The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	118342	125482	5320024		Escherichia_phage(83.33%)	6	NA	NA
WP_001272891.1|118342_120904_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001141345.1|121009_121666_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|121716_122484_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|122679_123588_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001551546.1|123584_124847_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|124843_125482_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 2
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	384107	435535	5320024	tRNA,protease,transposase,integrase	Escherichia_phage(33.33%)	47	395318:395333	434186:434201
WP_000858396.1|384107_384605_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001327408.1|384699_385407_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|385486_386218_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593261.1|386230_387181_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|387289_387853_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|387852_388269_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001327409.1|388442_389423_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|389440_390145_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|390162_390729_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|390725_391016_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|391023_391617_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239981.1|391609_392746_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745192.1|392814_393822_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394106.1|393938_394985_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|395160_395880_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
395318:395333	attL	AATGGGTTACCGCCGC	NA	NA	NA	NA
WP_001107565.1|396063_396390_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|396389_397109_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001327411.1|397269_398322_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091699.1|398349_398625_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|398689_399769_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|399970_401227_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839794.1|401275_403411_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|403809_404517_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|404895_406161_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|406416_407460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333708.1|407602_407833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|409153_409705_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|412196_412430_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_001329935.1|412495_412783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327564.1|412896_413112_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	83.6	1.1e-26
WP_099156432.1|413080_414207_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|414297_414411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322950.1|415953_416268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|416264_416525_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|416566_417127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|417166_417595_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_142767527.1|418303_419531_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	2.0e-170
WP_001327737.1|419506_419695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074472.1|419644_420838_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|420973_422698_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|422698_423646_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|423645_425388_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|425384_426662_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001551626.1|426743_428945_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001336025.1|428882_429128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|429899_433787_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|434383_435535_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
434186:434201	attR	AATGGGTTACCGCCGC	NA	NA	NA	NA
>prophage 3
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	1223654	1268932	5320024	tRNA,transposase,integrase	Enterobacteria_phage(33.33%)	36	1224016:1224030	1246465:1246479
WP_001070187.1|1223654_1224344_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
1224016:1224030	attL	AGAAAACAGGCATCA	NA	NA	NA	NA
WP_000678399.1|1224349_1226431_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|1226464_1227670_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|1227949_1229341_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001551854.1|1229461_1231171_+	AsmA family protein	NA	NA	NA	NA	NA
WP_001551856.1|1231213_1231894_-	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_001551858.1|1231874_1232807_-	ROK family protein	NA	NA	NA	NA	NA
WP_142767532.1|1232854_1233715_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000457123.1|1233795_1234647_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_000662199.1|1234658_1235750_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001028074.1|1235774_1236089_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_001521621.1|1236106_1236577_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001177975.1|1236603_1238157_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_071591541.1|1238242_1238440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551861.1|1238451_1240770_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_001551865.1|1240779_1242162_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218900.1|1242848_1244033_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001551866.1|1244444_1245488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072254179.1|1246370_1246565_-	hypothetical protein	NA	NA	NA	NA	NA
1246465:1246479	attR	AGAAAACAGGCATCA	NA	NA	NA	NA
WP_141119348.1|1246515_1246713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551868.1|1246841_1248575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077697982.1|1250660_1252262_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	1.4e-78
WP_032233146.1|1253366_1253861_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_032233147.1|1254066_1254240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042194850.1|1254635_1255079_-	adhesin	NA	NA	NA	NA	NA
WP_042194852.1|1255094_1257677_-	Dr fimbrial biogenesis usher DraC	NA	NA	NA	NA	NA
WP_114079256.1|1257716_1258409_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001209230.1|1258813_1259119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032147691.1|1260814_1261042_+	F1845 fimbrial adhesin operon transcriptional regulator DaaF	NA	NA	NA	NA	NA
WP_142767533.1|1261304_1262123_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	47.2	2.9e-48
WP_000544830.1|1262155_1262953_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|1262952_1264125_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_001551873.1|1264211_1265543_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032147602.1|1266316_1266994_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|1266993_1267341_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1267360_1268932_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 4
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	2185046	2228091	5320024	transposase	Escherichia_phage(63.64%)	43	NA	NA
