The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	393816	461196	5706987	head,portal,tail,tRNA,holin,capsid,terminase,integrase	Cronobacter_phage(60.0%)	78	395204:395249	426953:426998
WP_142814542.1|393816_395013_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.9	2.8e-100
395204:395249	attL	TTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACA	NA	NA	NA	NA
WP_142814543.1|395329_396391_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	74.6	6.1e-155
WP_142816368.1|396394_396958_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.0	4.6e-37
WP_046897810.1|397087_397324_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	41.2	1.7e-09
WP_046897809.1|397354_397864_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	50.3	1.9e-37
WP_142814544.1|397873_398077_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_052759932.1|398076_398460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814545.1|398467_398872_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	46.8	3.1e-27
WP_046897806.1|398947_399175_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060706389.1|399339_400239_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.5	3.5e-71
WP_060706390.1|400235_400466_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	43.4	5.0e-06
WP_142814546.1|400462_401089_+	HNH endonuclease	NA	A0A2I7RAW6	Vibrio_phage	60.6	2.3e-05
WP_142814547.1|401085_401478_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_142814548.1|401477_403529_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	64.7	5.9e-247
WP_060706394.1|403605_403824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072628566.1|403791_404067_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	68.6	3.5e-30
WP_142816369.1|404117_405098_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	70.7	6.2e-138
WP_142814549.1|405163_406954_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.3	1.8e-244
WP_046897800.1|407130_407940_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	41.9	6.0e-46
WP_060431885.1|407983_409012_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	77.6	7.0e-148
WP_060435824.1|409018_409723_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	61.1	1.3e-76
WP_142814550.1|409822_410275_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.0	4.1e-36
WP_060431888.1|410271_410772_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.2	4.0e-32
WP_142814551.1|410768_411479_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	63.0	2.1e-79
WP_142814552.1|411475_412600_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	65.1	4.9e-139
WP_046897793.1|412596_413052_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.6	1.2e-54
WP_060431890.1|413061_413364_+|holin	holin	holin	C7BGD7	Burkholderia_phage	51.1	2.9e-17
WP_142814553.1|413350_413692_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	83.2	7.4e-46
WP_142814554.1|413691_414063_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	56.8	4.6e-25
WP_046897789.1|414007_414187_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	60.7	8.6e-14
WP_142814555.1|414183_414459_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.8	6.2e-19
WP_071883790.1|414467_414647_+	hypothetical protein	NA	Q1I0Y8	Pasteurella_virus	50.0	3.8e-09
WP_142814556.1|414646_417046_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.3	1.6e-155
WP_060431894.1|417045_417393_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	74.7	1.6e-35
WP_142814557.1|417370_418555_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	67.8	2.7e-151
WP_046897784.1|418547_419147_+	protein phage	NA	F1BUK5	Cronobacter_phage	68.5	1.4e-71
WP_142814558.1|419152_422020_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	65.2	1.7e-103
WP_072628547.1|422022_422451_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.0	1.0e-12
WP_142814559.1|422440_423163_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	36.7	1.0e-36
WP_142814560.1|423137_423704_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	57.6	5.5e-46
WP_142814561.1|423690_425343_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	54.7	2.0e-168
WP_142816370.1|425609_425789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816371.1|426503_426683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020828274.1|427367_427850_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	2.9e-27
426953:426998	attR	TTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACA	NA	NA	NA	NA
WP_071827083.1|427957_428446_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_020828272.1|428438_428723_+	RnfH family protein	NA	NA	NA	NA	NA
WP_012146393.1|428837_429176_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_142816372.1|429289_430969_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_020828270.1|431037_431916_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_048762707.1|432040_432613_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_020828268.1|432664_433348_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	46.5	1.4e-51
WP_020828267.1|433694_434078_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.2	1.2e-31
WP_142814562.1|434264_435227_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_048762709.1|435219_435975_+	ankyrin repeat domain-containing protein	NA	A0A1J0FA54	Only_Syngen_Nebraska_virus	48.0	1.3e-10
WP_020828264.1|437339_438665_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	27.3	5.6e-41
WP_122080039.1|438764_439547_+	methyltransferase	NA	NA	NA	NA	NA
WP_041414864.1|439589_441227_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_142814563.1|441404_441980_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_128865105.1|442010_442664_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_020828260.1|442663_443623_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_142814564.1|443619_444096_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_142814565.1|444109_444931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828257.1|445473_447273_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	1.6e-22
WP_129941323.1|447303_448281_+	signal peptidase I	NA	NA	NA	NA	NA
WP_041414862.1|448463_449144_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.3	9.6e-21
WP_020828254.1|449140_450049_+	GTPase Era	NA	NA	NA	NA	NA
WP_020828253.1|450057_450789_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_020828252.1|450862_451594_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_020828251.1|451593_451974_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_044554541.1|452037_452298_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	5.5e-17
WP_142814566.1|452426_453965_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_142814567.1|454099_454948_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020828196.1|455116_456010_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_020828195.1|456028_457396_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_020828194.1|457399_458056_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_130016685.1|458096_459248_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_142814568.1|459447_460500_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_044554547.1|460683_461196_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	2.3e-06
>prophage 2
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	534396	567137	5706987	tail,terminase,integrase	Salmonella_phage(21.21%)	43	528351:528365	547367:547381
528351:528365	attL	TGCAGTTCTTCCAGC	NA	NA	NA	NA
WP_020828138.1|534396_535860_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	3.4e-87
WP_020828137.1|536036_537614_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_142814588.1|537837_539037_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	67.8	2.0e-154
WP_142814589.1|539041_539329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814590.1|539325_539979_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.9	1.1e-82
WP_142814591.1|539975_540254_-	DUF4752 family protein	NA	A0A1R3Y5T8	Salmonella_virus	34.5	1.6e-06
WP_142814592.1|540253_540646_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_142814593.1|540642_540894_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	54.9	9.9e-16
WP_142814594.1|540934_541870_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	81.2	2.1e-143
WP_142814595.1|541866_542685_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	79.3	1.2e-126
WP_142814596.1|542684_542990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814597.1|543167_543491_-	hypothetical protein	NA	A0A2H4JDX9	uncultured_Caudovirales_phage	37.2	3.2e-06
WP_142814598.1|543759_544356_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.3	4.7e-48
WP_142814599.1|544506_544725_+	hypothetical protein	NA	Q858D6	Salmonella_phage	59.4	1.7e-16
WP_142814600.1|544869_545076_+	hypothetical protein	NA	A0A1I9SES5	Klebsiella_phage	61.4	4.3e-09
WP_142814601.1|545802_546501_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	40.3	4.0e-22
WP_142814602.1|546710_547184_+	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	73.7	2.0e-57
WP_142814603.1|547187_547400_+	TraR/DksA family transcriptional regulator	NA	A2I309	Vibrio_virus	47.2	2.0e-09
547367:547381	attR	GCTGGAAGAACTGCA	NA	NA	NA	NA
WP_142814604.1|547410_547908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814605.1|547904_548537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814606.1|548523_549420_+	phosphoadenosine phosphosulfate reductase family protein	NA	S4TN48	Salmonella_phage	79.4	2.6e-143
WP_142814607.1|549600_549786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816374.1|549811_550384_+	hypothetical protein	NA	Q716F4	Shigella_phage	38.8	5.4e-09
WP_142814608.1|550557_551298_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	40.6	1.6e-05
WP_142814609.1|551287_551527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814610.1|551516_551906_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	33.0	3.9e-11
WP_142814611.1|552014_552497_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	39.3	1.9e-18
WP_142814612.1|552489_553977_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	71.4	1.2e-212
WP_142814613.1|554017_554395_-	hypothetical protein	NA	J9QM70	Pectobacterium_phage	70.6	2.5e-47
WP_142814614.1|554405_554594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814615.1|554917_555121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814616.1|555123_556809_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.6	2.1e-186
WP_142816375.1|556808_557105_+	hypothetical protein	NA	Q2A090	Sodalis_phage	71.8	1.0e-27
WP_142814617.1|557070_557337_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	83.6	7.1e-20
WP_142814618.1|557346_558042_+	peptidase	NA	Q2A089	Sodalis_phage	69.8	9.8e-45
WP_142814619.1|558048_559032_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	73.7	1.1e-139
WP_142814620.1|559085_559532_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	56.8	2.0e-30
WP_142814621.1|559543_559837_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	39.4	6.2e-09
WP_142814622.1|559879_560203_+	hypothetical protein	NA	T1SBJ0	Salmonella_phage	57.1	1.2e-21
WP_142814623.1|560202_560811_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	59.4	5.9e-62
WP_142814624.1|560810_563312_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.5	9.8e-305
