The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035503	Rhodoferax sp. CHu59-6-5 chromosome, complete genome	4387497	284997	293512	4387497		Acinetobacter_phage(50.0%)	8	NA	NA
WP_142817233.1|284997_286578_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	29.1	7.2e-35
WP_142817235.1|286581_287166_+	C26 family cysteine hydrolase domain-containing family	NA	A0A0P0IKJ1	Acinetobacter_phage	61.1	7.1e-65
WP_142817237.1|287226_288417_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_142817238.1|288429_289107_+	LysE family transporter	NA	NA	NA	NA	NA
WP_142817240.1|289149_290193_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	45.7	5.0e-77
WP_142817242.1|290200_290992_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.3	1.6e-59
WP_142817244.1|291069_291846_+	uracil-DNA glycosylase	NA	A0A286RUF9	Beluga_whale_alphaherpesvirus	45.7	1.9e-44
WP_142817246.1|292321_293512_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.8	2.8e-15
>prophage 2
NZ_CP035503	Rhodoferax sp. CHu59-6-5 chromosome, complete genome	4387497	714004	748446	4387497	transposase,integrase	Caulobacter_phage(37.5%)	29	746412:746449	749807:749844
WP_142817632.1|714004_715191_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	9.1e-51
WP_142817633.1|715251_715950_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	42.2	1.1e-43
WP_142817634.1|715951_716185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817635.1|716201_716999_-	hypothetical protein	NA	K4K650	Caulobacter_phage	40.1	1.0e-45
WP_142817636.1|716995_717793_-	metallophosphoesterase	NA	K4K650	Caulobacter_phage	36.5	2.2e-40
WP_142821071.1|717800_718607_-	hypothetical protein	NA	K4K650	Caulobacter_phage	37.8	1.3e-35
WP_142817637.1|718603_719362_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_142817638.1|719361_719835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817639.1|719834_720290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817640.1|720286_720841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817641.1|720862_722176_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_142817642.1|722309_722684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817643.1|723250_724264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817644.1|724266_726783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817645.1|727338_728832_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_142817646.1|728828_729653_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.5	7.0e-34
WP_142817647.1|729739_730879_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_142817648.1|731536_734014_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_142817649.1|734662_735058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168226692.1|735047_736253_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_168226693.1|736227_736479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817651.1|736606_736921_+	killer suppression protein HigA	NA	NA	NA	NA	NA
WP_142821072.1|736926_738036_+	helix-turn-helix domain-containing protein	NA	A0A075BTZ7	Microcystis_phage	40.5	8.6e-11
WP_142821073.1|738943_740683_-	NTPase KAP	NA	NA	NA	NA	NA
WP_142817652.1|741096_741720_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	34.4	8.8e-13
WP_142817653.1|741981_744555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142817654.1|744499_745951_+	hypothetical protein	NA	NA	NA	NA	NA
746412:746449	attL	TTATGTCCAGTTGGCGATTATGTGGAGTCGCCGCCAGC	NA	NA	NA	NA
WP_142817655.1|746494_747505_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_142817656.1|747501_748446_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
749807:749844	attR	GCTGGCGGCGACTCCACATAATCGCCAACTGGACATAA	NA	NA	NA	NA
>prophage 3
NZ_CP035503	Rhodoferax sp. CHu59-6-5 chromosome, complete genome	4387497	3126740	3196874	4387497	transposase,holin,integrase	Klosneuvirus(14.29%)	60	3129300:3129315	3202242:3202257
WP_142819914.1|3126740_3128360_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	30.1	1.6e-53
WP_168226752.1|3128405_3129680_-	MFS transporter	NA	NA	NA	NA	NA
3129300:3129315	attL	GCTGGCGCGCGACGCG	NA	NA	NA	NA
WP_142819916.1|3129663_3130914_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_142819917.1|3130916_3132011_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_142819918.1|3132023_3133523_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_142819919.1|3133557_3134532_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142819920.1|3134554_3135040_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_142819921.1|3135036_3136278_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_142819922.1|3136327_3137782_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	28.0	1.3e-09
WP_142819923.1|3137826_3138618_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168226753.1|3138614_3140219_-|holin	choline dehydrogenase	holin	A0A2I2L3D3	Orpheovirus	27.2	8.9e-33
WP_142819925.1|3140237_3141188_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_142819926.1|3141205_3142657_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_142819927.1|3142684_3144136_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_142821326.1|3144256_3145507_-	MFS transporter	NA	NA	NA	NA	NA
WP_142819928.1|3145737_3146538_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_142821328.1|3146534_3147587_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142819929.1|3147619_3148501_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.3	7.0e-32
WP_142819930.1|3148674_3149031_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_142819931.1|3149027_3149363_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_142819932.1|3149403_3150297_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_142819933.1|3150908_3151646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142819934.1|3151642_3152557_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_142819935.1|3152635_3152941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142819936.1|3153133_3153466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168226754.1|3153462_3153627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168226755.1|3154772_3156872_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_142819938.1|3157037_3157775_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_142819939.1|3157782_3158769_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_142821330.1|3158781_3159945_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_142819940.1|3160023_3160995_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142819941.1|3161061_3162030_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142819942.1|3162124_3163291_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_142819943.1|3163459_3164257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142819944.1|3164275_3165058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142819945.1|3165982_3166849_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_142819946.1|3167015_3168017_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_142819947.1|3168018_3168768_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	1.3e-10