WP_001519307.1|2185046_2186027_-|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	57.2	6.1e-101
WP_001519308.1|2186091_2187198_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001519309.1|2187217_2187934_-	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001564306.1|2189397_2190000_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.3	1.3e-53
WP_000044708.1|2190477_2191074_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_001357506.1|2191554_2192103_+	metal ABC transporter substrate-binding lipoprotein/fibrin-binding adhesin FimA	NA	NA	NA	NA	NA
WP_000824099.1|2192167_2192707_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000066559.1|2192743_2193469_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000120954.1|2193534_2196171_+	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_001244821.1|2196180_2196711_+	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000870577.1|2196723_2197227_+	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_000832236.1|2197246_2198149_+	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001519311.1|2198390_2199734_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000438582.1|2200073_2201258_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000208180.1|2201338_2202799_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
WP_000833684.1|2203013_2203787_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001298053.1|2204200_2204584_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_001677288.1|2205009_2205921_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001534825.1|2205985_2207158_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211971.1|2207170_2207632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298014.1|2207628_2208312_-	YjiH family protein	NA	NA	NA	NA	NA
WP_001151839.1|2208561_2209116_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
WP_001534830.1|2209128_2210307_-	MFS transporter	NA	NA	NA	NA	NA
WP_001300028.1|2210374_2211235_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000666413.1|2211299_2211557_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001297641.1|2211553_2212321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551998.1|2212330_2213482_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001067855.1|2213550_2214255_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011152976.1|2214822_2215482_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
WP_001067855.1|2215688_2216393_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|2216404_2217061_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|2217156_2218341_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_001550555.1|2218435_2218726_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	41.8	5.2e-08
WP_000027057.1|2218820_2219681_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|2220172_2220877_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_142767537.1|2221440_2221968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|2222074_2222812_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|2222808_2223033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|2223243_2224737_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|2224767_2225019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|2224912_2225215_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|2225301_2226117_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000427619.1|2227086_2228091_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	2501398	2574438	5320024	tRNA,protease,transposase,plate	Emiliania_huxleyi_virus(11.11%)	58	NA	NA
WP_001520521.1|2501398_2502751_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2502780_2505213_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2505334_2505820_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139287.1|2505823_2506849_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2506953_2507409_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2507412_2508201_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001550626.1|2508200_2509349_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001550627.1|2509345_2509942_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001294781.1|2509978_2513461_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_000055748.1|2513473_2514433_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_142767541.1|2514530_2516672_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2516728_2517118_+	VOC family protein	NA	NA	NA	NA	NA
WP_001550628.1|2517182_2518481_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|2518529_2518790_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2518776_2518977_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185287.1|2519142_2519688_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|2519684_2520107_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239188.1|2520120_2520831_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001550629.1|2520861_2521686_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|2521738_2523457_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|2523567_2524275_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2524271_2524676_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2524793_2525609_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2525648_2526302_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2526294_2527326_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|2527512_2528085_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|2533844_2534648_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|2534644_2535559_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2535799_2536600_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001550637.1|2536677_2537448_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2537494_2538853_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|2538924_2539680_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|2539713_2540436_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2540432_2540900_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|2540964_2541696_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|2542234_2543020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|2543168_2543636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|2543645_2544560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|2544603_2545086_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001563736.1|2545109_2546462_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_122989438.1|2546472_2549907_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|2550015_2551428_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001550641.1|2551432_2552176_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_089503205.1|2552172_2555022_-	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	29.7	8.5e-79
WP_001521863.1|2555030_2555792_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|2555796_2557128_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2557130_2557655_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|2557651_2558932_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|2558956_2560039_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|2560002_2561853_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|2561856_2562270_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|2562276_2563752_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|2563802_2564027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550646.1|2564061_2564562_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2565258_2565777_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550647.1|2565986_2568128_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001077735.1|2572703_2573081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024192499.1|2573301_2574438_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	3506337	3581671	5320024	terminase,head,portal,tRNA,capsid,lysis,integrase,tail,transposase,holin	Enterobacteria_phage(36.67%)	96	3569750:3569809	3587669:3589025