WP_142814625.1|563311_563785_+	hypothetical protein	NA	Q858G2	Salmonella_phage	62.7	1.6e-51
WP_142814626.1|564377_567137_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	37.7	2.4e-86
>prophage 3
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	571735	578607	5706987	holin	Klebsiella_phage(28.57%)	10	NA	NA
WP_142814629.1|571735_572473_+	transcriptional regulator	NA	H6WRU9	Salmonella_phage	51.9	2.3e-20
WP_142814630.1|572505_572799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814631.1|572953_573709_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	45.0	4.6e-48
WP_142814632.1|574076_574325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814633.1|574512_576933_+	hypothetical protein	NA	A0A289YVP5	Serratia_phage	40.6	1.5e-121
WP_142814634.1|576947_577229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814635.1|577258_577489_+|holin	holin	holin	H9C183	Pectobacterium_phage	72.5	1.9e-21
WP_142814636.1|577472_577988_+	glycoside hydrolase family protein	NA	Q71TF3	Escherichia_phage	51.1	6.5e-46
WP_142814637.1|577972_578350_+	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	43.0	7.7e-12
WP_142814638.1|578346_578607_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	53.5	2.4e-12
>prophage 4
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	652335	659680	5706987		Salmonella_phage(33.33%)	10	NA	NA
WP_142814658.1|652335_652974_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	1.7e-27
WP_122079991.1|652970_654011_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.5e-70
WP_020828072.1|654266_654893_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_116689999.1|655102_656392_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.3	7.1e-65
WP_002487967.1|656606_656855_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_020828070.1|656883_657399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044554653.1|657627_658329_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_142814659.1|658345_658885_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.2	1.5e-48
WP_130016636.1|658896_659127_-	hypothetical protein	NA	J9Q735	Salmonella_phage	49.3	2.9e-14
WP_020828066.1|659326_659680_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	3.9e-18
>prophage 5
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	671906	741146	5706987	head,portal,tail,holin,capsid,terminase,integrase	Cronobacter_phage(54.05%)	77	666808:666823	730246:730261
666808:666823	attL	CGGCAAGGTGCTGAGC	NA	NA	NA	NA
WP_142814662.1|671906_672887_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	51.5	3.7e-90
WP_142814663.1|672910_673246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814664.1|673485_673785_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	61.6	2.5e-26
WP_142814665.1|673893_674154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814666.1|674166_674379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814667.1|674375_674645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814668.1|674635_674857_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_142814669.1|675095_675431_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_142814670.1|675722_675992_+	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	46.1	3.6e-11
WP_142814672.1|675988_676213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814673.1|676220_677258_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	8.8e-66
WP_142814675.1|677254_679504_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	48.7	3.1e-185
WP_142814676.1|679693_680140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814678.1|680167_680434_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	59.5	5.0e-26
WP_142814679.1|680490_681564_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.4	1.2e-123
WP_142814680.1|681560_683366_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.7	7.8e-187
WP_142814681.1|683543_684626_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	42.6	4.6e-33
WP_142814682.1|684676_685714_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	53.8	1.4e-95
WP_142814683.1|685716_686421_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	58.2	3.1e-70
WP_142814684.1|686529_687003_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	58.9	2.3e-37
WP_142814685.1|686999_687476_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	37.0	3.7e-27
WP_142814686.1|687511_688168_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	1.7e-67
WP_142814687.1|688170_689310_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.2	3.6e-129
WP_142814688.1|689312_689768_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.6	2.3e-39
WP_142814689.1|689772_690063_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.2	2.9e-11
WP_142814690.1|690059_690401_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	1.6e-40
WP_142814691.1|690400_690784_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	42.3	2.2e-14
WP_142814692.1|690701_690884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814693.1|690886_691162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814694.1|691170_691350_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	7.1e-08
WP_142814695.1|691351_693430_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.4	6.5e-153
WP_142814696.1|693426_693762_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	59.6	1.1e-30
WP_142814697.1|693754_694939_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	70.7	8.0e-156
WP_142814698.1|694931_695522_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	67.9	2.6e-75
WP_142814699.1|695531_697634_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	59.2	1.2e-101
WP_142814700.1|697636_698065_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	51.2	3.5e-29
WP_142814701.1|698054_698780_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	44.9	5.2e-49
WP_142814702.1|698751_699297_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	60.4	8.2e-47
WP_142814703.1|699305_701030_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	59.9	4.7e-173
WP_142816379.1|701848_702004_+	Hok/Gef family protein	NA	A0A1I9LJU7	Stx_converting_phage	57.1	1.5e-06
WP_020828053.1|702312_703194_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_020828052.1|703210_704263_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_020828051.1|704512_705226_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	35.2	3.4e-37
WP_115058306.1|705663_706530_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_142814704.1|706584_708597_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142814705.1|708714_709404_+	esterase	NA	NA	NA	NA	NA
WP_020828048.1|709432_709618_-	YpfN family protein	NA	NA	NA	NA	NA
WP_130016630.1|709620_710295_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_142814706.1|710291_711419_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_046374994.1|711415_711781_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_041415576.1|712012_712438_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_122079980.1|712529_712847_-	isochorismate-pyruvate lyase	NA	NA	NA	NA	NA
WP_142814707.1|712858_713299_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020828041.1|713308_713788_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_129941467.1|713921_716093_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_142814708.1|716102_717173_-	YncE family protein	NA	NA	NA	NA	NA
WP_142814709.1|717566_719606_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.4	4.3e-08
WP_100396732.1|719844_719904_+	protein YpfM	NA	NA	NA	NA	NA
WP_115058313.1|720024_723162_-	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_020828036.1|723442_723721_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020828035.1|723747_724380_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_142814710.1|724541_726224_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_020828033.1|726625_727126_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_081667734.1|727118_727382_+	chaperone NapD	NA	NA	NA	NA	NA
WP_046372967.1|727378_729865_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_041414810.1|729919_730369_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
730246:730261	attR	CGGCAAGGTGCTGAGC	NA	NA	NA	NA
WP_020828029.1|730380_730998_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_046372968.1|731129_731705_+	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_142814711.1|731753_732176_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	39.3	5.4e-14
WP_020828026.1|732290_732839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814712.1|733463_735458_-	transketolase	NA	NA	NA	NA	NA
WP_046372969.1|735475_736426_-	transaldolase	NA	A0A127KMN5	Cyanophage	33.3	1.9e-11
WP_020828023.1|736721_737315_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.5e-22
WP_020828022.1|737720_738662_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142814713.1|738603_738951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115058347.1|739023_740523_-	chitinase	NA	A0A1B1V5N4	Malacosoma_sp._alphabaculovirus	28.5	3.2e-24
WP_020828020.1|740819_741146_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	41.5	7.9e-13
>prophage 6
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	762636	772570	5706987		Planktothrix_phage(33.33%)	8	NA	NA
WP_142814720.1|762636_763725_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.3	6.0e-33
WP_142814721.1|763809_764691_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	41.9	8.5e-54
WP_142816381.1|764694_766647_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	5.9e-39
WP_142814722.1|766649_767843_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	70.0	3.4e-29
WP_020827993.1|768017_768698_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041415561.1|768703_770020_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	3.2e-20
WP_012146162.1|770283_770793_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_020827991.1|770842_772570_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
>prophage 7
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	1004800	1047125	5706987	protease,portal,tail,terminase,integrase	Enterobacterial_phage(26.32%)	47	1001044:1001058	1009177:1009191
1001044:1001058	attL	GGCGCAGCCGGTGGC	NA	NA	NA	NA
WP_122079878.1|1004800_1005958_-	acyltransferase	NA	Q6QI96	Burkholderia_phage	30.8	2.4e-40
WP_142814779.1|1006354_1007533_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.8	1.7e-33
WP_142814780.1|1007532_1007751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814781.1|1007799_1008378_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.5	5.8e-67
WP_142814782.1|1008374_1009334_-	DUF551 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	61.3	7.2e-14
1009177:1009191	attR	GCCACCGGCTGCGCC	NA	NA	NA	NA
WP_142814783.1|1009333_1009852_-	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	57.1	5.0e-54
WP_142814784.1|1010017_1010356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814785.1|1010345_1011038_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.6	1.5e-29
WP_142814786.1|1011034_1011220_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_142814787.1|1011219_1011753_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	60.8	4.2e-56
