The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	364821	416701	5031277	portal,holin,capsid,integrase,tail,terminase,plate,head	Shigella_phage(46.77%)	71	385389:385437	425497:425545
WP_001043675.1|364821_365874_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366156_367260_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367271_368522_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051887.1|368727_369891_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077941726.1|369767_370202_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
WP_000206732.1|370117_370423_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|370422_370785_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|370775_371312_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081309.1|371439_372264_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001325618.1|372329_372710_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-63
WP_000159356.1|373130_373322_+	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_000859462.1|373734_374409_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|374499_374700_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|374743_375295_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_058647562.1|375291_376440_+	peptidase	NA	A5LH69	Enterobacteria_phage	99.7	4.8e-214
WP_000620701.1|376436_376661_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	9.7e-39
WP_001677149.1|376657_377476_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_072129969.1|377472_377967_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	3.3e-87
WP_001343335.1|377966_378620_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_048348968.1|378616_378943_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
WP_021512743.1|378939_379329_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_023352899.1|379348_380158_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
WP_001439745.1|380165_381155_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_084569447.1|381168_381921_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	3.7e-138
WP_001624505.1|382071_382329_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|382474_382861_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|382847_383129_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|383128_383743_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|383739_384132_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|384593_384926_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|384976_385327_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
385389:385437	attL	GGACTGCCCGCCCCATCGTTTTTTTATACCCGCGAAAAATGAAATTTAA	NA	NA	NA	NA
WP_000929174.1|385452_385938_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_000088161.1|385951_387685_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000605606.1|387696_387879_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001514795.1|387878_389120_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_021567480.1|389759_390965_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021577001.1|391014_391242_+	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000927719.1|391216_391540_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|391536_391947_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_022630978.1|391921_392428_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000779279.1|392424_392985_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|392993_393164_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_022630977.1|393147_394644_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|394643_395000_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|394999_395269_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_015675131.1|395235_395418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052896704.1|395410_397243_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	5.1e-303
WP_001439754.1|397324_397837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|397927_399256_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|399252_400332_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|400331_400880_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|400879_401305_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|401291_402350_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|402340_402925_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_142515937.1|402928_404461_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	97.7	3.6e-241
WP_006678265.1|404430_405048_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|405051_405459_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_000639149.1|406513_407077_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_032214357.1|407706_408039_+	protein flxA	NA	NA	NA	NA	NA
WP_001529718.1|408756_409971_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_001304884.1|410136_410352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000035054.1|410399_410603_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529719.1|410602_411034_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_033567214.1|411046_411880_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000476150.1|411872_412055_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032150717.1|412048_413077_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|413069_413264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|413260_413524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|413520_413742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|413734_414337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529722.1|414349_416701_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
425497:425545	attR	GGACTGCCCGCCCCATCGTTTTTTTATACCCGCGAAAAATGAAATTTAA	NA	NA	NA	NA
>prophage 2
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	1035272	1044004	5031277	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1035272_1036391_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1036387_1038334_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1038463_1038685_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1039008_1039329_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1039359_1041636_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1041827_1042286_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|1042458_1042734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|1042748_1044004_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	1094067	1184983	5031277	holin,lysis,integrase,tail,protease,tRNA,terminase	Salmonella_phage(62.22%)	91	1096976:1096995	1160871:1160890
WP_001154025.1|1094067_1094871_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1094863_1096186_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1096166_1096871_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1096870_1101337_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1096976:1096995	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1101681_1103523_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1103782_1104331_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1104358_1105006_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1105067_1106258_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1106442_1107534_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1108140_1109541_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1109741_1110203_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1110199_1110433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1110519_1111734_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1111978_1113415_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1113492_1114695_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1114889_1116182_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1116226_1116475_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1116515_1116755_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1116797_1117955_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1117917_1121118_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1121244_1121595_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1121643_1121775_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1122071_1122506_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1122611_1122839_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1122873_1123194_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1123278_1124262_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1124264_1125014_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1125024_1125372_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1125368_1125827_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1125830_1126139_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1126142_1126787_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1126786_1127044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1127098_1128076_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1128087_1128684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1129275_1129509_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1129618_1129840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1129924_1130527_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_022631099.1|1130526_1130733_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.0e-34
WP_001096542.1|1130735_1131347_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1131343_1131484_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001534733.1|1132363_1132489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1132624_1133074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1133434_1134121_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1134396_1134726_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1134709_1135162_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1135179_1135626_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1136094_1136640_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1137760_1138093_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1138192_1138690_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1138806_1139340_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1139429_1140125_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1140134_1140872_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1140769_1141474_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000178849.1|1144934_1145177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1145230_1147669_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1147668_1148250_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1148725_1149694_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1150341_1150968_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1151036_1151336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1151320_1152007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1152277_1152469_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1152895_1155508_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1155715_1156726_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1156891_1157434_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1157430_1158540_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1158638_1160747_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1160759_1162667_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1160871:1160890	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1162681_1163935_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1163939_1165580_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1165576_1166140_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1166395_1166563_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1166662_1167181_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1167249_1169010_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1169195_1169648_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1169719_1170772_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1171128_1171638_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1171854_1172460_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1172446_1174600_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1174618_1175065_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1175188_1177243_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1177278_1177737_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1177831_1178494_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1178664_1179081_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1179125_1179443_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1179500_1180712_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1180926_1181475_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1181500_1182280_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1182328_1182610_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1182606_1182936_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1183022_1183682_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1184302_1184983_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	1972066	1978875	5031277	tail,integrase	Salmonella_phage(33.33%)	11	1966929:1966951	1976644:1976666