WP_000074984.1|3506337_3507456_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	5.9e-84
WP_000003742.1|3507424_3507694_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|3507755_3510197_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070259.1|3510290_3510482_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|3510478_3510667_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|3511067_3511271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3511235_3511454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3511613_3511769_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001420344.1|3512061_3512400_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|3512791_3513034_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|3513017_3513443_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|3513514_3514585_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|3514625_3515048_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|3515105_3515462_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001550964.1|3515555_3515738_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_000786213.1|3516390_3516570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3516828_3516984_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001112736.1|3517025_3517205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141427.1|3517151_3517424_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001550965.1|3517425_3518484_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	1.7e-88
WP_000139998.1|3518484_3518847_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001545909.1|3518861_3519683_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_023143430.1|3520216_3520543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562553.1|3520578_3520710_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001336019.1|3520990_3521326_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_001550966.1|3521586_3523548_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	5.6e-239
WP_023143432.1|3523684_3523867_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538590.1|3523904_3524150_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284506.1|3524226_3524442_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|3524446_3525337_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|3525373_3525907_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001322430.1|3525849_3526065_-	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	90.2	1.1e-23
WP_001446668.1|3526063_3526246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|3526260_3526392_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|3526394_3526862_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|3527172_3527499_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|3527621_3527975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012602757.1|3527862_3528183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327250.1|3528286_3528469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|3528457_3528967_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001551252.1|3528938_3530867_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	9.4e-263
WP_001551250.1|3530850_3531057_+|head	head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.9e-10
WP_001537684.1|3531053_3532646_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_001253953.1|3532635_3534141_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	2.7e-100
WP_000256835.1|3534177_3534525_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522583.1|3534582_3535611_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000201498.1|3535662_3536046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204571.1|3536038_3536392_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000974995.1|3536407_3536941_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_000683079.1|3536937_3537333_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|3537340_3538087_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|3538105_3538537_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|3538563_3538977_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_142767546.1|3538957_3541519_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.9	0.0e+00
WP_000847298.1|3541515_3541845_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001550635.1|3541844_3542543_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.0	2.2e-129
WP_001576728.1|3542548_3543292_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_072258937.1|3543237_3543870_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_000559722.1|3543891_3544233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021519674.1|3544213_3547906_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.9	0.0e+00
WP_001228261.1|3547973_3548573_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000216560.1|3548724_3550788_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001204582.1|3550784_3551063_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|3551072_3551366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|3551405_3551504_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_001309429.1|3551476_3551614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550976.1|3551558_3552215_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|3552283_3552550_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|3552781_3553645_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3553628_3554765_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|3555014_3556241_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|3556289_3557411_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|3557486_3558947_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3558946_3559618_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|3559786_3561157_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|3561160_3561802_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|3561837_3562944_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|3562997_3563459_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|3563468_3564107_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|3564439_3564775_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|3564774_3565224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|3565805_3567056_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|3567251_3567710_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_142767566.1|3567867_3568131_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	57.5	6.3e-29
3569750:3569809	attL	CTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTT	NA	NA	NA	NA
WP_000427619.1|3570018_3571023_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|3571101_3574068_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3574070_3574631_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3574756_3575107_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|3575309_3576323_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|3576480_3576954_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|3577183_3577531_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3577524_3578364_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001993321.1|3578293_3578473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3578491_3578992_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|3578960_3579953_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|3579955_3581671_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