WP_142814788.1|1011836_1012658_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	63.3	2.4e-95
WP_142814789.1|1012710_1013082_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	1.6e-46
WP_142814790.1|1014581_1015301_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	32.3	9.8e-24
WP_142814791.1|1015373_1015634_+	helix-turn-helix domain-containing protein	NA	Q6J1N2	Burkholderia_virus	47.9	1.3e-10
WP_142814792.1|1015656_1016130_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	67.3	4.6e-54
WP_142814793.1|1016193_1016382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814794.1|1016378_1017029_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7QZZ9	Vibrio_phage	52.0	2.4e-53
WP_142814795.1|1017030_1017210_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_142814796.1|1017206_1018298_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	43.5	1.6e-62
WP_142814797.1|1018294_1018537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816383.1|1019499_1020303_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	73.8	1.3e-96
WP_142814798.1|1020299_1021337_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	40.7	5.9e-70
WP_142814799.1|1021333_1022155_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.1	9.1e-50
WP_142814800.1|1022529_1022826_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	70.4	1.7e-30
WP_142814801.1|1022827_1023358_+	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	80.0	3.5e-79
WP_142814802.1|1023354_1023741_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_142814803.1|1023670_1023892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814804.1|1023867_1024074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814805.1|1024438_1024948_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	52.9	1.1e-40
WP_142814806.1|1024937_1027049_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	70.0	8.6e-302
WP_033646499.1|1027045_1027261_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	71.4	4.4e-20
WP_142814807.1|1027257_1028763_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	70.9	9.1e-205
WP_142814808.1|1028710_1030735_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	76.0	5.0e-291
WP_142814809.1|1030819_1031140_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	55.1	8.8e-25
WP_142814810.1|1031132_1031408_+	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	52.5	1.2e-17
WP_142814811.1|1031418_1031982_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	58.9	3.3e-51
WP_142814812.1|1031978_1032380_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	59.4	1.6e-44
WP_142814813.1|1032391_1033129_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.0	3.4e-88
WP_142814814.1|1033172_1033580_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	42.7	4.9e-20
WP_142814815.1|1033600_1033912_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	3.2e-24
WP_142814816.1|1033892_1037018_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	28.9	2.4e-98
WP_142814817.1|1037017_1037374_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	38.6	1.8e-18
WP_142814818.1|1037382_1038135_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	59.0	6.5e-87
WP_142816384.1|1038137_1038839_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	56.5	2.2e-76
WP_142814819.1|1039512_1040130_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	61.1	6.2e-59
WP_142814820.1|1040190_1043574_+	DUF1983 domain-containing protein	NA	I6PDK0	Cronobacter_phage	47.2	3.4e-300
WP_142814821.1|1046216_1047125_+	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	53.5	2.2e-20
>prophage 8
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	1154093	1189430	5706987	head,tail,holin,terminase,integrase	Salmonella_phage(28.57%)	44	1169788:1169802	1198324:1198338
WP_142814875.1|1154093_1154747_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.6	8.0e-33
WP_142814876.1|1154826_1155054_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	51.7	4.8e-09
WP_057523791.1|1155172_1155352_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_142814877.1|1155651_1156365_+	hypothetical protein	NA	C6ZR51	Salmonella_phage	51.7	3.0e-25
WP_142814878.1|1156476_1158354_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.6	4.6e-230
WP_142816389.1|1158407_1159298_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	56.9	2.6e-82
WP_142814879.1|1159297_1159729_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	67.5	1.8e-41
WP_142814880.1|1159818_1160007_+	late control protein B	NA	F1BUT0	Erwinia_phage	61.5	5.3e-14
WP_142814881.1|1160264_1160834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814882.1|1161092_1161311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814883.1|1161381_1161732_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	69.0	4.9e-29
WP_142814884.1|1161712_1162180_+	glycoside hydrolase family protein	NA	A0A2P1MXF6	Escherichia_phage	73.0	1.2e-59
WP_142814885.1|1162176_1162713_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	51.1	2.6e-29
WP_142814886.1|1163016_1163205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814887.1|1163223_1163793_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	48.3	1.0e-36
WP_142814888.1|1164079_1165450_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.2	2.0e-142
WP_142814889.1|1165449_1166946_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	60.1	3.1e-173
WP_142816390.1|1166875_1167538_+|head	phage head morphogenesis protein	head	A0A2H4J8F5	uncultured_Caudovirales_phage	59.1	2.5e-66
WP_142814890.1|1167791_1169033_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	51.3	1.4e-102
WP_142814891.1|1169032_1169530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814892.1|1169544_1170483_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	56.7	9.9e-101
1169788:1169802	attL	CCCGGCATTGACCTG	NA	NA	NA	NA
WP_142814893.1|1170517_1170898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814894.1|1170881_1171289_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	70.1	3.7e-44
WP_142814895.1|1171285_1171789_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	57.1	1.9e-42
WP_142814896.1|1171775_1172162_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	80.5	7.0e-53
WP_142814897.1|1172139_1172703_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	62.2	9.3e-62
WP_142814898.1|1172705_1174187_+	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	50.8	4.2e-130
WP_142814899.1|1174196_1174640_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	66.7	2.4e-49
WP_142814900.1|1174650_1175049_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	61.9	1.9e-37
WP_142814901.1|1175226_1177239_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	56.3	3.8e-206
WP_142814902.1|1177238_1177853_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.0	6.6e-61
WP_142814903.1|1177852_1178161_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.4	1.6e-23
WP_142814904.1|1178160_1179222_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	68.1	5.0e-141
WP_142814905.1|1179227_1180367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814906.1|1180425_1181178_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	56.4	6.1e-77
WP_142814907.1|1181177_1181531_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	65.0	3.4e-38
WP_142814908.1|1181527_1182721_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	58.7	2.4e-120
WP_142814909.1|1182717_1183389_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	50.0	1.9e-53
WP_142814910.1|1183381_1184281_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	50.0	7.2e-16
WP_142814911.1|1184280_1184493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814912.1|1184551_1186969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814913.1|1186970_1187879_+	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	54.5	1.3e-20
WP_142814914.1|1188024_1188288_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	32.5	4.9e-05
WP_142814915.1|1188332_1189430_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MDN5	Escherichia_phage	64.5	2.8e-139
1198324:1198338	attR	CAGGTCAATGCCGGG	NA	NA	NA	NA
>prophage 9
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	1317789	1362967	5706987	tail,terminase,holin,coat	Enterobacteria_phage(25.58%)	61	NA	NA
WP_142814958.1|1317789_1319061_-	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	44.3	1.9e-86
WP_142814959.1|1319033_1319219_-	excisionase	NA	A0A1I9KF80	Aeromonas_phage	54.5	2.7e-10
WP_142814960.1|1319290_1319476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814961.1|1319469_1320588_-	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	48.9	1.2e-63
WP_142814962.1|1320599_1323710_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	37.4	8.9e-130
WP_142814963.1|1324229_1324523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814964.1|1324602_1324800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814965.1|1325198_1325600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814966.1|1325722_1326115_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	53.2	2.4e-32
WP_142814967.1|1326218_1326464_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	66.2	1.0e-20
WP_142814968.1|1326474_1326936_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	43.3	1.8e-18
WP_142814969.1|1326951_1327194_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_142814970.1|1328344_1328809_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	52.3	2.5e-44
WP_142814971.1|1328813_1329236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814972.1|1329232_1329589_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	62.0	1.1e-15
WP_142814973.1|1329585_1329834_+	hypothetical protein	NA	A0A1B0VMD8	Pseudomonas_phage	64.4	8.3e-23
WP_142814974.1|1329830_1330370_+	hypothetical protein	NA	J9Q748	Salmonella_phage	61.6	3.5e-58
WP_142814975.1|1330362_1330650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814976.1|1330646_1330853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814977.1|1330852_1331239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814978.1|1331228_1331639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816394.1|1332618_1332852_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	55.8	4.4e-18
WP_142814979.1|1332897_1333137_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.2	1.1e-19
WP_142814980.1|1333179_1333773_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	84.6	9.7e-94
WP_142814981.1|1333769_1334063_+	hypothetical protein	NA	A0A2H4FS95	Methylophilaceae_phage	50.0	4.0e-24
WP_142814982.1|1334059_1334650_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.6	7.0e-68
WP_142814983.1|1335122_1335458_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	45.2	2.2e-18
WP_142814984.1|1335461_1336085_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	61.2	2.5e-68
WP_142814985.1|1336081_1336468_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_142814986.1|1336397_1336625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816395.1|1337243_1337687_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	38.7	4.6e-08
WP_142814987.1|1337667_1338972_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	7.5e-147
WP_142814988.1|1338977_1340369_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	73.3	1.3e-197