1966929:1966951	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1972066_1972948_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1973420_1973609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1973673_1973841_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1974097_1974631_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1974684_1974915_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1975104_1975599_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1975658_1976513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1976886_1977240_-	YebY family protein	NA	NA	NA	NA	NA
1976644:1976666	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1977256_1978132_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1978132_1978507_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1978644_1978875_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2054325	2133606	5031277	portal,holin,capsid,integrase,transposase,tail,protease,terminase,plate,head	Salmonella_phage(73.91%)	106	2060863:2060878	2135229:2135244
WP_000502119.1|2054325_2054784_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2054964_2056170_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2056248_2057736_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2057992_2059396_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2059410_2059818_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2059817_2060186_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2060257_2061742_+	alpha-amylase	NA	NA	NA	NA	NA
2060863:2060878	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2061781_2062207_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2062392_2063598_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2063594_2063828_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2064092_2064479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2064598_2064913_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2065129_2066812_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2066804_2067800_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2067792_2068500_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2068499_2069870_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2069891_2070335_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2070331_2071549_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2071653_2072121_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2072125_2073130_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2073126_2073540_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2073539_2073917_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2073916_2074654_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2074663_2074933_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2074941_2075736_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2076017_2076641_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2076679_2076928_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2077002_2077230_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2077539_2078355_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2078333_2080046_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2080210_2080456_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2080472_2081384_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2081559_2082480_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2082468_2082939_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2082919_2084350_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2084423_2085119_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2085210_2085510_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2086159_2087356_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2087616_2087805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2087815_2088028_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2088482_2089751_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2089753_2090173_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2090299_2090461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2091654_2091867_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2091863_2092277_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2092324_2092438_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2092512_2092746_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2092859_2093465_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_001207832.1|2094983_2095571_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2095573_2096653_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2096645_2097059_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2097063_2097597_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2097596_2098655_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2098651_2099992_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2100051_2100501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2100517_2102443_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2102527_2102854_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2102850_2103207_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2103206_2104703_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2104692_2104857_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2104878_2105436_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2105432_2105945_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2105916_2106321_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2106317_2106641_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2106643_2106844_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2106893_2108099_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2108113_2108764_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2108741_2109983_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_052895330.1|2109982_2110165_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	2.9e-25
WP_033567282.1|2110176_2111910_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2111906_2112401_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2112526_2112877_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2112927_2113260_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_097053918.1|2113559_2113838_-	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001530346.1|2113722_2114115_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2114111_2114726_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2114725_2115007_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2114993_2115380_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2115525_2115783_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2115933_2116686_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2116699_2117689_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2117696_2118557_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2118573_2118963_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2118971_2119847_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2119843_2120317_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2120313_2121288_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2121284_2121509_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2121505_2122648_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2122644_2123199_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2123227_2123452_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071530432.1|2123390_2123576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2123549_2124245_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2124450_2124789_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2124751_2124976_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2125515_2125887_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2125944_2126772_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2126908_2127448_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2127518_2128052_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2128053_2128311_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2128321_2128903_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2128906_2129476_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2129500_2129743_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2129744_2130734_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2131025_2131823_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2132194_2132485_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2133132_2133606_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2135229:2135244	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2219600	2230106	5031277		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2219600_2220914_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2220940_2222020_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2222024_2222798_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2222794_2223787_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2223792_2224344_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2224344_2225223_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2225270_2226170_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2226169_2227255_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2227631_2228525_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2228702_2230106_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2298414	2307585	5031277	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2298414_2300448_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2300688_2301147_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2301318_2301849_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2301905_2302373_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2302419_2303139_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2303135_2304821_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2305043_2305775_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2305834_2305942_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2305922_2306654_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2306637_2307585_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2326992	2393388	5031277	