The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1143888	1210181	5052222	terminase,lysis,portal,tail,integrase,capsid,tRNA,plate,head	Salmonella_phage(82.61%)	69	1147403:1147449	1181443:1181489
WP_001805599.1|1143888_1144056_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	59.5	3.1e-05
WP_104856770.1|1144043_1144262_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	57.4	4.4e-12
WP_080189483.1|1144310_1145996_-	AIPR family protein	NA	NA	NA	NA	NA
WP_061423855.1|1146012_1147209_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.4	6.5e-105
1147403:1147449	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|1147566_1148592_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|1148593_1149226_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|1149345_1149594_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_023135813.1|1149626_1150136_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_024144841.1|1150143_1150440_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.2	3.2e-21
WP_001556502.1|1150525_1150774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023135811.1|1150855_1151197_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.0e-55
WP_023135810.1|1151264_1151498_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	2.4e-32
WP_023135809.1|1151497_1151725_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.7e-35
WP_023135808.1|1151721_1152579_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.3e-160
WP_023135807.1|1152575_1154990_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_001154431.1|1155143_1155332_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001089754.1|1155270_1155576_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1155689_1156367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024144839.1|1156733_1157204_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.2	1.4e-23
WP_024144838.1|1157207_1157789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023226820.1|1157766_1158138_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	48.4	2.6e-28
WP_023135805.1|1158744_1159122_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_023135804.1|1159133_1159925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023135803.1|1159921_1160971_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.9	8.0e-176
WP_023135802.1|1160970_1162737_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_023135801.1|1162879_1163713_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	96.0	1.3e-128
WP_023135800.1|1163729_1164794_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.5e-193
WP_023135799.1|1164797_1165448_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	1.9e-114
WP_023135798.1|1165541_1166006_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868184.1|1166005_1166209_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1166212_1166428_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|1166408_1166918_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1166922_1167300_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_023135797.1|1167299_1167725_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	8.5e-68
WP_023135796.1|1167820_1168252_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	5.6e-75
WP_000343946.1|1168244_1168691_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.1	5.8e-67
WP_023135795.1|1168692_1169544_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	58.9	3.4e-92
WP_001556169.1|1169621_1170200_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	94.8	3.8e-103
WP_000177484.1|1170196_1170556_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
WP_000268273.1|1170542_1171451_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
WP_001086804.1|1171443_1172049_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_023226824.1|1172045_1173812_+|tail	tail fiber domain-containing protein	tail	A0A1S6KZZ8	Salmonella_phage	53.5	7.5e-142
WP_000680167.1|1173814_1174342_+|tail	tail protein	tail	NA	NA	NA	NA
WP_023135769.1|1174472_1175645_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_023135770.1|1175654_1176170_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	99.4	3.5e-92
WP_001280967.1|1176224_1176527_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1176541_1176661_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_023135771.1|1176653_1179461_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	98.7	0.0e+00
WP_000980409.1|1179457_1179943_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_023135772.1|1179939_1181040_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
WP_000980498.1|1181108_1181327_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072319951.1|1181878_1183042_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1181443:1181489	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_061423838.1|1183049_1185230_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533865.1|1185226_1186636_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_080189533.1|1186700_1197920_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1198535_1199018_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1199167_1199644_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1199633_1199924_+	RnfH family protein	NA	NA	NA	NA	NA
WP_080189532.1|1200089_1200428_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_020899108.1|1200576_1202238_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1202323_1203202_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1203325_1203916_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1203950_1204556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1204676_1205963_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1205982_1206774_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1206939_1208301_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1208553_1208802_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1208820_1209369_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1209413_1210181_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1237068	1335393	5052222	terminase,holin,portal,tail,integrase,tRNA,protease,capsid,plate,head	Salmonella_phage(37.88%)	111	1229645:1229660	1276538:1276553
1229645:1229660	attL	CGCGGCGGCAACGGTT	NA	NA	NA	NA
WP_000997368.1|1237068_1238106_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_079959625.1|1238221_1238911_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.1	2.3e-54