WP_142814989.1|1340371_1341484_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.2	1.6e-118
WP_142814990.1|1341587_1342340_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	74.8	3.9e-100
WP_142814991.1|1342434_1343574_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.8	9.7e-159
WP_142814992.1|1343618_1343972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814993.1|1343975_1344458_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	60.6	3.3e-52
WP_142814994.1|1344459_1344810_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	65.0	3.6e-32
WP_142814995.1|1344811_1345396_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.8	2.5e-54
WP_142814996.1|1345392_1345623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814997.1|1345619_1346039_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	42.9	1.7e-23
WP_142814998.1|1346082_1346739_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	64.8	1.4e-69
WP_142814999.1|1346784_1347138_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	54.4	6.5e-29
WP_142815000.1|1347185_1347440_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	64.1	1.7e-18
WP_142815001.1|1347463_1347766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815002.1|1347822_1350750_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	43.8	1.4e-185
WP_142815003.1|1350789_1351131_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	51.8	1.4e-28
WP_142815004.1|1351127_1351865_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	76.7	1.7e-119
WP_142815005.1|1351867_1352587_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	68.1	2.0e-101
WP_142815006.1|1352579_1353197_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	71.7	2.0e-78
WP_142815007.1|1353197_1353587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815008.1|1353846_1357032_+	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	60.6	0.0e+00
WP_142815009.1|1357046_1357358_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	43.2	1.8e-11
WP_142815010.1|1357375_1358026_+	hypothetical protein	NA	T2DR06	Escherichia_virus	33.8	4.7e-17
WP_142815011.1|1358143_1358380_+	cor protein	NA	E4WL42	Enterobacteria_phage	63.2	2.7e-23
WP_142815012.1|1358449_1359769_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	41.6	3.0e-87
WP_142815013.1|1359890_1361306_+	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	54.2	4.9e-51
WP_142815014.1|1361447_1361912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815015.1|1361914_1362184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815016.1|1362364_1362967_-	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	48.2	2.2e-21
>prophage 10
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	1478013	1486975	5706987		Escherichia_phage(50.0%)	6	NA	NA
WP_142815049.1|1478013_1480158_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	69.5	3.8e-140
WP_020827477.1|1480841_1481627_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.9	1.0e-90
WP_142815050.1|1481844_1482714_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	25.9	1.7e-06
WP_020827475.1|1482717_1483242_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.8	4.2e-32
WP_142815051.1|1483274_1485608_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.1	4.4e-33
WP_020827473.1|1486072_1486975_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.7	1.7e-36
>prophage 11
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	2346577	2441570	5706987	head,protease,tRNA,terminase,coat,integrase	Cronobacter_phage(24.0%)	112	2348536:2348552	2396915:2396931
WP_041414516.1|2346577_2348506_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.5e-132
2348536:2348552	attL	ACACGACAGATCACATG	NA	NA	NA	NA
WP_142815299.1|2348785_2349547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815300.1|2349557_2351309_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_142815301.1|2351309_2353805_-	MoaD/ThiS family protein	NA	A0A1B1W274	Salmonella_phage	55.4	2.2e-256
WP_142816414.1|2353752_2354157_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	65.5	1.8e-46
WP_115058964.1|2354176_2354647_-	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	63.4	3.3e-52
WP_020826612.1|2354647_2355115_-	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.2	8.5e-53
WP_142815302.1|2355273_2355453_+	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_142815303.1|2355449_2355629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815304.1|2355676_2359102_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.4	2.8e-217
WP_142815305.1|2359162_2359858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815306.1|2360003_2360354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816415.1|2360494_2360854_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	53.7	1.7e-13
WP_142815307.1|2360892_2361567_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	57.0	2.7e-68
WP_142815308.1|2361621_2362377_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.5	2.1e-45
WP_142815309.1|2362442_2362823_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	57.9	8.2e-38
WP_142815310.1|2362819_2363188_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	76.2	1.4e-47
WP_142815311.1|2363189_2363540_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.4	3.0e-26
WP_142815312.1|2363637_2364018_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.8	7.2e-50
WP_142815313.1|2364017_2364419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815314.1|2364428_2365505_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.1	3.1e-154
WP_142815315.1|2365515_2365953_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.8	5.7e-43
WP_142815316.1|2365956_2367342_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.6	1.2e-155
WP_142816416.1|2367372_2368260_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	64.6	2.2e-105
WP_142815317.1|2368327_2369755_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	64.5	1.1e-167
WP_142815318.1|2369765_2371256_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	80.9	1.0e-240
WP_142815319.1|2371259_2371703_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.4	2.4e-49
WP_142815320.1|2371734_2372385_-	hypothetical protein	NA	I6S676	Salmonella_phage	77.6	6.2e-94
WP_142815321.1|2372449_2372692_-	DUF2560 family protein	NA	NA	NA	NA	NA
WP_142815322.1|2372766_2372964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815323.1|2373051_2373306_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	76.2	4.2e-30
WP_142815324.1|2373820_2374060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816418.1|2374072_2374261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816417.1|2374241_2374598_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_142815325.1|2374621_2374816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815326.1|2374802_2375465_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	48.6	4.0e-56
WP_142815327.1|2375502_2375937_-	glycoside hydrolase family protein	NA	R9TMH8	Aeromonas_phage	55.9	2.0e-35
WP_130380110.1|2375923_2376325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815328.1|2377058_2377754_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	27.5	1.3e-12
WP_142815329.1|2377750_2378107_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	68.6	3.0e-42
WP_142815330.1|2378103_2379078_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.6	5.2e-68
WP_142815331.1|2379074_2379497_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	58.0	1.3e-44
WP_142815332.1|2379496_2380888_-	AAA family ATPase	NA	A0A1V0E5J4	Salmonella_phage	64.2	1.2e-150
WP_142815333.1|2380884_2381943_-	replication protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	81.4	3.9e-53
WP_142815334.1|2382382_2382706_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	81.7	4.4e-40
WP_142815335.1|2382721_2382952_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	63.2	6.1e-20
WP_142816419.1|2383180_2383759_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	54.8	1.6e-37
WP_142815336.1|2383964_2384306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815337.1|2384305_2384779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815338.1|2384824_2385079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815339.1|2385461_2385641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815340.1|2386345_2386540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816420.1|2386520_2387186_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.4	1.5e-18
WP_142815341.1|2387185_2387851_+	ATP-binding protein	NA	G9L667	Escherichia_phage	62.2	3.4e-71
WP_142815342.1|2387850_2388537_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.6	3.2e-24
WP_142815343.1|2388628_2389471_+	chromosome partitioning protein ParB	NA	R9W077	Serratia_phage	55.5	1.6e-73
WP_142815344.1|2389454_2390015_+	hypothetical protein	NA	A0A220NRQ7	Escherichia_phage	60.3	2.2e-10
WP_142815345.1|2390011_2390545_+	hypothetical protein	NA	J9Q748	Salmonella_phage	60.6	3.8e-57
WP_142815346.1|2390541_2391246_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	50.4	4.4e-53
WP_142815347.1|2391250_2392096_+	hypothetical protein	NA	M4MB35	Vibrio_phage	40.3	4.7e-49
WP_142815348.1|2392120_2392306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815349.1|2392373_2392667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815350.1|2392669_2392924_+	hypothetical protein	NA	A0A076G6R3	Escherichia_phage	48.3	7.5e-11
WP_142815351.1|2393152_2393410_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	59.3	8.9e-20
WP_142815352.1|2393419_2393656_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	64.6	1.1e-21
WP_142815353.1|2393655_2394018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815354.1|2394532_2394913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815355.1|2394928_2395111_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_116690640.1|2395112_2395328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116928038.1|2395339_2395588_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.2	2.0e-13
WP_115059018.1|2395551_2396754_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	59.8	2.7e-135
WP_142815356.1|2397108_2397720_-	hypothetical protein	NA	NA	NA	NA	NA
2396915:2396931	attR	ACACGACAGATCACATG	NA	NA	NA	NA
WP_130015635.1|2397971_2399012_-	CAP-Gly protein	NA	NA	NA	NA	NA
WP_020826578.1|2399258_2399480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020826577.1|2399604_2400291_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_046375047.1|2400329_2401463_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020826575.1|2401612_2402896_-	septum site-determining protein	NA	NA	NA	NA	NA
WP_104410898.1|2403152_2404493_-	cytochrome c	NA	NA	NA	NA	NA
WP_041414502.1|2404502_2406284_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_128865382.1|2406286_2407012_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_142815357.1|2407319_2407985_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	50.0	7.0e-08
WP_116690645.1|2408094_2408394_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_142815358.1|2408526_2409471_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_020826568.1|2409467_2410358_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	26.4	1.2e-07
