558_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	40.2	6.0e-59
WP_142499327.1|1311448_1312069_-	N-6 DNA methylase	NA	A0A097BYG1	Leuconostoc_phage	48.3	9.3e-55
WP_142499328.1|1312073_1312979_-	hypothetical protein	NA	L0P704	Lactobacillus_phage	61.6	2.2e-36
WP_085680981.1|1312990_1313200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085678363.1|1313233_1313422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499329.1|1313562_1313802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499330.1|1313969_1314425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663758.1|1314636_1314867_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_142499331.1|1315002_1315665_+	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	45.1	1.9e-45
WP_142499332.1|1315723_1316362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142499333.1|1316381_1316963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109913733.1|1317343_1317556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499334.1|1317566_1317770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499335.1|1317833_1318616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099979621.1|1318779_1319892_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	3.6e-57
WP_003674261.1|1319928_1321179_-	peptidase T	NA	NA	NA	NA	NA
WP_142499336.1|1321203_1322028_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_079376002.1|1322014_1322731_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_003674266.1|1322819_1324004_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016496838.1|1324243_1325530_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003674268.1|1325720_1326863_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.5e-37
WP_016496915.1|1326864_1328730_-	DNA primase	NA	I6P4U6	Helicobacter_phage	34.2	1.0e-48
1327039:1327056	attR	ATCATCAATTGCCCGCAT	NA	NA	NA	NA
WP_016496916.1|1328864_1330940_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003665860.1|1330941_1331928_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003674276.1|1332188_1332974_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003674278.1|1332989_1333895_-	GTPase Era	NA	NA	NA	NA	NA
WP_142499337.1|1333906_1334302_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003665856.1|1334285_1334765_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003674280.1|1334764_1335772_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.4	8.6e-50
WP_016496918.1|1335871_1336843_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016496919.1|1336848_1337421_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_072575053.1|1337548_1338934_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003674287.1|1340314_1341292_-	choloylglycine hydrolase family protein	NA	A0A2K9L5Y5	Tupanvirus	24.8	1.4e-17
WP_142499338.1|1341359_1342328_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_013923736.1|1342509_1343640_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
>prophage 9
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	1675181	1751470	2084748	holin,tRNA,transposase	Streptococcus_phage(35.29%)	52	NA	NA
WP_142499359.1|1675181_1675640_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_142499360.1|1675759_1676734_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003676241.1|1676794_1677484_-	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	49.2	1.0e-41
WP_003667483.1|1677634_1678219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666449.1|1678275_1678749_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.8	4.0e-42
WP_142499361.1|1678766_1681172_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.3	7.7e-89
WP_142499362.1|1681158_1681935_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003676245.1|1682013_1682238_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_086132300.1|1682319_1683870_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003666444.1|1683987_1685370_-	amino acid permease	NA	NA	NA	NA	NA
WP_003666443.1|1685565_1686888_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	69.9	8.9e-172
WP_003667474.1|1686978_1687728_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_063164244.1|1687843_1689049_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003666436.1|1689139_1690147_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003666435.1|1690649_1691243_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.3	8.0e-56
WP_003666428.1|1692180_1693122_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.2e-50
WP_003667464.1|1693140_1694127_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	55.2	1.9e-94
WP_142499363.1|1694142_1695036_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.4	4.5e-10
WP_012390508.1|1695122_1696454_-	amino acid permease	NA	NA	NA	NA	NA
WP_003667458.1|1696722_1699587_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.9	4.0e-310
WP_142499364.1|1699602_1701618_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_003666419.1|1701839_1702112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666416.1|1702216_1702855_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003667456.1|1703021_1704746_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	59.8	5.0e-199
WP_003667454.1|1704835_1705342_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003667453.1|1705387_1706272_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109883758.1|1706530_1707700_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_109883756.1|1707794_1708727_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.8	1.7e-84
WP_003667448.1|1708923_1709793_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_109897249.1|1709793_1711281_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003667445.1|1711273_1712008_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003666398.1|1712074_1712989_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.4	7.5e-69
WP_142499365.1|1713053_1714070_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_142499366.1|1714095_1714923_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_086118063.1|1714915_1715887_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003670462.1|1715900_1716257_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_142499367.1|1716256_1716592_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_102816417.1|1716621_1717620_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_102816418.1|1717663_1717819_-	acyl dehydratase	NA	NA	NA	NA	NA
WP_142499368.1|1717819_1720183_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_003667436.1|1720389_1720938_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_142499369.1|1721730_1723062_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	38.2	1.6e-75
WP_142499370.1|1723123_1723756_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.5	2.1e-38