3587669:3589025	attR	AACTTGTCGTCAAAATCGGTGTTGCAAAAACGGGAGTGACCATAGATTCCGTTTTCTGAGACGACCCCTATTATGGCGAAGGTATCATTCAGGAAGCGTTGATGAAGGATTATCTCTGTAAAAAGTTATTCAACCGGCTTTCCGGTACCCTGGTGATCAGAGCGCGCTGCGGCAATAACATTACTGGCCTGGCATGTTGCAATATTCTTTATCCCTCGCCCCGATACAGCGGTCAGCTGCATATTAAAGAGCTGTATGTTTCTCAGTGCGATCGAAATAAGGGCACGGGTAAAGCGATAATGCGCTTTATAGCCCGGCTTGCGCTTGAACAGGAATGCCTTAGCCTTAGCTGGAACGCTGAAAAATCCAACCCCGGCGCTAACCGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGATAAAGGAATATCAATTGATGCATCAAATATCGATTCTCAAGCCAAAATAGCACTATCAAGTGTCGAACTTTCAAGTGCTTTGGATAGTATTGATGTTAACAAAACTACAACGGATGTAAGCATCCTTAATCGAAGTATTATCACGCCTGGTAATAATATTCTGGTTAATAATACTGGAGGTGGCTTAAACATAATTTCGTCC	NA	NA	NA	NA
>prophage 7
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	3781221	3887765	5320024	terminase,tRNA,lysis,integrase,tail,transposase	Escherichia_phage(46.43%)	103	3772117:3772132	3814606:3814621
3772117:3772132	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001314661.1|3781221_3782454_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|3782708_3783692_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|3784169_3785543_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|3785671_3786607_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551035.1|3786658_3787894_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000079604.1|3787895_3788111_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551036.1|3788210_3788399_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_001317028.1|3788391_3788586_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551037.1|3788642_3789452_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001551038.1|3789444_3792096_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001314664.1|3792197_3792473_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001551041.1|3792547_3792718_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	9.7e-23
WP_000560221.1|3792717_3792939_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001551042.1|3793359_3793512_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001551043.1|3793965_3794442_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|3794565_3794862_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551045.1|3794884_3795307_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551046.1|3795319_3796177_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.6	3.5e-68
WP_001551047.1|3796183_3796930_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_001551048.1|3796952_3797714_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001403739.1|3797729_3798161_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_001551049.1|3798157_3798379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000385105.1|3798354_3799509_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001551050.1|3799483_3801748_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000940316.1|3802161_3802761_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551052.1|3802760_3803051_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000640136.1|3803047_3803590_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000839599.1|3804871_3805087_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_001551053.1|3805086_3805584_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_001228688.1|3805800_3805986_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|3806182_3807640_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|3807777_3808569_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|3808561_3809494_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|3809471_3809681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142767548.1|3809684_3810779_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	5.0e-112
WP_000625348.1|3810759_3812061_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001551056.1|3812063_3813470_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_001363932.1|3813453_3814566_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551057.1|3814670_3815435_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
3814606:3814621	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918487.1|3815533_3816673_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|3816895_3817291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551058.1|3817290_3817674_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001551059.1|3817674_3818055_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|3818051_3818444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551060.1|3818470_3819433_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|3819583_3819943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|3820050_3820251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551061.1|3820414_3822913_+|tail	lambda family phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.1	1.7e-86
WP_077634177.1|3822916_3823648_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	48.2	5.4e-54
WP_000024051.1|3823640_3823979_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152425.1|3823978_3824677_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_032147653.1|3824682_3825426_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_050436738.1|3825362_3825971_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_001551065.1|3826031_3829511_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_001228337.1|3829578_3830178_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_142767549.1|3830242_3832618_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|3832617_3832899_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001551067.1|3832908_3833949_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000355602.1|3833991_3834285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968130.1|3834636_3835494_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|3835490_3836348_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983720.1|3836344_3837172_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_000286867.1|3837171_3838086_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|3838672_3839107_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|3839247_3840381_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001551068.1|3840742_3844267_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|3844540_3844807_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001523197.1|3844803_3845226_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|3845336_3846326_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001551069.1|3846533_3849173_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|3849169_3849355_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001306533.1|3849362_3849689_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|3849860_3850766_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001551070.1|3851001_3852501_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535436.1|3852559_3854833_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551071.1|3855080_3857126_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_071591516.1|3857374_3858340_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|3858351_3858639_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001551072.1|3858647_3859394_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189203.1|3859408_3859906_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