WP_000627811.1|1239229_1239613_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023205557.1|1239674_1240262_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_080189977.1|1240364_1241264_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080189974.1|1241281_1242616_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.5	1.0e-42
WP_000083343.1|1242746_1243484_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_104856772.1|1243468_1245091_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1245175_1245355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1245354_1245519_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_065675026.1|1245515_1246091_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_001168374.1|1246122_1246773_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1246772_1247729_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1247725_1248205_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_080157532.1|1248702_1249932_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	1.9e-232
WP_001670787.1|1249909_1250194_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1250234_1250474_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077915474.1|1250516_1251674_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	6.1e-217
WP_080190032.1|1251636_1254564_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	92.8	0.0e+00
WP_000438989.1|1255273_1255480_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_079802414.1|1255508_1256012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079802413.1|1256008_1256239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058649024.1|1256267_1256735_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	85.8	7.2e-68
WP_000145711.1|1256748_1256976_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_015702794.1|1256941_1257316_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_046597590.1|1257407_1258244_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.0	7.6e-52
WP_045718387.1|1258240_1258936_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	45.0	1.6e-55
WP_142807565.1|1259592_1260261_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	95.5	5.1e-43
WP_080157554.1|1261312_1261927_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	37.1	2.9e-32
WP_080189797.1|1262078_1262711_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	99.5	1.1e-111
WP_039501152.1|1262777_1263044_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	98.9	5.7e-46
WP_001217669.1|1263199_1263433_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1263549_1263798_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1263832_1264435_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001241016.1|1264434_1264641_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
WP_058665211.1|1264643_1265255_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	98.5	3.6e-91
WP_000801757.1|1265251_1265392_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097244.1|1265388_1266078_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000781780.1|1266272_1266620_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
WP_001005893.1|1266622_1267237_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.1	5.0e-109
WP_080189799.1|1267233_1267626_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	87.5	3.4e-55
WP_118998233.1|1267510_1267786_+	peptidase	NA	U5P461	Shigella_phage	75.8	6.6e-29
WP_023200328.1|1268079_1268430_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	2.9e-61
WP_000929175.1|1268555_1269050_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_039501161.1|1269046_1270780_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|1270791_1270974_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_023231283.1|1270973_1272215_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.5	1.0e-241
WP_080189801.1|1272192_1272843_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	99.1	3.6e-118
WP_046076246.1|1272857_1274063_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	1.3e-222
WP_000601352.1|1274113_1274314_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|1274316_1274640_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702395.1|1274636_1275047_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224838.1|1275021_1275528_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
WP_000779294.1|1275524_1276085_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497757.1|1276093_1276264_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_080189802.1|1276247_1277744_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	1.0e-272
1276538:1276553	attR	CGCGGCGGCAACGGTT	NA	NA	NA	NA
WP_000090998.1|1277743_1278100_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|1278096_1278420_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000774665.1|1278504_1280406_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
WP_000738065.1|1280470_1280959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347687.1|1281015_1282389_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.0	4.1e-244
WP_000999519.1|1282385_1283465_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	2.6e-206
WP_022630975.1|1283464_1284013_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|1284012_1284438_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|1284424_1285483_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|1285473_1286058_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_142807567.1|1286061_1287144_+|tail	phage tail protein	tail	U5P0I1	Shigella_phage	83.8	9.8e-52
WP_142807570.1|1287150_1287576_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	81.5	8.3e-55
WP_080190090.1|1287644_1288604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080072978.1|1288617_1288995_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080072979.1|1289110_1289272_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_142807572.1|1289345_1290173_+	hypothetical protein	NA	I6S627	Salmonella_phage	53.6	1.5e-60
WP_080189988.1|1290407_1292207_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1292223_1293198_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1293471_1294152_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1294148_1295054_+	GTPase Era	NA	NA	NA	NA	NA