WP_046373759.1|2410357_2411218_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_020826566.1|2411217_2412078_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_116690647.1|2412115_2412565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142815359.1|2412825_2413695_+	phosphotransferase	NA	NA	NA	NA	NA
WP_020826563.1|2413739_2414300_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_142815360.1|2414495_2415776_+|protease	protease	protease	NA	NA	NA	NA
WP_142815361.1|2415834_2416500_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_020826560.1|2416896_2417445_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	36.1	4.9e-07
WP_104410899.1|2417622_2419020_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_020826558.1|2419085_2419895_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_142815362.1|2419903_2421007_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_142815363.1|2421276_2421996_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_142815364.1|2422070_2422862_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_142816421.1|2423073_2424468_+	MFS transporter	NA	NA	NA	NA	NA
WP_142815365.1|2424729_2425947_-	MFS transporter	NA	NA	NA	NA	NA
WP_142815366.1|2425943_2426174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815367.1|2426170_2427703_-	MFS transporter	NA	NA	NA	NA	NA
WP_046373767.1|2427878_2428766_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020826553.1|2428930_2429809_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_128864327.1|2430700_2432737_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.5	1.1e-85
WP_020826550.1|2432756_2433467_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_046373769.1|2433562_2434060_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_048762701.1|2434304_2435552_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_046373770.1|2435520_2438151_+	PqiB family protein	NA	NA	NA	NA	NA
WP_129940401.1|2438254_2439691_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_122079008.1|2439970_2440510_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020826544.1|2440512_2441016_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_020826543.1|2441021_2441570_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 12
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	2607822	2615371	5706987		Erwinia_phage(50.0%)	11	NA	NA
WP_142815427.1|2607822_2608680_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.6	3.1e-77
WP_048760572.1|2608784_2609177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060430006.1|2609208_2609718_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	58.0	9.0e-48
WP_142816423.1|2609728_2609938_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	52.8	1.7e-08
WP_142815428.1|2609901_2610255_+	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	54.5	2.7e-27
WP_089187117.1|2610321_2610600_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060429999.1|2610599_2610818_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	61.1	2.7e-17
WP_142815429.1|2610820_2611645_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	45.9	4.2e-63
WP_142815430.1|2611638_2611857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060430812.1|2611868_2612900_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	6.7e-66
WP_142815431.1|2612896_2615371_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.4	3.0e-237
>prophage 13
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	2619155	2642392	5706987	head,portal,tail,plate,holin,capsid,terminase,integrase,lysis	Salmonella_phage(64.29%)	30	2631617:2631632	2643167:2643182
WP_142815436.1|2619155_2620199_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.2	2.5e-153
WP_089187108.1|2620199_2621966_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	83.7	1.4e-300
WP_142815437.1|2622109_2622943_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	68.7	5.0e-80
WP_142815438.1|2623003_2624068_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	73.3	1.7e-141
WP_082100051.1|2624106_2624742_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	54.3	4.7e-54
WP_142815439.1|2624840_2625305_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	55.2	3.0e-42
WP_046373880.1|2625304_2625508_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	3.4e-22
WP_142815440.1|2625512_2625881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815441.1|2625883_2626213_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	41.0	2.9e-07
WP_142815442.1|2626187_2626685_+	glycoside hydrolase family protein	NA	S4TUB1	Salmonella_phage	60.0	2.7e-49
WP_142815443.1|2626681_2627140_+|lysis	LysB family phage lysis regulatory protein	lysis	E5FFH9	Burkholderia_phage	49.2	2.0e-06
WP_142815444.1|2627042_2627285_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	51.3	1.6e-15
WP_142815445.1|2627247_2627679_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	59.7	1.1e-38
WP_142815446.1|2627671_2628118_+	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	54.6	1.5e-35
WP_142815447.1|2628263_2628857_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	56.4	2.6e-54
WP_142815448.1|2628853_2629204_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	54.1	9.3e-28
WP_142815449.1|2629200_2630109_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.2	1.9e-109
WP_142815450.1|2630101_2630701_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	59.5	2.1e-56
WP_142815451.1|2630669_2632430_+	SGNH/GDSL hydrolase family protein	NA	A0A2D1GNM3	Pseudomonas_phage	50.4	4.4e-25
2631617:2631632	attL	GCGCAGCGCGGGCTGG	NA	NA	NA	NA
WP_142815452.1|2632440_2633211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815453.1|2633255_2634419_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	54.8	1.1e-51
WP_142815454.1|2634615_2635791_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	82.0	3.2e-181
WP_142815455.1|2635801_2636317_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	69.0	5.3e-64
WP_089187090.1|2636377_2636668_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	60.0	1.5e-23
WP_142815456.1|2636682_2636802_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	66.7	1.5e-09
WP_142815457.1|2636794_2639338_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	52.6	5.4e-149
WP_089187088.1|2639334_2639799_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.3	3.1e-47
WP_142815458.1|2639795_2640893_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	64.9	6.3e-123
WP_071844562.1|2640966_2641185_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	65.3	6.2e-22
WP_142815459.1|2641300_2642392_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	60.8	2.4e-122
2643167:2643182	attR	CCAGCCCGCGCTGCGC	NA	NA	NA	NA
>prophage 14
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	2676894	2711618	5706987	head,portal,tail,plate,capsid,terminase,integrase	Enterobacteria_phage(37.14%)	46	2670042:2670056	2699270:2699284
2670042:2670056	attL	CATCAACGCCGCCAT	NA	NA	NA	NA
WP_142815471.1|2676894_2677893_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.2	8.7e-87
WP_142815472.1|2677899_2678517_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_142815473.1|2678638_2678938_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	52.6	4.5e-23
WP_142815474.1|2679025_2679295_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_142815475.1|2679326_2679758_+	hypothetical protein	NA	R9TRS3	Vibrio_phage	30.3	8.5e-07
WP_142815476.1|2679767_2679980_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	70.9	1.3e-16
WP_142815477.1|2679976_2680225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815478.1|2680221_2680485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815479.1|2680588_2680897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033640694.1|2680971_2681169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815480.1|2681325_2681883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815481.1|2681875_2682094_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	55.4	4.4e-12
WP_142815482.1|2682097_2682919_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	48.9	3.2e-63
WP_094859918.1|2682912_2683176_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	53.3	3.7e-13
WP_142816424.1|2683214_2684219_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	41.0	5.7e-62
WP_142815483.1|2684215_2684605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815484.1|2684579_2687204_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	47.5	1.3e-190
WP_142815485.1|2687206_2687428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197967.1|2687522_2687798_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	46.4	6.4e-16
WP_072265813.1|2687794_2688160_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_142815486.1|2688595_2689651_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.9	1.7e-141
WP_142815487.1|2689652_2691374_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	64.9	3.4e-224
WP_142815488.1|2691533_2692367_+|capsid	GPO family capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	67.5	1.6e-102
WP_142815489.1|2692403_2693450_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.1	7.2e-108
WP_142815490.1|2693494_2694409_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	81.8	4.1e-99
WP_142815491.1|2694512_2695010_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	78.8	2.6e-68
WP_142815492.1|2695009_2695210_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	61.5	1.3e-15
WP_142815493.1|2695200_2695482_+	hypothetical protein	NA	B9A7B8	Serratia_phage	87.0	6.1e-30
WP_142815494.1|2695478_2696033_+	glycoside hydrolase family protein	NA	Q1I0Z1	Pasteurella_virus	41.2	2.4e-30
WP_142815495.1|2696029_2696413_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_142815496.1|2696554_2697016_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.6	8.8e-34
WP_142815497.1|2697012_2697651_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.3	2.8e-46
WP_142815498.1|2697650_2698235_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.2	9.3e-65
WP_142815499.1|2698231_2698600_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	53.9	9.8e-28
WP_142815500.1|2698586_2699486_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	63.2	8.6e-94
2699270:2699284	attR	CATCAACGCCGCCAT	NA	NA	NA	NA
WP_142815501.1|2699478_2700087_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	49.7	2.0e-41
WP_142815502.1|2700083_2702432_+	hypothetical protein	NA	R9TNJ7	Vibrio_phage	51.0	8.0e-06
WP_142815503.1|2702433_2703345_+	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	53.5	2.2e-20
WP_142815504.1|2703376_2704525_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	53.3	3.1e-48
WP_142815505.1|2704616_2705108_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.8e-54
WP_142815506.1|2705122_2708086_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	91.1	6.9e-273
WP_142815507.1|2708075_2708216_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	61.5	5.0e-09
WP_142815508.1|2708248_2708548_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	88.9	1.8e-40
WP_142815509.1|2708613_2709129_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	9.4e-53
WP_142815510.1|2709129_2710311_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.6	2.7e-156
WP_142815511.1|2710463_2711618_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	88.3	8.0e-193
>prophage 15
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	2917234	2985113	5706987	protease,tail,tRNA,plate,transposase	Salmonella_phage(15.38%)	60	NA	NA