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2326992_2327688_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2327841_2328726_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2328902_2329622_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2329618_2329864_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2330068_2331310_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2331303_2332539_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2332613_2333624_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2333639_2335160_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2335293_2336292_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2336790_2337813_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2337962_2339105_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2339119_2339788_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2340117_2340975_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2340963_2341353_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2341357_2342725_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2342941_2343829_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2343861_2345184_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2345227_2347219_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2347564_2349034_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2349223_2350087_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2350207_2351257_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2351335_2352193_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2352257_2353946_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2353962_2354901_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2354900_2356031_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2356399_2357581_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2357645_2358311_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2358312_2358435_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2358822_2359077_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2359400_2359973_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2360185_2361172_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2361201_2361921_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2362334_2362907_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2363232_2364789_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2364895_2366701_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2366710_2367805_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2367804_2368830_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2368831_2370421_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2370424_2370769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2371159_2372350_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2372377_2373073_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2373224_2374985_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2375109_2375394_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2375502_2376123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2376150_2377158_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2377337_2377565_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2377596_2379357_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2379637_2380141_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2380168_2380459_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2380806_2382636_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2382689_2383133_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2383510_2384038_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2384040_2385282_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2385874_2386204_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2386500_2387832_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2387860_2388229_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2388243_2389233_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2389561_2391928_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2392096_2392300_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2392596_2393388_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2733092	2833195	5031277	portal,holin,capsid,lysis,integrase,transposase,tail,protease,tRNA,terminase,head	Salmonella_phage(41.27%)	109	2759236:2759251	2828284:2828299
WP_000940032.1|2733092_2733824_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2733942_2734746_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2734890_2735769_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2735950_2736994_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2736997_2737816_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2737826_2738840_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2738840_2739827_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2739817_2740456_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2740581_2741859_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2741853_2742993_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2743188_2744442_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2744766_2745957_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2746138_2747683_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2748043_2749375_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2749457_2751602_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2751657_2753118_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2753166_2753505_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2753581_2754919_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2754915_2755680_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2755681_2757112_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2757761_2761649_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2759236:2759251	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2761670_2761904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2761904_2763449_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2763499_2764051_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2764075_2764711_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2764714_2766076_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2766086_2766980_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2767095_2767944_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2767982_2768900_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2768921_2770118_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2770233_2771160_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2771197_2771458_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2771569_2771950_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2771949_2772681_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2772692_2773421_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2773432_2774338_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2774334_2775015_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2775288_2776263_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2776279_2778079_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2778483_2779977_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2780437_2780575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2781287_2781452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2782031_2782097_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2782159_2782372_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2782478_2782706_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2782802_2783381_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2783370_2784195_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2784191_2786564_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2786617_2786860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2786898_2790261_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2790322_2790970_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2790867_2791605_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2791611_2792310_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2792319_2792649_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2792651_2795747_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2795718_2796057_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2796053_2796449_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2796499_2797246_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2797253_2797655_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2797763_2798894_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2798942_2799521_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2799548_2799932_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2799942_2800302_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2800359_2801388_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2801442_2801790_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2801802_2803299_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2803288_2804869_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2804865_2805069_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2805052_2806984_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2806955_2807501_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2807787_2808189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2808424_2808877_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2808894_2809347_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2809330_2809660_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2809935_2810622_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2810836_2811025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2811531_2812095_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2812185_2812371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2812367_2813045_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2813041_2813182_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2813178_2813790_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2813792_2813999_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929803.1|2813998_2814601_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2814640_2814946_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2814935_2815175_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_071530012.1|2815366_2815648_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	92.5	1.4e-47
WP_000445792.1|2816039_2816513_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2816512_2817037_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2817033_2817381_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2817391_2818141_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2818143_2819127_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2819211_2819586_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2819551_2819788_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2819917_2820322_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2820720_2820879_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2820900_2821251_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2821377_2824305_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2824267_2825425_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2825467_2825707_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2825747_2826032_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2826009_2827239_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2827736_2828216_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2828212_2829169_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2828284:2828299	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2829168_2829819_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2829850_2830426_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2830422_2830587_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2830586_2830766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2830850_2832473_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2832457_2833195_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	2865680	2927016	5031277	tRNA,transposase,integrase	Escherichia_phage(45.45%)	49	2880900:2880914	2928605:2928619
WP_000469804.1|2865680_2866448_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2866492_2867041_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2867059_2867308_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2867621_2868983_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2869148_2869940_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2869959_2871246_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2871366_2871972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2872006_2872597_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2872719_2873598_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2873683_2875345_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2875493_2875832_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2875997_2876288_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2876277_2876754_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2876903_2877386_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2877999_2889474_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