WP_142821331.1|3168903_3171114_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_142819948.1|3171110_3172226_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_142819949.1|3172257_3173049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168226756.1|3173112_3174093_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142821333.1|3174101_3174644_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_142819951.1|3174764_3175100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142821335.1|3175278_3176103_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142819952.1|3177321_3177510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142819953.1|3177600_3178323_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_142819954.1|3180055_3180922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142819955.1|3181044_3181836_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_142819956.1|3181865_3182975_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_168226757.1|3183011_3183992_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142819958.1|3184033_3185263_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_142819959.1|3185275_3186505_+	CoA transferase	NA	NA	NA	NA	NA
WP_142819960.1|3186581_3187247_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_142819961.1|3188028_3189504_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	56.6	8.2e-150
WP_142819963.1|3190844_3192083_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	48.5	1.8e-102
WP_142819964.1|3192262_3192811_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_142819965.1|3193186_3193465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142819966.1|3193461_3194505_-	PRTRC system protein D	NA	NA	NA	NA	NA
WP_142819967.1|3195713_3196874_+|integrase	integrase	integrase	NA	NA	NA	NA
3202242:3202257	attR	CGCGTCGCGCGCCAGC	NA	NA	NA	NA
>prophage 4
NZ_CP035503	Rhodoferax sp. CHu59-6-5 chromosome, complete genome	4387497	3295936	3348224	4387497	transposase,holin,integrase	Catovirus(25.0%)	46	3341376:3341393	3353334:3353351
WP_142820045.1|3295936_3297619_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.0	6.2e-53
WP_142820046.1|3297672_3298482_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_142820047.1|3298492_3299482_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142820048.1|3299478_3300093_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_142820049.1|3300023_3300374_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_142820050.1|3300493_3301843_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_142820051.1|3301854_3303237_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_168226764.1|3303445_3304804_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_142820053.1|3304916_3305900_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142820054.1|3305998_3306844_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_142820055.1|3306884_3308354_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_142820056.1|3308361_3310275_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_142820057.1|3311043_3311796_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.1	8.7e-07
WP_142820058.1|3311839_3313045_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142821353.1|3313322_3314399_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_142820059.1|3314602_3315565_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_142820060.1|3315587_3316520_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142820061.1|3316531_3317890_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_142820062.1|3318149_3318374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168226765.1|3318592_3318922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142820064.1|3318935_3319907_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_168226766.1|3321474_3322635_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_142820066.1|3322640_3323552_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_142820067.1|3323710_3324769_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_142820068.1|3324782_3325532_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.1	1.1e-09
WP_142820069.1|3325506_3327303_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.7	5.1e-13
WP_142820070.1|3327299_3328223_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_142820071.1|3328229_3329420_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_142820072.1|3329734_3330667_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142820073.1|3330727_3331276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142820075.1|3331707_3333696_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	31.5	6.1e-23
WP_142820076.1|3333705_3334731_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_142821354.1|3334831_3336550_+	carboxylesterase family protein	NA	M1PNU1	Moumouvirus	32.8	3.4e-30
WP_142820077.1|3336584_3336884_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_142821356.1|3336958_3337375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168226767.1|3337498_3337813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142821358.1|3337727_3339416_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.7	8.1e-53
WP_142820079.1|3339432_3340134_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_142820080.1|3340144_3340908_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3341376:3341393	attL	GTATGCGTTCCGCGAACC	NA	NA	NA	NA
WP_142820081.1|3341456_3341804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142820082.1|3341800_3342142_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_142820083.1|3342232_3343582_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	44.0	5.7e-73
WP_142820084.1|3343594_3345667_-	recombinase family protein	NA	NA	NA	NA	NA
WP_168226768.1|3345653_3345863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142817655.1|3346272_3347283_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_142817656.1|3347279_3348224_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3353334:3353351	attR	GGTTCGCGGAACGCATAC	NA	NA	NA	NA
>prophage 5
NZ_CP035503	Rhodoferax sp. CHu59-6-5 chromosome, complete genome	4387497	3925761	3933226	4387497		Escherichia_phage(42.86%)	7	NA	NA
WP_142820642.1|3925761_3926868_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.3	6.6e-11
WP_142820643.1|3927071_3927614_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	60.7	6.6e-57
WP_142820644.1|3927633_3928767_-	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	40.2	2.3e-67
WP_142820645.1|3928763_3930191_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	26.8	5.1e-48
WP_142820646.1|3930187_3931087_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.6	3.4e-98
WP_142820647.1|3931246_3932149_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	8.2e-28
WP_142820648.1|3932155_3933226_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.1	8.7e-85