WP_080189989.1|1295065_1295794_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818969.1|1295805_1296537_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1296536_1296917_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1297028_1297289_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_080189991.1|1297326_1298253_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	1.0e-09
WP_001276364.1|1298368_1299565_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|1299586_1300504_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|1300542_1301391_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1301506_1302400_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_061376109.1|1302410_1303772_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_080189992.1|1303775_1304411_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_080189993.1|1304435_1304987_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_142807574.1|1305037_1306582_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_023202125.1|1306582_1306816_-	periplasmic protein	NA	NA	NA	NA	NA
WP_080190066.1|1306837_1310725_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.1e-128
WP_001676035.1|1311373_1312804_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
WP_080190015.1|1312805_1313570_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|1313566_1314904_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|1314980_1315319_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856788.1|1315367_1316828_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	2.2e-46
WP_080190014.1|1316883_1319028_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000100008.1|1319110_1320442_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_080190013.1|1320802_1322347_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_080190012.1|1322528_1323719_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919178.1|1324043_1325297_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_001173721.1|1325492_1326632_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_053445209.1|1326626_1327904_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000805728.1|1328029_1328668_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_023223775.1|1328658_1329645_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000020685.1|1329645_1330659_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000017587.1|1330669_1331488_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000985209.1|1331491_1332535_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000174944.1|1332716_1333595_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553473.1|1333739_1334543_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|1334661_1335393_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1385235	1432372	5052222	terminase,integrase,holin,tail	Salmonella_phage(64.71%)	55	1385465:1385481	1394591:1394607
WP_000944174.1|1385235_1386702_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
1385465:1385481	attL	AGCGCCAGGCGGAAGAA	NA	NA	NA	NA
WP_000138296.1|1386771_1388349_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_080189830.1|1388541_1389795_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	94.7	9.2e-227
WP_080189831.1|1389791_1389971_-	hypothetical protein	NA	T1SA82	Salmonella_phage	94.9	2.5e-21
WP_080189832.1|1389967_1390615_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.6	1.3e-120
WP_080189834.1|1390611_1391289_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	45.7	5.0e-46
WP_080189835.1|1391285_1391444_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_053388684.1|1391436_1391736_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	97.0	3.4e-47
WP_000816432.1|1391845_1392094_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_053388663.1|1392140_1393022_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.9	5.0e-155
WP_053388662.1|1393018_1393840_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	98.2	1.7e-160
WP_052930710.1|1393836_1394139_-	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	3.8e-46
WP_080189836.1|1394146_1395139_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	76.4	2.3e-55
1394591:1394607	attR	TTCTTCCGCCTGGCGCT	NA	NA	NA	NA
WP_080189838.1|1395509_1396106_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.5	1.3e-106
WP_003037808.1|1396261_1396495_+	hypothetical protein	NA	Q858D6	Salmonella_phage	100.0	5.4e-40
WP_003037811.1|1396642_1396837_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	53.3	2.6e-11
WP_080189839.1|1396833_1397508_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	84.9	9.0e-112
WP_080189842.1|1397497_1398313_+	Pyocin large subunit	NA	T1SA92	Salmonella_phage	92.6	5.9e-142
WP_080189840.1|1398433_1398778_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	96.5	1.4e-60
WP_080189841.1|1398839_1399346_+	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	38.1	1.9e-13
WP_142807565.1|1399455_1400124_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	95.5	5.1e-43
WP_111192463.1|1400128_1400767_+	ead/Ea22-like family protein	NA	A0A2H4A316	Salmonella_phage	86.9	3.7e-22
WP_142807583.1|1401174_1401774_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	36.9	7.6e-30
WP_080189712.1|1401859_1402198_+	hypothetical protein	NA	Q858C6	Salmonella_phage	86.6	1.6e-48
WP_080189738.1|1402301_1402895_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	98.0	1.3e-101
WP_080189713.1|1402891_1404373_+|terminase	terminase	terminase	M1F3C4	Salmonella_phage	98.0	3.3e-292
WP_080189714.1|1404419_1404842_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.3	2.7e-58
WP_000334867.1|1405342_1405549_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_080189715.1|1405563_1407234_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	96.8	1.4e-307
WP_080189716.1|1407230_1407527_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	92.9	4.9e-46
WP_080189717.1|1407529_1408237_+	peptidase	NA	T1SAP9	Salmonella_phage	85.7	1.5e-64
WP_080189718.1|1408254_1409241_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	85.7	2.1e-162
WP_080189719.1|1409292_1409733_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	2.4e-65
WP_080189720.1|1409743_1410088_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	73.0	5.7e-38
WP_003037867.1|1410139_1410463_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	72.8	1.7e-36
