The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	63028	112187	6527298	transposase,plate	Clostridioides_phage(25.0%)	49	NA	NA
WP_034081097.1|63028_63721_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105446728.1|63773_64301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081095.1|64344_64566_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_034081094.1|64722_65424_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071535402.1|65508_65826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081093.1|66544_67798_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_132519268.1|67794_68181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154010.1|68280_68967_+	lipoprotein	NA	NA	NA	NA	NA
WP_003154012.1|68997_69351_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_034081092.1|69347_70013_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003154016.1|70027_70444_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034081091.1|70819_72481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011979075.1|73015_73444_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011979076.1|73707_74256_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.0	1.8e-33
WP_011979077.1|74294_74801_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_034081090.1|74866_75787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033997725.1|75894_76782_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_034081089.1|76845_77547_+	DsbA family protein	NA	NA	NA	NA	NA
WP_079383539.1|77630_78086_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003157864.1|78196_78430_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_034081087.1|78442_78880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034081086.1|78936_79353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052151112.1|79444_80572_+	aminopeptidase	NA	NA	NA	NA	NA
WP_034081081.1|80579_81563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011979083.1|81595_82261_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_034081080.1|82253_82796_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_034081079.1|82873_84919_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.2	2.3e-33
WP_011979086.1|84915_85191_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_034081078.1|85279_86338_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011979121.1|86451_87366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034081076.1|87427_89140_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_034081075.1|89132_90332_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_079383535.1|90331_91051_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.3e-19
WP_034081073.1|91047_94143_-	protein kinase	NA	M1PCM5	Moumouvirus	27.4	1.2e-22
WP_003157819.1|94150_94879_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_034081072.1|94888_95569_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_003157821.1|95565_99096_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011979128.1|99092_100442_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_011979129.1|100448_101783_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011979130.1|101799_102264_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_034081070.1|102308_103787_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_034081069.1|104154_105186_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011979134.1|105274_105793_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003151425.1|105805_107302_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003151423.1|107377_107866_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_034081068.1|108024_108810_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003151421.1|108811_109321_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_033998060.1|109317_111177_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011979137.1|111140_112187_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	604008	688378	6527298	tRNA,tail,transposase,plate,holin	Pseudomonas_phage(22.22%)	84	NA	NA
WP_079383473.1|604008_604863_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.4	2.2e-78
WP_034079686.1|604859_605144_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	3.6e-14
WP_031636674.1|605582_607268_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	99.8	0.0e+00
WP_034079687.1|608348_612086_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	1.6e-13
WP_012074163.1|612192_614046_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_012074165.1|614125_616117_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.0	3.2e-72
WP_003085042.1|616199_616649_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|616716_616932_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_034079688.1|617132_618158_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.8e-108
WP_012074167.1|618237_618807_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003149641.1|618890_619244_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_034079689.1|619234_619777_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012074168.1|619749_620982_-	multifunctional CCA addition/repair protein	NA	A0A1V0E714	Klebsiella_phage	43.0	5.3e-78
WP_012074169.1|621024_621531_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_012074170.1|621625_623179_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_012074171.1|623175_624447_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_034079690.1|624547_626470_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_142821757.1|626422_626665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003149627.1|626749_627082_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_012074174.1|627125_627977_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	30.9	9.6e-10
WP_033999511.1|627976_628357_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_012074176.1|628393_629200_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_012074177.1|629315_630302_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_034079691.1|630298_631591_-	molecular chaperone SurA	NA	NA	NA	NA	NA
WP_034079692.1|631571_634352_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|634484_636197_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_071534477.1|636384_636597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034079693.1|637469_638486_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012074181.1|638482_639157_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_012074182.1|639158_639917_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_034079694.1|639917_640970_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_034079695.1|641121_643521_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003152151.1|643566_644196_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012074186.1|644324_645359_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012074187.1|645590_646700_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	1.0e-27
WP_012074188.1|646755_647802_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012074189.1|647913_649161_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152154.1|649237_650068_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012074190.1|650191_650866_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_033999495.1|650865_651684_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003152157.1|651756_653235_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003152158.1|653520_653835_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_034079696.1|653935_654706_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.5	3.0e-71
WP_034079697.1|655163_655364_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	46.8	8.8e-07
WP_034079698.1|655409_655769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079383476.1|656150_656579_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.7	4.8e-26
WP_034079699.1|656600_657116_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	46.3	3.0e-35