WP_020826116.1|2917234_2918527_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.7	9.8e-91
WP_041414384.1|2918636_2919980_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.7e-77
WP_020826114.1|2919987_2920599_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_142815558.1|2920945_2924521_-	cell division protein FtsK	NA	G1DAY1	Mycobacterium_virus	47.7	2.8e-87
WP_004928318.1|2924641_2925136_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_020826112.1|2925796_2926768_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.0e-61
WP_142815559.1|2926848_2927736_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142815560.1|2927834_2928452_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_142815561.1|2928628_2930395_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	1.7e-24
WP_115059292.1|2930397_2932134_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	1.3e-16
WP_046374008.1|2932164_2932890_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2932996_2933215_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_020826106.1|2933417_2935697_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.3e-166
WP_020826105.1|2935724_2936045_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_004942590.1|2936404_2936626_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.0e-16
WP_046374009.1|2936705_2938652_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.0	2.1e-36
WP_046374010.1|2938651_2939794_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_046374011.1|2939959_2940928_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_020826101.1|2940924_2942589_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_048761828.1|2942781_2943678_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_142815562.1|2943852_2945502_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_142815563.1|2945553_2946558_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_020826097.1|2946738_2948460_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_020826096.1|2948632_2949649_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_122078084.1|2949685_2950033_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_142815564.1|2950178_2951618_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_142815565.1|2951775_2952786_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_122078080.1|2952786_2953623_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.0	5.5e-10
WP_142815566.1|2953812_2955330_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_020826090.1|2955368_2955692_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	44.2	2.2e-15
WP_128864103.1|2955853_2956402_+	lipoprotein	NA	NA	NA	NA	NA
WP_020826088.1|2956665_2957394_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	3.9e-28
WP_020826087.1|2957427_2958159_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041414381.1|2958168_2958885_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_129940212.1|2958884_2959553_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_142815567.1|2959760_2960495_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142815568.1|2960557_2961685_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.1	1.1e-26
WP_116691166.1|2961753_2962233_-	YbjO family protein	NA	NA	NA	NA	NA
WP_020826081.1|2962458_2963304_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_104410965.1|2963300_2964260_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_020826079.1|2964291_2965425_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_020826078.1|2965562_2966672_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_020826077.1|2967080_2967560_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_142815569.1|2967721_2968624_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.9	1.4e-35
WP_044549449.1|2968680_2968986_-	YbjC family protein	NA	NA	NA	NA	NA
WP_012006074.1|2969228_2969492_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_048761796.1|2969535_2969925_-	membrane protein	NA	NA	NA	NA	NA
WP_041414378.1|2970352_2972041_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_142815570.1|2973655_2973868_-	late control protein B	NA	Q53ZE7	Salmonella_virus	76.1	7.8e-22
WP_142816429.1|2973935_2975306_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	1.5e-169
WP_142815571.1|2975328_2975736_-	hypothetical protein	NA	A0A1S6KZY7	Salmonella_phage	96.3	2.1e-63
WP_142815572.1|2976413_2977010_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.2	2.5e-49
WP_142815573.1|2977009_2977765_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	58.5	6.6e-71
WP_142815574.1|2977772_2977892_-|plate	phage baseplate protein	plate	E5G6N6	Salmonella_phage	91.7	7.7e-11
WP_142815575.1|2978004_2979756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816430.1|2979782_2979965_-	hypothetical protein	NA	E5G6N4	Salmonella_phage	65.5	1.1e-13
WP_142816431.1|2980308_2981420_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	5.8e-07
WP_142815576.1|2981709_2982669_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_142815577.1|2982831_2983755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815578.1|2983993_2985113_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	6.6e-51
>prophage 16
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	3899951	3907874	5706987	integrase	uncultured_Mediterranean_phage(33.33%)	6	3897376:3897388	3901391:3901403
3897376:3897388	attL	AAAAATCACCAAA	NA	NA	NA	NA
WP_142815873.1|3899951_3901244_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	27.4	2.4e-20
WP_142816449.1|3901483_3904039_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.6	2.5e-29
3901391:3901403	attR	TTTGGTGATTTTT	NA	NA	NA	NA
WP_142815874.1|3904121_3905120_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	9.4e-33
WP_122077272.1|3905174_3906185_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	38.6	8.1e-08
WP_128864986.1|3906492_3907119_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	2.0e-33
WP_046374485.1|3907112_3907874_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	4.6e-56
>prophage 17
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	3934254	3995221	5706987	head,protease,portal,tail,holin,capsid,terminase,integrase	Cronobacter_phage(38.89%)	62	3991333:3991349	3999914:3999930
WP_142815881.1|3934254_3935112_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.9	7.8e-28
WP_142816451.1|3935122_3936646_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	32.8	1.6e-60
WP_130016192.1|3936681_3937872_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	28.1	2.1e-15
WP_020825244.1|3937918_3938290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815882.1|3938300_3939491_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020825242.1|3939787_3941083_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.2	4.8e-130
WP_020825241.1|3941286_3942924_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	1.3e-151
WP_115061103.1|3943299_3944094_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_020825239.1|3944249_3946481_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_142815883.1|3946490_3947840_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.4e-34
WP_142815884.1|3947908_3950641_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.4	2.1e-50
WP_142815885.1|3952006_3953446_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	7.2e-26
WP_130016188.1|3953636_3955154_-	dGTPase	NA	NA	NA	NA	NA
WP_020825234.1|3955283_3955985_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_142815886.1|3955986_3956793_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_020825232.1|3956792_3957407_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_142815887.1|3957633_3957882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004950184.1|3957940_3958285_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	4.5e-27
WP_142815888.1|3958374_3959814_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_116691284.1|3959993_3961283_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_020825228.1|3961353_3962208_-	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_020825227.1|3962207_3962804_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	30.6	3.1e-15
WP_142815889.1|3962988_3963369_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_142816452.1|3963368_3963623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815890.1|3964995_3966669_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.8	2.6e-136
WP_142815891.1|3966665_3967217_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.6	1.2e-37
WP_142815892.1|3967213_3967918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815893.1|3967917_3968682_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	23.7	7.8e-11
WP_142815894.1|3968678_3970481_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	43.8	1.1e-58
WP_142815895.1|3970488_3971073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815896.1|3971072_3971705_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	51.8	9.8e-44
WP_142815897.1|3971697_3972882_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	64.3	8.3e-145
WP_142815898.1|3972971_3973307_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	61.4	2.3e-28
WP_142815899.1|3973303_3975385_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	39.5	4.0e-134
WP_142815900.1|3975390_3975570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815901.1|3975611_3975887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815902.1|3975870_3976101_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	52.2	1.3e-09
WP_142815903.1|3976365_3976704_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	78.2	5.1e-39
WP_142815904.1|3976700_3976994_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	44.2	9.2e-13
WP_142815905.1|3976997_3977453_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	60.3	2.9e-45
WP_142815906.1|3977455_3978631_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.0	6.4e-113
WP_142815907.1|3978627_3979326_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.0	1.8e-43
WP_142815908.1|3979315_3979831_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_142815909.1|3979827_3980280_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.0	1.3e-34
WP_142815910.1|3980397_3981141_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.8	3.7e-66
WP_142815911.1|3981155_3982325_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	48.8	2.0e-82
WP_142815912.1|3982407_3983367_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	56.3	4.5e-40
WP_142815913.1|3985400_3986507_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.7	5.8e-124
WP_142815914.1|3986503_3986836_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_142815915.1|3986937_3987633_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	58.9	1.1e-67
WP_142815916.1|3987790_3990040_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.0	2.2e-183
WP_142815917.1|3990036_3991074_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	40.7	2.9e-53
WP_142815918.1|3991081_3991306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815919.1|3991302_3991572_-	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	44.9	1.3e-10
3991333:3991349	attL	CAGCATGACAAAATCAG	NA	NA	NA	NA