001551073.1|3859913_3860984_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001551074.1|3860980_3861748_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551075.1|3861747_3862536_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_019842675.1|3862537_3863962_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_001551077.1|3863954_3864377_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|3864376_3865582_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632281.1|3865608_3866922_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001551078.1|3867022_3867973_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001551079.1|3867954_3868545_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001551080.1|3868875_3873897_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001563833.1|3874104_3874965_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000048949.1|3875078_3875684_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001551082.1|3875884_3879787_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_001523214.1|3880071_3880410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|3880396_3880846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343026.1|3880965_3881343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027956.1|3881458_3882259_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115969.1|3882455_3883895_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048646.1|3883936_3884938_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001306523.1|3885126_3885657_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731833.1|3885901_3886075_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001309484.1|3886146_3886296_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085948682.1|3886395_3887765_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 8
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	4191618	4245342	5320024	terminase,head,portal,tRNA,capsid,lysis,tail,integrase	Enterobacteria_phage(50.91%)	68	4198592:4198619	4245367:4245394
WP_000672359.1|4191618_4194006_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001551178.1|4194020_4195004_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
WP_001386830.1|4195142_4195187_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4195309_4195666_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4195719_4195917_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4196013_4196556_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|4196559_4198488_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
4198592:4198619	attL	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
WP_000877736.1|4199226_4200969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551179.1|4201450_4201744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247637.1|4201786_4202827_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
WP_001518417.1|4202836_4203118_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_016238726.1|4203117_4205493_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001551182.1|4205557_4206157_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	1.0e-98
WP_001551184.1|4206224_4209623_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
WP_000090872.1|4209683_4210316_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843054.1|4210252_4210996_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_001551186.1|4211001_4211700_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847339.1|4211699_4212029_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001551188.1|4212025_4214587_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
WP_000459467.1|4214579_4215014_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479143.1|4214995_4215418_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001445656.1|4215433_4216174_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_000683105.1|4216181_4216577_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|4216573_4217152_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752996.1|4217163_4217517_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158895.1|4217528_4217924_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_001551189.1|4217965_4218991_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	7.6e-187
WP_001299443.1|4219045_4219378_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123230.1|4219387_4220707_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001551191.1|4220687_4222289_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.7e-308
WP_000198149.1|4222285_4222492_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|4222488_4224414_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453587.1|4224388_4224934_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738421.1|4225602_4225896_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|4225986_4226169_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135296.1|4226385_4226883_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|4226882_4227098_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146309.1|4227286_4228018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|4228369_4229329_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|4229521_4230046_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|4230201_4230579_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|4230664_4230805_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_000774488.1|4231161_4231452_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|4231444_4231615_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|4231614_4232070_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|4232066_4232168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|4232284_4233082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|4233091_4233643_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001551199.1|4234107_4235634_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001299444.1|4235691_4235841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|4235888_4236221_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|4236288_4236591_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|4236587_4237289_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001551200.1|4237285_4238215_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182891.1|4238301_4238841_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|4238910_4239141_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4239245_4239935_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_023148105.1|4240446_4240737_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995443.1|4240812_4241109_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|4241114_4241900_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186804.1|4241896_4242577_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|4242573_4242756_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|4242728_4242920_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|4242930_4243212_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763364.1|4243310_4243529_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488401.1|4243576_4243855_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_001354056.1|4243945_4244176_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_001196928.1|4244133_4245342_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
4245367:4245394	attR	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
>prophage 9
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	4353411	4446081	5320024	terminase,head,portal,tRNA,protease,capsid,lysis,tail,integrase,transposase,holin	Enterobacteria_phage(46.27%)	113	4400876:4400891	4455137:4455152