WP_075584439.1|1410462_1411068_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.0	5.8e-110
WP_080189721.1|1411067_1413545_+	hypothetical protein	NA	Q858G3	Salmonella_phage	97.8	0.0e+00
WP_080189722.1|1413544_1414009_+	hypothetical protein	NA	T1SA73	Salmonella_phage	94.8	4.2e-84
WP_045719038.1|1414008_1414551_+	hypothetical protein	NA	T1SA02	Salmonella_phage	99.4	1.2e-71
WP_080189723.1|1414563_1417074_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	83.0	0.0e+00
WP_080189724.1|1417070_1418873_+	hypothetical protein	NA	T1SAQ5	Salmonella_phage	86.2	2.3e-271
WP_080189726.1|1418877_1421352_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	95.3	0.0e+00
WP_080189728.1|1421361_1421670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141102624.1|1421712_1422408_-	BRO-like protein	NA	A0A193GYJ9	Enterobacter_phage	72.3	8.7e-94
WP_080189729.1|1422726_1422987_-	hypothetical protein	NA	T1SA06	Salmonella_phage	98.8	8.4e-42
WP_080189731.1|1425543_1427184_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	34.9	2.1e-74
WP_080189732.1|1427186_1428104_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	90.1	1.2e-154
WP_080189733.1|1428100_1428463_-	GtrA family protein	NA	U5P0S6	Shigella_phage	78.3	6.0e-46
WP_045717273.1|1428617_1429022_+	membrane protein	NA	T1SA79	Salmonella_phage	99.3	2.2e-65
WP_080189734.1|1429008_1429317_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	97.1	1.9e-48
WP_080189735.1|1429306_1429933_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	93.2	4.9e-112
WP_080189737.1|1429929_1430412_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	85.6	1.2e-65
WP_080190025.1|1431068_1431398_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_080190026.1|1431382_1431574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075924.1|1432180_1432372_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 4
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1548770	1554802	5052222		Salmonella_virus(50.0%)	6	NA	NA
WP_111174575.1|1548770_1548917_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	67.4	6.6e-12
WP_106417236.1|1548932_1549076_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_080189637.1|1550065_1551988_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	9.5e-300
WP_001753429.1|1551999_1552260_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.2e-25
WP_023226602.1|1552228_1552618_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_000377772.1|1553860_1554802_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
>prophage 5
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1795693	1804864	5052222	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1795693_1796641_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1796624_1797356_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1797336_1797444_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1797503_1798235_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1798457_1800143_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1800139_1800859_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1800905_1801373_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_069721497.1|1801429_1801960_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1802131_1802590_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|1802830_1804864_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	1883622	1894129	5052222		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023994317.1|1883622_1885026_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1885203_1886097_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1886473_1887559_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_061423791.1|1887558_1888458_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_061423793.1|1888505_1889384_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.6e-108
WP_000973710.1|1889384_1889936_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.3e-52
WP_000018219.1|1889941_1890916_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648785.1|1890931_1891705_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1891709_1892789_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1892815_1894129_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	2018045	2025270	5052222		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|2018045_2018465_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_080190048.1|2018467_2019736_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	3.5e-226
WP_000208509.1|2020181_2020394_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2020404_2020593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061378784.1|2020851_2022030_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	2.5e-109
WP_000107433.1|2022679_2022979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|2023070_2023766_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_080190071.1|2023839_2025270_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	2130875	2172756	5052222	terminase,lysis,tail,integrase,head	Edwardsiella_phage(20.0%)	59	2127855:2127869	2132782:2132796
2127855:2127869	attL	CCACAGCGCGCTACT	NA	NA	NA	NA
WP_076735562.1|2130875_2131955_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.9	4.5e-105
WP_078061180.1|2131935_2132208_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_077960374.1|2132268_2132505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076735564.1|2132693_2134787_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	2.5e-197
2132782:2132796	attR	CCACAGCGCGCTACT	NA	NA	NA	NA
WP_063390535.1|2134783_2135041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|2135134_2135314_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_047598971.1|2135924_2136257_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_076166144.1|2136249_2136570_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	60.6	6.1e-34
WP_076735565.1|2136605_2137436_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
WP_076166140.1|2137428_2140119_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	3.7e-116
WP_076735566.1|2140259_2140595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|2140669_2140954_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_071992601.1|2141335_2141491_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_001224472.1|2141800_2142226_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033911.1|2142322_2142577_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574210.1|2142563_2143058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076735567.1|2143101_2144109_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.4e-123