WP_142499371.1|1725164_1739780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499457.1|1739915_1740962_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.0	1.6e-27
WP_142499372.1|1741111_1742827_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.0e-95
WP_142499373.1|1743124_1743583_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.3	3.9e-18
WP_142499374.1|1743817_1745317_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_142499375.1|1745317_1746874_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003668074.1|1747853_1748822_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003667431.1|1749634_1750045_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072575358.1|1750183_1751470_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP030089	Lactobacillus reuteri strain YSJL-12 chromosome, complete genome	2084748	1962158	2030354	2084748	protease,tRNA,integrase,transposase	unidentified_phage(13.33%)	55	1966385:1966404	1990211:1990230
WP_016497152.1|1962158_1962893_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003674515.1|1962968_1963673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667139.1|1963782_1964103_-	membrane protein	NA	NA	NA	NA	NA
WP_063164286.1|1964389_1965745_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	52.0	3.7e-125
WP_003667137.1|1965871_1966159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|1966296_1967427_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
1966385:1966404	attL	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_086143147.1|1967512_1970362_-	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	26.8	3.3e-22
WP_142499411.1|1970382_1970883_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_086132026.1|1970882_1971836_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.8	1.1e-14
WP_085719611.1|1972090_1974313_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_085719612.1|1974328_1974955_+	Tat pathway signal sequence	NA	NA	NA	NA	NA
WP_085719613.1|1974997_1975825_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003665466.1|1976049_1976820_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003665465.1|1976951_1977353_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_003674501.1|1977364_1977907_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_003674500.1|1979880_1981299_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003665459.1|1981444_1981678_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003674496.1|1981743_1982394_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_142499413.1|1982472_1982700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499415.1|1982807_1983548_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.2	3.5e-08
WP_142499417.1|1983711_1985034_-	MFS transporter	NA	NA	NA	NA	NA
WP_003674489.1|1985758_1986328_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063164289.1|1986469_1987330_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674487.1|1987521_1987746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674484.1|1987866_1988355_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003674482.1|1988405_1988744_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003674480.1|1988746_1989745_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_013923736.1|1990122_1991253_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
1990211:1990230	attR	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_016497165.1|1997138_1998389_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.5	7.8e-85
WP_003675881.1|1998912_1999962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003665449.1|2000129_2000816_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003675884.1|2000911_2002171_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003675891.1|2004310_2005348_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.9	1.1e-60
WP_003675893.1|2005352_2006807_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.4e-56
WP_003675894.1|2006782_2009011_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	2.3e-148
WP_003675896.1|2009014_2009695_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003675897.1|2009695_2009944_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_063164290.1|2009944_2010664_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_003675901.1|2010886_2012182_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.3	9.4e-17
WP_035161928.1|2012253_2013408_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016497168.1|2013370_2013856_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.4	1.8e-21
WP_003675907.1|2014037_2014754_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003675908.1|2014770_2016450_-	acetolactate synthase AlsS	NA	G8DDL3	Micromonas_pusilla_virus	22.9	8.7e-31
WP_003675909.1|2016634_2018296_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003665417.1|2018464_2019508_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003675910.1|2019679_2020855_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003675911.1|2021112_2021775_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	46.0	1.8e-40
WP_086120158.1|2021833_2022493_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_016497172.1|2022564_2023206_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_142499419.1|2023202_2023949_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003665409.1|2023930_2024857_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003665407.1|2024856_2026149_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003675915.1|2026162_2027092_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.9	5.0e-28
WP_035161933.1|2027436_2028318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013924000.1|2028935_2030354_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP030090	Lactobacillus reuteri strain YSJL-12 plasmid unnamed1, complete sequence	51906	17927	26420	51906		Streptococcus_phage(33.33%)	10	NA	NA
WP_016497301.1|17927_18230_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	46.9	8.0e-20
WP_007124974.1|18785_19403_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_016497300.1|19419_19770_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.0	1.0e-10
WP_016497299.1|20030_20462_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_016497298.1|20712_22866_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.4	2.3e-60
WP_142499477.1|22918_23083_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_002817475.1|23101_23398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497322.1|23688_24267_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	33.3	1.8e-23
WP_016497294.1|24399_24813_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	31.0	7.6e-05
WP_016497293.1|25085_26420_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	1.0e-29