2880900:2880914	attL	CGCGCGTGTCGAAGT	NA	NA	NA	NA
WP_000533858.1|2889538_2890948_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2890944_2893125_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2893132_2894296_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2894896_2895961_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2895974_2896142_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2896188_2896782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2897171_2898365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2898699_2899527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2899977_2900193_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2900228_2902298_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2902718_2904002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2904046_2904865_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2905018_2905375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2905469_2905754_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2905866_2906388_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2906384_2906759_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2906755_2907736_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2907746_2908760_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2909054_2910257_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2910330_2910966_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_031603456.1|2910989_2911553_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2911552_2912395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2912524_2914066_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2914288_2915968_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|2917018_2917723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2918307_2919168_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|2919317_2919719_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2919765_2920470_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2920530_2921367_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2921366_2922170_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|2922230_2923046_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2923353_2924205_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2924960_2925665_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2925711_2927016_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2928605:2928619	attR	CGCGCGTGTCGAAGT	NA	NA	NA	NA
>prophage 11
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	3400879	3442409	5031277	portal,holin,capsid,integrase,tail,tRNA,terminase,head	Cronobacter_phage(68.42%)	48	3396216:3396231	3439631:3439646
3396216:3396231	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3400879_3401893_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3402120_3402336_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3402571_3404317_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3404466_3406314_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3406437_3406944_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3407267_3407570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000746531.1|3408001_3408187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3408938_3410639_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3410641_3411187_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3411158_3411884_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3411873_3412428_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3412440_3414675_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3414684_3415272_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3415264_3416449_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3416445_3416775_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3416771_3418742_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3418929_3419187_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001670161.1|3419173_3419362_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000376373.1|3419333_3419666_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3419665_3420007_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3420003_3420297_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3420306_3420762_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3420758_3421886_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3421882_3422590_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3422586_3423093_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3423089_3423578_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3423638_3424340_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3424343_3425366_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3425427_3426231_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3426391_3428167_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3428163_3429225_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3429221_3429545_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3429518_3429725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3429844_3431866_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3431862_3432723_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3432713_3432947_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3433014_3433416_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3433415_3433841_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3433830_3434058_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3434067_3434571_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3434601_3434823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3434966_3435548_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3435564_3436131_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3436134_3437172_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3437161_3438943_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3439200_3439968_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3439631:3439646	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3440199_3440847_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052895313.1|3440843_3442409_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	4477722	4498142	5031277	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4477722_4478451_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4478647_4478938_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4479186_4479642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4479638_4480244_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4480248_4481994_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4481996_4482629_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4482621_4483737_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4483727_4484087_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4484250_4485798_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4485797_4486727_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4486723_4487086_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4487413_4488136_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4488145_4489189_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4489176_4489386_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4489385_4490339_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4490338_4492693_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4492789_4492918_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4492877_4493195_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4493246_4493771_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4493770_4495198_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4495187_4495385_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4495381_4495837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4495996_4496311_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4496323_4496929_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4496931_4497219_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4497794_4498142_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 13
NZ_CP040686	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain USDA15WA-1 chromosome, complete genome	5031277	4524591	4561108	5031277	holin,capsid,integrase,tail,tRNA,terminase,plate	Shigella_phage(34.15%)	45	4515163:4515178	4568941:4568956
4515163:4515178	attL	GGCAGTTTTTGTCGCT	NA	NA	NA	NA
WP_000549966.1|4524591_4525026_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4525052_4525325_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_001061343.1|4525361_4525934_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_000206745.1|4525933_4526743_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4526742_4527105_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4527095_4527632_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_033567165.1|4527759_4528584_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_001323604.1|4528649_4529030_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_000141753.1|4529449_4529695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514782.1|4529612_4529888_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4529896_4530100_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000848748.1|4530271_4530946_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4531036_4531237_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4531280_4531838_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4532013_4532193_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|4532182_4533124_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086936917.1|4533120_4533615_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_001433188.1|4533614_4534268_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4534264_4534591_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4534587_4534977_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4534996_4535806_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_033567167.1|4535813_4536803_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_048306282.1|4536816_4537569_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_001624505.1|4537719_4537977_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|4538122_4538509_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4538495_4538777_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|4538776_4539391_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|4539387_4539780_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|4540241_4540574_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_142515940.1|4540611_4540974_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.7	1.1e-60
WP_048306293.1|4541099_4541585_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_000605606.1|4543342_4543525_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_022630975.1|4548640_4549189_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_022630974.1|4549599_4550658_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|4550648_4551233_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_142515941.1|4552706_4553354_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	4.6e-113
WP_001747940.1|4553357_4553765_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_000639149.1|4554819_4555383_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_077248251.1|4555407_4555530_+|capsid	capsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	73.5	2.0e-06
WP_033567204.1|4555526_4555775_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
WP_000332264.1|4555836_4556934_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4557022_4558060_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4558227_4558470_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235551.1|4558644_4559628_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|4559692_4561108_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
4568941:4568956	attR	AGCGACAAAAACTGCC	NA	NA	NA	NA