WP_000984517.1|4353411_4354293_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055785.1|4354484_4356533_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|4356552_4357251_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043876.1|4357347_4357845_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001316436.1|4357974_4359258_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001306757.1|4359226_4361860_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024186439.1|4361939_4363379_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|4363496_4363733_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|4363837_4364029_+	YebW family protein	NA	NA	NA	NA	NA
WP_001551231.1|4364029_4364686_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.1	1.2e-55
WP_000976472.1|4365081_4365423_-	YebY family protein	NA	NA	NA	NA	NA
WP_001551232.1|4365435_4366308_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|4366311_4366686_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4366824_4367055_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011653.1|4367156_4367813_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4367836_4368499_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001551233.1|4368495_4370556_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|4370712_4371138_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_001551234.1|4371194_4372364_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.0	1.7e-203
WP_000024733.1|4372527_4373187_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4373513_4373870_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4373936_4374227_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001551236.1|4374360_4375539_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|4375593_4376235_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|4376271_4378083_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|4378317_4379793_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|4380130_4381000_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|4381127_4382570_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001551238.1|4382701_4383673_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|4383792_4385115_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|4385130_4386063_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4386141_4386897_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|4386893_4387679_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|4387828_4388839_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4388847_4389459_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|4389597_4389663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|4389733_4390336_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001551239.1|4390337_4390859_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|4390893_4391634_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001308712.1|4391662_4392115_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001551240.1|4392232_4394005_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001551241.1|4394314_4394881_+	hydrolase	NA	NA	NA	NA	NA
WP_001300214.1|4394962_4395079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|4395235_4395484_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_001300215.1|4395480_4395627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355701.1|4395738_4396032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|4396041_4396320_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_001551243.1|4396316_4398383_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_001513563.1|4398447_4399047_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_115189916.1|4399114_4402807_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.4	0.0e+00
4400876:4400891	attL	CCGCGGCGTGTCCCAT	NA	NA	NA	NA
WP_024194397.1|4402787_4403129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117004347.1|4403150_4403783_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.3	3.8e-96
WP_000194711.1|4403728_4404472_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_001348269.1|4404482_4405181_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_000847298.1|4405180_4405510_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001550972.1|4405506_4408080_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000533402.1|4408060_4408474_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|4408500_4408932_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235037.1|4408950_4409697_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683079.1|4409704_4410100_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_001565313.1|4410096_4410672_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.2e-48
WP_001204533.1|4410687_4411041_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001565314.1|4411033_4411417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238735.1|4411468_4412497_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	1.1e-113
WP_016247652.1|4412554_4412902_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
WP_016238736.1|4412938_4414444_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_021524278.1|4414433_4416026_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|4416022_4416229_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001550967.1|4416212_4418141_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.6e-262
WP_000235436.1|4418112_4418622_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|4419437_4419623_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|4419755_4419896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082539.1|4420246_4420714_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000992072.1|4421012_4421546_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_000369850.1|4421651_4421924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|4421889_4422234_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|4422238_4422454_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874512.1|4422604_4424458_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000951233.1|4424998_4425220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077634182.1|4425722_4426061_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.1e-48
WP_000737259.1|4426511_4427594_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	78.7	1.4e-162
WP_001204776.1|4427781_4428165_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_001065351.1|4429224_4429482_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	1.6e-21
WP_000203851.1|4429478_4430879_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.1e-244
WP_000988266.1|4430875_4431775_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_001551255.1|4431785_4432778_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	5.1e-55
WP_000995578.1|4432774_4433074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|4433070_4433295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626793.1|4433291_4433486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551256.1|4433482_4434337_-	rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	69.0	8.2e-102
WP_001551257.1|4434445_4435153_-	hypothetical protein	NA	Q8W645	Enterobacteria_phage	85.5	4.5e-106
WP_000177358.1|4435149_4435377_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	91.0	4.9e-30
WP_000838350.1|4435488_4436145_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	98.2	3.1e-125
WP_001551258.1|4436248_4436752_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	8.9e-64