WP_000140163.1|2144101_2144563_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_022742732.1|2144575_2144971_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_023139357.1|2144967_2145240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2145446_2145599_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_024150651.1|2145791_2146097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|2146160_2146760_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_076735568.1|2146756_2146951_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	53.7	5.3e-09
WP_050942040.1|2146947_2147229_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
WP_023139354.1|2147578_2147920_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_022742728.1|2147951_2148482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|2148468_2149398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166132.1|2149531_2149759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|2149910_2150213_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208105.1|2150190_2150730_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	5.7e-77
WP_001534346.1|2150830_2151295_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.4	1.3e-56
WP_001113128.1|2151520_2151703_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_022742724.1|2151773_2152526_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_022742723.1|2152491_2153913_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_076166126.1|2153912_2155433_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	6.3e-105
WP_000552017.1|2155473_2156163_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139349.1|2156159_2157506_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_001525451.1|2157507_2157990_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031913.1|2157989_2159018_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|2159021_2159369_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001748492.1|2159375_2159831_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
WP_001748491.1|2159824_2160409_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_076166120.1|2160405_2160771_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	1.8e-21
WP_000094504.1|2160755_2161301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076166117.1|2161281_2162766_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_000016414.1|2162766_2163213_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_023234167.1|2163212_2163617_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	8.2e-20
WP_000228831.1|2163658_2163841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076735570.1|2163824_2165996_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000010346.1|2165992_2166703_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
WP_000890115.1|2166702_2167005_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_076735571.1|2167001_2167871_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	4.5e-31
WP_023257603.1|2167851_2168529_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_023257604.1|2168541_2168898_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
WP_023257605.1|2168894_2170136_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_076166114.1|2170137_2170740_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	7.7e-30
WP_076735572.1|2170729_2172181_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_076735573.1|2172180_2172756_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.2e-95
>prophage 9
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	3100301	3109653	5052222	protease,integrase	Ralstonia_phage(16.67%)	8	3095099:3095113	3108389:3108403
3095099:3095113	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_080189862.1|3100301_3100679_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.9	2.2e-19
WP_001117984.1|3100840_3101038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080189861.1|3102311_3102788_+	adhesin	NA	NA	NA	NA	NA
WP_000934064.1|3103289_3105566_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3105596_3105917_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3106240_3106462_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125895.1|3106591_3108538_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
3108389:3108403	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201760.1|3108534_3109653_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	4541870	4587701	5052222	terminase,holin,portal,integrase,tRNA,capsid,protease,head,plate,tail	Salmonella_phage(69.81%)	66	4544004:4544019	4547410:4547425
WP_000918353.1|4541870_4543286_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235555.1|4543350_4544334_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4544004:4544019	attL	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000891417.1|4544508_4544751_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_058652095.1|4544918_4545956_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4546044_4547142_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217553.1|4547203_4547452_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
4547410:4547425	attR	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_077248251.1|4547448_4547571_-|capsid	capsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	73.5	2.0e-06
WP_000639149.1|4547595_4548159_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_000161707.1|4548683_4549406_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006335.1|4549602_4550010_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
WP_000554741.1|4550016_4551111_-	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	99.1	7.9e-57
WP_001207832.1|4551097_4551685_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|4551687_4552767_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|4552759_4553173_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|4553177_4553711_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|4553710_4554769_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_000863821.1|4554765_4556106_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	1.7e-250