WP_142815920.1|3991862_3992198_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_142815921.1|3992314_3992623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815922.1|3992642_3992864_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_142815923.1|3992863_3993115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815924.1|3993111_3993360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815925.1|3993356_3993731_-	hypothetical protein	NA	Q1JS24	Enterobacteria_phage	65.4	4.2e-34
WP_142815926.1|3993841_3994144_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	64.6	1.8e-27
WP_142815927.1|3994210_3995221_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	64.0	7.6e-115
3999914:3999930	attR	CAGCATGACAAAATCAG	NA	NA	NA	NA
>prophage 18
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	4094184	4173334	5706987	head,protease,portal,tail,tRNA,capsid,terminase	Salmonella_phage(15.09%)	89	NA	NA
WP_020825151.1|4094184_4097001_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	27.0	2.2e-66
WP_020825150.1|4097157_4098096_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_110605907.1|4098103_4098190_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_142816454.1|4098229_4098406_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_012005147.1|4098486_4098747_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004950031.1|4098816_4099716_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_020825149.1|4099910_4101077_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.6	9.8e-90
WP_142815947.1|4101312_4102437_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.2	5.6e-26
WP_020825147.1|4102543_4104457_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	47.2	3.5e-145
WP_041415204.1|4104781_4105381_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_142815948.1|4105432_4106740_-	MFS transporter	NA	NA	NA	NA	NA
WP_020825144.1|4106863_4107451_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_020825143.1|4107601_4108555_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	1.8e-12
WP_142815949.1|4108936_4110361_+	amino acid carrier protein	NA	NA	NA	NA	NA
WP_020825141.1|4110466_4111240_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_020825140.1|4111303_4112593_-	threonine synthase	NA	NA	NA	NA	NA
WP_130016159.1|4112596_4113526_-	homoserine kinase	NA	NA	NA	NA	NA
WP_122077094.1|4113527_4115987_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_071998276.1|4116069_4116138_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_020825137.1|4116350_4117037_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004949989.1|4117670_4118387_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_020825136.1|4118431_4118911_-	protein CreA	NA	NA	NA	NA	NA
WP_142815950.1|4119253_4120123_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_020825134.1|4120119_4120767_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_020825133.1|4120878_4121418_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_020825132.1|4121439_4121769_-	trp operon repressor	NA	NA	NA	NA	NA
WP_048762900.1|4121824_4123753_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.6	3.0e-11
WP_130016158.1|4124490_4125105_+	YfiR family protein	NA	NA	NA	NA	NA
WP_020825129.1|4125101_4126349_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	1.2e-13
WP_020825128.1|4126384_4126882_+	OmpA family protein	NA	NA	NA	NA	NA
WP_142815951.1|4127257_4127518_+	DinI-like family protein	NA	K7PKM2	Enterobacterial_phage	79.7	3.4e-27
WP_142814822.1|4127499_4127739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814913.1|4127763_4128672_-	hypothetical protein	NA	A0A2H4PAN7	Aphanizomenon_phage	54.5	1.3e-20
WP_142815952.1|4131313_4134712_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	52.1	6.8e-309
WP_142815953.1|4134771_4135371_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	63.5	1.7e-61
WP_142815954.1|4135403_4135829_-	hypothetical protein	NA	A0A1B0VMK5	Pseudomonas_phage	39.3	8.4e-23
WP_142816455.1|4135872_4136574_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	56.7	2.7e-79
WP_142815955.1|4136576_4137326_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	58.8	3.9e-84
WP_116690146.1|4137334_4137688_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	47.0	5.1e-26
WP_142815956.1|4137684_4141086_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	34.9	6.8e-115
WP_142815957.1|4141118_4141409_-	DUF4035 domain-containing protein	NA	K7PJX0	Enterobacterial_phage	48.9	1.6e-17
WP_142815958.1|4141405_4141828_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	57.5	5.7e-32
WP_142815959.1|4141845_4142568_-	Ig domain-containing protein	NA	A0A220NRQ0	Escherichia_phage	64.3	4.4e-48
WP_142815960.1|4142625_4142973_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	50.4	2.1e-24
WP_142815961.1|4142969_4143386_-	hypothetical protein	NA	K7PH04	Enterobacteria_phage	53.7	8.7e-33
WP_142815962.1|4143382_4143709_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	56.1	1.1e-27
WP_142816456.1|4143708_4144029_-	hypothetical protein	NA	K7P6N0	Enterobacteria_phage	64.1	1.1e-32
WP_142815963.1|4144077_4145241_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	85.3	2.9e-182
WP_142815964.1|4145242_4145923_-|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	81.9	5.0e-102
WP_142815965.1|4145940_4147209_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	81.3	3.5e-202
WP_142815966.1|4147208_4148945_-|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	44.6	2.2e-138
WP_142815967.1|4148898_4149363_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	9.7e-49
WP_142815968.1|4149581_4149782_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	50.0	1.6e-08
WP_142815969.1|4149781_4150120_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	76.4	2.1e-45
WP_142815970.1|4150116_4150341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815971.1|4150466_4150715_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	53.8	1.4e-14
WP_142815972.1|4150711_4150939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816457.1|4150868_4151225_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_142815973.1|4151248_4151764_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	68.4	1.2e-60
WP_142815974.1|4151987_4152518_-	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	81.1	3.2e-80
WP_142814800.1|4152519_4152816_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	70.4	1.7e-30
WP_142815975.1|4153182_4153956_-	antitermination protein	NA	NA	NA	NA	NA
WP_142815976.1|4153847_4154885_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	41.5	8.2e-72
WP_142816383.1|4154881_4155685_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	73.8	1.3e-96
WP_142815977.1|4156246_4156651_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2I7RVC5	Vibrio_phage	47.3	1.0e-30
WP_142814797.1|4156647_4156890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142814796.1|4156886_4157978_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	43.5	1.6e-62
WP_142814795.1|4157974_4158154_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_142815978.1|4158155_4158830_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7QZZ9	Vibrio_phage	53.6	2.2e-57
WP_142814793.1|4158826_4159015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142815979.1|4159078_4159552_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	67.9	5.4e-55
WP_142815980.1|4159577_4159775_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	4.1e-17
WP_142815981.1|4159879_4160530_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	70.4	1.2e-84
WP_142815982.1|4160809_4161061_-	bssS family protein	NA	NA	NA	NA	NA
WP_142815983.1|4161476_4161848_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	76.4	2.9e-48
WP_142815984.1|4161902_4162724_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	62.5	2.3e-93
WP_142815985.1|4162807_4163341_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	61.4	2.2e-57
WP_142815986.1|4163340_4163523_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_142815987.1|4163524_4164175_+	Eac protein	NA	A0A220NQT7	Salmonella_phage	49.0	3.9e-56
WP_142815988.1|4164167_4164428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142815989.1|4164604_4165123_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	57.1	1.3e-54
WP_142815990.1|4165122_4166082_+	DUF551 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	61.3	7.2e-14
WP_142815991.1|4166078_4166657_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	67.6	1.5e-67
WP_142816458.1|4166759_4166999_+	DUF1233 family excisionase	NA	A0A286S2A4	Klebsiella_phage	41.2	4.6e-10
WP_142815992.1|4167012_4168305_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	55.5	1.8e-132
WP_041414175.1|4168334_4170002_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	4.3e-38
WP_142815993.1|4170032_4170944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142815994.1|4171042_4172044_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020825124.1|4172077_4173334_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.0	2.0e-88
>prophage 19
NZ_CP033893	Serratia liquefaciens strain FG3 chromosome, complete genome	5706987	5514042	5544045	5706987	head,portal,tail,holin,capsid,terminase,integrase	Cronobacter_phage(77.42%)	37	5504244:5504259	5541015:5541030
5504244:5504259	attL	GCGCAATTTTACCGCC	NA	NA	NA	NA
WP_142816319.1|5514042_5515107_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.7	2.0e-118
WP_142816321.1|5515108_5515669_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	41.5	6.0e-37
WP_142816323.1|5515799_5516018_+	regulator	NA	NA	NA	NA	NA
WP_046897809.1|5516050_5516560_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	50.3	1.9e-37
WP_046897808.1|5516569_5516773_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_142816324.1|5516772_5517156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142814545.1|5517163_5517568_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	46.8	3.1e-27
WP_046897806.1|5517643_5517871_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_060706389.1|5518035_5518935_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.5	3.5e-71
WP_060706390.1|5518931_5519162_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	43.4	5.0e-06
WP_139276975.1|5519455_5519788_+	HNH endonuclease	NA	A0A2I7RAW6	Vibrio_phage	62.9	5.6e-06
WP_142816325.1|5519784_5520177_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_142816326.1|5520176_5522228_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	64.5	1.3e-246
WP_060706394.1|5522304_5522523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072628566.1|5522490_5522766_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	68.6	3.5e-30
WP_142816369.1|5522816_5523797_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	70.7	6.2e-138
WP_142814549.1|5523862_5525653_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.3	1.8e-244
WP_046897800.1|5525829_5526639_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	41.9	6.0e-46
WP_060431885.1|5526682_5527711_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	77.6	7.0e-148
WP_060435824.1|5527717_5528422_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	61.1	1.3e-76
WP_142814550.1|5528521_5528974_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.0	4.1e-36