WP_001551259.1|4436639_4436900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141093.1|4437039_4437246_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_001551260.1|4437440_4437623_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.7e-09
WP_001551261.1|4437628_4438210_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	64.5	9.6e-70
WP_001551262.1|4438220_4438469_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000179800.1|4438458_4438776_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001300189.1|4438729_4439044_+	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000034225.1|4439030_4439717_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.8e-38
WP_001290008.1|4439713_4440250_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	67.2	1.6e-63
WP_000224229.1|4440251_4440515_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	71.3	1.1e-30
WP_000208033.1|4440525_4441038_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	97.4	2.2e-78
WP_000457723.1|4441122_4441365_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|4441368_4441515_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|4441523_4441760_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362005.1|4441815_4443129_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_042196262.1|4443110_4443881_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	5.7e-70
WP_000252980.1|4443933_4444329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|4444369_4445113_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564730.1|4445109_4446081_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
4455137:4455152	attR	CCGCGGCGTGTCCCAT	NA	NA	NA	NA
>prophage 10
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	4644334	4652184	5320024	integrase,tail	Shigella_phage(33.33%)	11	4641782:4641794	4656453:4656465
4641782:4641794	attL	TACGGGAAGCTGG	NA	NA	NA	NA
WP_001421515.1|4644334_4645501_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	6.1e-225
WP_001333292.1|4645844_4645976_-	hypothetical protein	NA	O64339	Escherichia_phage	64.3	1.8e-08
WP_000221969.1|4646737_4647817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805577.1|4647935_4648529_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.1	7.3e-57
WP_000141754.1|4648749_4649037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120505551.1|4649273_4649495_+	hypothetical protein	NA	S5FNS4	Shigella_phage	94.5	3.4e-36
WP_000008235.1|4649550_4650087_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242744.1|4650077_4650440_+	hypothetical protein	NA	U5P092	Shigella_phage	96.7	3.4e-65
WP_000627693.1|4650439_4650745_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_000132739.1|4650833_4651025_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007952.1|4651005_4652184_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.2	1.7e-230
4656453:4656465	attR	CCAGCTTCCCGTA	NA	NA	NA	NA
>prophage 11
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	4675481	4686981	5320024		Bacillus_phage(25.0%)	10	NA	NA
WP_001551312.1|4675481_4676870_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	2.9e-32
WP_001286270.1|4676873_4678322_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.3	2.5e-58
WP_001421539.1|4678314_4678815_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|4678817_4679783_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_001140914.1|4679785_4680907_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000799972.1|4680933_4681950_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000234390.1|4681968_4682988_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	3.7e-85
WP_000183077.1|4683297_4684191_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999474.1|4684433_4685429_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.7	8.6e-10
WP_001115975.1|4685586_4686981_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 12
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	4780686	4790129	5320024		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|4780686_4781823_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|4781819_4783820_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|4783944_4784406_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|4784447_4784918_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|4784964_4785684_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4785680_4787366_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|4787587_4788319_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|4788378_4788486_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|4788466_4789198_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|4789202_4790129_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 13
NZ_CP041359	Escherichia coli strain U1 chromosome, complete genome	5320024	5253193	5295932	5320024	terminase,head,tRNA,tail,holin	Salmonella_phage(52.27%)	55	NA	NA
WP_001295367.1|5253193_5253730_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|5253754_5254390_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|5254598_5255447_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001253100.1|5255757_5256024_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	83.0	2.7e-35
WP_001039127.1|5256325_5257171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904955.1|5257175_5257490_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.9	1.6e-39
WP_077634188.1|5257516_5257915_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.3	8.1e-12
WP_001174919.1|5257917_5258358_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_024192484.1|5258329_5258923_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.9	7.0e-60
WP_001551478.1|5258922_5259717_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	91.0	6.9e-79
WP_000049943.1|5259716_5260397_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	1.5e-103
WP_001551479.1|5260393_5261593_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_001270631.1|5261592_5261946_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_001551480.1|5261945_5262698_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	8.5e-87
WP_001551481.1|5262758_5263271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551482.1|5263267_5263603_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.7e-23
WP_001551483.1|5263602_5264667_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	4.2e-156
WP_000155119.1|5264669_5264972_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001298404.1|5264971_5265559_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_001551484.1|5265558_5267544_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_023141050.1|5267533_5267710_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
WP_000393954.1|5267721_5268174_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|5268177_5268618_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_001551485.1|5268628_5269774_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_001349562.1|5269777_5270341_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001551486.1|5270315_5270705_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_142767562.1|5270691_5271246_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	7.4e-80
WP_001551489.1|5271242_5271650_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
WP_001107515.1|5271615_5271837_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001551491.1|5271878_5272820_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.6e-154
WP_001066732.1|5272831_5273338_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_001551492.1|5273341_5274562_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	9.3e-200