WP_001033736.1|4556165_4556615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785382.1|4556631_4558557_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.6	0.0e+00
WP_000588852.1|4558641_4558968_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|4558964_4559321_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|4559320_4560817_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497756.1|4560806_4560971_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	2.2e-24
WP_001241332.1|4560992_4561538_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_001180259.1|4561534_4562047_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	1.4e-80
WP_001255649.1|4562018_4562432_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.0	1.3e-49
WP_000886224.1|4562443_4562767_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_000005720.1|4563070_4564288_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.4	3.9e-198
WP_000039024.1|4564297_4565146_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000002706.1|4565159_4566464_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
WP_000229717.1|4566463_4568206_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.7	3.1e-140
WP_000919034.1|4568159_4568624_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_001749169.1|4568756_4569101_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.0	4.4e-46
WP_001252724.1|4569168_4569672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050814.1|4569774_4570317_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001075994.1|4570313_4570928_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_000226307.1|4570927_4571209_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294874.1|4571195_4571585_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000658039.1|4571674_4571863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001154612.1|4571917_4572106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508331.1|4572143_4572362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899401.1|4572541_4573294_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|4573307_4574297_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|4574304_4575165_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|4575181_4575571_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|4575567_4576461_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|4576460_4576943_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|4576944_4577763_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|4577759_4577984_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|4577980_4579138_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|4579134_4579689_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|4579717_4579942_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|4579880_4580066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|4580039_4580735_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067434.1|4580940_4581132_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001749158.1|4581053_4581308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078504.1|4581207_4581459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|4582030_4582402_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080411.1|4582459_4583287_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	97.8	1.6e-150
WP_000008354.1|4583423_4583963_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_142807596.1|4584033_4584699_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	95.3	5.7e-42
WP_000850456.1|4585327_4585630_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	70.5	4.5e-31
WP_000267994.1|4585671_4585965_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	97.9	9.4e-50
WP_000156435.1|4585961_4586330_+	hypothetical protein	NA	G9L6B4	Escherichia_phage	80.2	3.6e-46
WP_001093920.1|4586465_4586738_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	94.3	2.2e-40
WP_000956555.1|4587167_4587701_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	88.7	1.3e-89
>prophage 11
NZ_CP030749	Salmonella enterica strain MAC15 chromosome, complete genome	5052222	4613549	4634152	5052222	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4613549_4613897_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4614473_4614761_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_080189477.1|4614763_4615369_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	3.2e-60
WP_023138085.1|4615381_4615696_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_080189476.1|4615855_4616311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4616307_4616505_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4616494_4617922_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907494.1|4617921_4618446_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003637.1|4618497_4618815_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4618774_4618903_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080189475.1|4618999_4621354_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	1.1e-66
WP_080189474.1|4621353_4622307_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269717.1|4622306_4622516_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_079821454.1|4622503_4623547_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.3	2.5e-76
WP_000679393.1|4623556_4624279_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_071786854.1|4624287_4624530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593182.1|4624605_4624968_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703634.1|4624964_4625894_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_061423732.1|4625893_4627441_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.1	1.1e-48
WP_023203260.1|4627604_4627964_+|plate	baseplate	plate	Q6QIA0	Burkholderia_phage	63.3	6.2e-35
WP_061423733.1|4627954_4629070_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	5.3e-101
WP_061423734.1|4629062_4629695_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_080090768.1|4629697_4631623_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	53.1	1.6e-52
WP_061424830.1|4631627_4632233_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084338.1|4632229_4632685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|4633423_4634152_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