WP_046897793.1|5531298_5531754_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.6	1.2e-54
WP_060431890.1|5531763_5532066_+|holin	holin	holin	C7BGD7	Burkholderia_phage	51.1	2.9e-17
WP_142814553.1|5532052_5532394_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	83.2	7.4e-46
WP_142814554.1|5532393_5532765_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	56.8	4.6e-25
WP_046897789.1|5532709_5532889_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	60.7	8.6e-14
WP_142814555.1|5532885_5533161_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.8	6.2e-19
WP_071883790.1|5533169_5533349_+	hypothetical protein	NA	Q1I0Y8	Pasteurella_virus	50.0	3.8e-09
WP_142814556.1|5533348_5535748_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.3	1.6e-155
WP_060431894.1|5535747_5536095_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	74.7	1.6e-35
WP_142814557.1|5536072_5537257_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	67.8	2.7e-151
WP_046897784.1|5537249_5537849_+	protein phage	NA	F1BUK5	Cronobacter_phage	68.5	1.4e-71
WP_142814558.1|5537854_5540722_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	65.2	1.7e-103
WP_072628547.1|5540724_5541153_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	41.0	1.0e-12
5541015:5541030	attR	GGCGGTAAAATTGCGC	NA	NA	NA	NA
WP_142816327.1|5541142_5541865_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	36.7	1.3e-36
WP_142816328.1|5541839_5542406_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.2	2.5e-46
WP_142816329.1|5542392_5544045_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.0	6.1e-170
>prophage 1
NZ_CP033894	Serratia liquefaciens strain FG3 plasmid p1-159, complete sequence	159042	59198	89809	159042	transposase,integrase	Escherichia_phage(40.0%)	23	51414:51428	61587:61601
51414:51428	attL	GCCGGCAGCGCCGGC	NA	NA	NA	NA
WP_060452175.1|59198_59978_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	84.8	8.1e-48
WP_142816524.1|60159_60468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072274593.1|60501_60861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816525.1|61116_61374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816526.1|61398_62019_+	hypothetical protein	NA	NA	NA	NA	NA
61587:61601	attR	GCCGGCGCTGCCGGC	NA	NA	NA	NA
WP_142816527.1|62015_62624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816528.1|62884_63640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816529.1|64587_65514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816530.1|65902_66178_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_142816531.1|66212_67322_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.8e-31
WP_142816532.1|67365_67764_+	VOC family protein	NA	NA	NA	NA	NA
WP_142816533.1|70710_71286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816534.1|71838_72534_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.5	1.4e-43
WP_142816535.1|75890_76133_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_142816536.1|76125_76416_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_142816537.1|77897_78227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816538.1|79474_80698_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_142816539.1|80888_83927_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_142816540.1|84208_84906_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	57.1	5.5e-80
WP_142816541.1|85332_86073_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_142816542.1|86160_86748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816543.1|86791_88411_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	26.5	2.5e-11
WP_142816544.1|88585_89809_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP033894	Serratia liquefaciens strain FG3 plasmid p1-159, complete sequence	159042	104517	112413	159042	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_142816553.1|104517_105462_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.9	2.7e-69
WP_142816554.1|105983_107329_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	2.2e-77
WP_142816555.1|107395_108025_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.7	3.4e-20
WP_142816556.1|108021_108369_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.4	5.9e-43
WP_142816557.1|108388_109216_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	1.8e-37
WP_142816558.1|109464_112413_-	RHS repeat protein	NA	S5W9C6	Leptospira_phage	31.6	1.5e-06
>prophage 1
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	0	2640	125113	transposase	Enterobacteria_phage(100.0%)	2	NA	NA
WP_142816584.1|875_2099_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_142816585.1|2301_2640_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	53.7	4.2e-25
>prophage 2
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	15852	19745	125113	transposase,integrase	Sodalis_phage(33.33%)	4	13799:13812	19187:19200
13799:13812	attL	TGCCCGTCTGGCGG	NA	NA	NA	NA
WP_142816589.1|15852_16785_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.6e-72
WP_142816590.1|16856_17741_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_025862211.1|18206_18950_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.0	1.5e-19
WP_025862212.1|19121_19745_+	AAA family ATPase	NA	K7R2R7	Vibrio_phage	46.4	1.4e-42
19187:19200	attR	TGCCCGTCTGGCGG	NA	NA	NA	NA
>prophage 3
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	23443	26556	125113		Enterobacteria_phage(33.33%)	5	NA	NA
WP_142816594.1|23443_24454_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	25.8	9.6e-17
WP_142816595.1|24511_24754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816596.1|24823_25468_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	39.3	9.7e-31
WP_142816597.1|25484_25706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094887923.1|26130_26556_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	33.6	6.4e-15
>prophage 4
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	33124	39736	125113		unidentified_phage(25.0%)	7	NA	NA
WP_142816605.1|33124_33922_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	37.8	1.9e-15
WP_142816606.1|34659_35031_+	dehydrogenase	NA	NA	NA	NA	NA
WP_042785947.1|35087_35915_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.7	1.2e-46
WP_142816607.1|36016_36313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816608.1|36598_37075_-	transglycosylase SLT domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	33.7	8.8e-05
WP_142816609.1|37495_37891_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_142816610.1|38020_39736_-	response regulator	NA	A0A1V0SGX0	Hokovirus	25.0	1.4e-23
>prophage 5
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	48415	104255	125113	transposase,protease	Escherichia_phage(50.0%)	47	NA	NA
WP_142816677.1|48415_48586_+|protease	Clp protease	protease	NA	NA	NA	NA
WP_142816621.1|48582_49071_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_142816622.1|51950_52208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816623.1|52204_52552_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_142816624.1|52548_53205_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_142816625.1|53197_54205_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_142816626.1|54219_54849_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_142816627.1|54845_56723_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_142816628.1|56731_57475_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_142816629.1|57491_57755_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_142816630.1|57744_58311_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_142816678.1|58310_59675_+	F-type conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_142816631.1|59674_62503_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_142816632.1|62511_63027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816633.1|63351_65538_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_142816634.1|65537_70784_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_142816635.1|70785_71523_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_142816636.1|71684_72245_+	DUF1669 domain-containing protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	2.0e-16
WP_142816637.1|72381_72633_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_142816679.1|73059_74007_+	Replication protein	NA	NA	NA	NA	NA
WP_142816638.1|74979_75195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816639.1|75243_76467_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_142816640.1|77679_78201_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	61.5	5.8e-58
WP_072628372.1|78986_79433_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_142816641.1|79991_80687_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	4.1e-43
WP_142816642.1|80793_80985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816643.1|80998_81904_-	fimbrial protein	NA	NA	NA	NA	NA
WP_142816644.1|81921_82428_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_142816680.1|82441_82969_-	fimbrial protein	NA	NA	NA	NA	NA
WP_142816645.1|82981_85609_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_142816646.1|85676_86381_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_142816647.1|86414_86954_-	fimbrial protein	NA	NA	NA	NA	NA
WP_142816648.1|87027_87588_-	fimbrial protein	NA	NA	NA	NA	NA
WP_142816649.1|89222_90146_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142816641.1|90274_90970_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	4.1e-43
WP_142816650.1|92432_93173_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_142816651.1|93467_93632_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142816681.1|95588_96134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816652.1|96485_96968_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_142816653.1|97030_97513_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_142816654.1|98551_99265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142816655.1|99517_100215_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.1	2.3e-62
WP_142816656.1|100502_100763_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	52.9	2.2e-05
WP_142816641.1|101043_101739_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	4.1e-43
WP_142816657.1|102864_103056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089186945.1|103109_103403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142816658.1|103403_104255_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	30.6	4.9e-14
>prophage 6
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	108943	109231	125113		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_125460859.1|108943_109231_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	2.6e-20
>prophage 7
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	113607	116334	125113		Synechococcus_phage(50.0%)	3	NA	NA
WP_142816666.1|113607_114339_+	hypothetical protein	NA	A0A1D8KLN2	Synechococcus_phage	27.0	5.0e-15
WP_142816667.1|114378_115554_-	MFS transporter	NA	NA	NA	NA	NA
WP_142816668.1|115755_116334_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.1	1.7e-26
>prophage 8
NZ_CP033895	Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence	125113	119868	120978	125113		Mycobacterium_phage(100.0%)	1	NA	NA
WP_142816670.1|119868_120978_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	58.9	9.0e-101