WP_136759112.1|5274576_5275311_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_001551494.1|5275201_5276668_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	6.0e-262
WP_001551495.1|5276667_5278290_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|5278292_5278865_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001551496.1|5278926_5279451_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	2.6e-42
WP_001194119.1|5279434_5279911_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|5279914_5280256_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001551497.1|5280788_5281211_-	hypothetical protein	NA	Q8W638	Enterobacteria_phage	65.0	8.0e-42
WP_000034494.1|5281236_5281527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551498.1|5281842_5284104_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000016208.1|5284107_5284308_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001551499.1|5284449_5285124_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_001551500.1|5285499_5286069_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.7	3.2e-38
WP_001551501.1|5286439_5287342_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001551502.1|5287344_5288646_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	5.2e-132
WP_000769005.1|5288661_5289210_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_000551014.1|5289262_5289892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551504.1|5289938_5292002_+	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	6.7e-275
WP_001551506.1|5292066_5292828_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_001551508.1|5293063_5293258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551509.1|5293257_5293542_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.3e-27
WP_001551510.1|5293557_5294475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551511.1|5294537_5295932_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	1.0e-210
>prophage 1
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	0	5700	130003	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000099150.1|477_2016_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	5.9e-292
WP_000612626.1|2064_2412_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2408_2813_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032145081.1|4191_5700_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.1e-43
>prophage 2
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	17935	22803	130003	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_000065240.1|17935_18691_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_142767521.1|18687_20187_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_011478084.1|20615_20987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032145081.1|21294_22803_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.1e-43
>prophage 3
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	27380	36675	130003	integrase	Enterobacteria_phage(33.33%)	11	17783:17797	39316:39330
17783:17797	attL	CTGGAAAAAGTGATG	NA	NA	NA	NA
WP_001066947.1|27380_28121_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309253.1|28363_29341_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_000371372.1|29653_29878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001270422.1|30397_30685_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.3e-19
WP_001132895.1|30681_30933_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_071532442.1|31306_31492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817635.1|31690_32896_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.6e-204
WP_000756328.1|32892_33855_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	2.3e-113
WP_072164940.1|34994_35495_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001309256.1|35604_35916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086171.1|35991_36675_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.3	7.9e-31
39316:39330	attR	CTGGAAAAAGTGATG	NA	NA	NA	NA
>prophage 4
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	42537	50331	130003		Pseudomonas_phage(25.0%)	13	NA	NA
WP_072198834.1|42537_42876_+	class I SAM-dependent methyltransferase	NA	A0A059VA49	Pseudomonas_phage	39.1	1.1e-09
WP_071589698.1|42786_42981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024187997.1|42961_43405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141058.1|43561_43681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|43706_44234_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|44291_44525_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001537566.1|44585_46550_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.5	3.2e-24
WP_000845953.1|46618_47053_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|47049_47769_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|48048_48207_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001127499.1|48960_49080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001545326.1|49103_49400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|49509_50331_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
>prophage 5
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	57719	60957	130003	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
WP_001550332.1|57719_59258_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_000612591.1|59307_59655_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|59651_60032_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_142767522.1|60091_60601_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278695.1|60735_60957_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 6
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	65297	65720	130003		Salmonella_phage(100.0%)	1	NA	NA
WP_001229309.1|65297_65720_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.8	9.4e-67
>prophage 7
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	84783	87711	130003		Xanthomonas_phage(50.0%)	4	NA	NA
WP_000205709.1|84783_85530_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	2.4e-09
WP_000139329.1|85584_86142_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001336517.1|86293_86497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000760080.1|87249_87711_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	1.0e-18
>prophage 8
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	94411	97906	130003	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_001057737.1|94411_95134_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	1.6e-34
WP_000621194.1|95130_96603_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001067855.1|97201_97906_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 9
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	105748	112054	130003		Planktothrix_phage(33.33%)	5	NA	NA
WP_000117262.1|105748_106444_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|106430_106916_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|106940_107426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336919.1|109410_109980_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_001189111.1|110545_112054_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 10
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	118911	120140	130003	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106378881.1|118911_120140_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
>prophage 11
NZ_CP041358	Escherichia coli strain U1 plasmid unnamed1, complete sequence	130003	124884	125646	130003		Indivirus(100.0%)	1	NA	NA
WP_000020504.1|124884_125646_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.7	8.0e-16