WP_034079700.1|657112_657670_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	53.7	5.4e-46
WP_034079701.1|657822_658149_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	58.3	1.6e-29
WP_034079702.1|658145_659033_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	59.3	5.3e-88
WP_034079703.1|659025_659559_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	65.7	1.6e-63
WP_034079704.1|659560_661669_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	2.9e-225
WP_034079705.1|661677_662118_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_034079706.1|662160_663321_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	5.9e-188
WP_004366803.1|663333_663837_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	71.6	6.1e-65
WP_004366805.1|663851_664196_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034079707.1|664368_666633_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_034079708.1|666642_667512_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.6	1.2e-76
WP_004366813.1|667486_667693_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	5.6e-17
WP_004366815.1|667750_668746_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	58.2	3.1e-108
WP_034079709.1|668770_669400_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	77.0	1.9e-84
WP_034079723.1|669396_669759_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	50.0	4.2e-15
WP_033999480.1|669755_670013_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	68.3	5.2e-20
WP_071537122.1|669970_670159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150133.1|670363_670969_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	1.9e-73
WP_012074210.1|670970_672020_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	2.4e-111
WP_003150132.1|672016_672853_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.2e-70
WP_003085214.1|672914_673559_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|673830_674253_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003150131.1|674572_675367_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_012074213.1|675431_676079_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_034079710.1|676182_676521_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003150128.1|676596_678078_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.9	5.1e-67
WP_034079711.1|678089_678890_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034079712.1|678950_680018_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_034079713.1|680139_681108_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003150125.1|681123_681546_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_034079714.1|681835_682870_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_034079715.1|682869_683589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079383474.1|683589_684012_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|684089_684440_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_034079716.1|684489_685581_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_079383477.1|685583_686894_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	45.0	1.0e-18
WP_003150121.1|687178_688378_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	1455996	1465019	6527298		Bacillus_phage(33.33%)	9	NA	NA
WP_074197311.1|1455996_1456632_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.7	3.0e-40
WP_034080332.1|1456677_1457571_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_034080333.1|1457671_1458676_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	1.2e-35
WP_003092272.1|1459101_1459425_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079383494.1|1459491_1462059_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.0	7.1e-24
WP_079383495.1|1462038_1462203_+	TolB-like translocation protein	NA	NA	NA	NA	NA
WP_034080334.1|1462184_1463192_-	TolB family protein	NA	NA	NA	NA	NA
WP_003152358.1|1463338_1463845_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	73.4	9.9e-55
WP_003092260.1|1463978_1465019_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	2642030	2648922	6527298	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_034082492.1|2642030_2643311_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	4.1e-97
WP_012075462.1|2643312_2644710_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003153618.1|2644714_2645689_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_034082489.1|2645774_2646758_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	3.2e-142
WP_003153616.1|2646754_2647090_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.9e-38
WP_033996668.1|2647086_2647392_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003153613.1|2647391_2647751_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	3.1e-34
WP_003153611.1|2647747_2648143_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	7.7e-47
WP_003153609.1|2648253_2648922_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	81.6	3.3e-90
>prophage 5
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	3606809	3662994	6527298	protease,tRNA,integrase,head,terminase	Pseudomonas_phage(70.42%)	77	3606604:3606663	3655582:3655642
3606604:3606663	attL	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATC	NA	NA	NA	NA
WP_034005423.1|3606809_3607073_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	90.8	1.1e-36
WP_034005425.1|3607069_3607438_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	76.2	5.9e-41
WP_034013816.1|3607434_3607869_-	lysozyme	NA	A0A127KNA7	Pseudomonas_phage	100.0	5.1e-76
WP_079383489.1|3607965_3610023_-	structural protein	NA	A0A127KNR5	Pseudomonas_phage	88.8	0.0e+00
WP_034080104.1|3610083_3612813_-	hypothetical protein	NA	H2BD95	Pseudomonas_phage	97.6	0.0e+00
WP_034080105.1|3612784_3613192_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	98.5	1.7e-73
WP_034080106.1|3613196_3613688_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	90.7	1.6e-81
WP_016852774.1|3613671_3614139_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	99.4	1.4e-92
WP_034080107.1|3614135_3616637_-	tape measure protein	NA	A0A127KNB7	Pseudomonas_phage	97.7	0.0e+00
WP_034080108.1|3616636_3617254_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	99.0	6.3e-112
WP_034080109.1|3617250_3618246_-	Ig domain-containing protein	NA	H2BD89	Pseudomonas_phage	95.5	2.7e-165
WP_034080111.1|3618260_3618635_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	96.0	2.0e-65
WP_034080112.1|3618631_3619036_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	98.5	5.3e-67
WP_034080114.1|3619037_3619358_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	96.2	5.6e-56
WP_033966860.1|3619354_3619756_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.7	5.0e-70
WP_014603767.1|3619840_3620032_-	hypothetical protein	NA	H2BD83	Pseudomonas_phage	100.0	2.0e-29
WP_023434426.1|3620041_3621136_-	hypothetical protein	NA	H2BD82	Pseudomonas_phage	99.7	1.3e-208
WP_023098990.1|3621151_3621601_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	100.0	5.6e-78
WP_034080115.1|3621604_3622882_-	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.1	1.5e-213
WP_031631177.1|3622885_3623815_-|head	SPP1 gp7 family phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	98.4	1.7e-169
WP_034080117.1|3623771_3625142_-	DUF1073 domain-containing protein	NA	A0A125RNL9	Pseudomonas_phage	98.7	4.2e-265
WP_014603761.1|3625144_3625342_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
WP_014603760.1|3625341_3626805_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	83.5	1.5e-241
WP_044719990.1|3626794_3627379_-|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
WP_014603758.1|3627369_3627642_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
WP_023434898.1|3627644_3627977_-	peptidase M48	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
WP_034080118.1|3628368_3629055_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	93.4	2.3e-123
WP_033949578.1|3629125_3629443_-	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	92.4	2.0e-45
WP_034080119.1|3629442_3630084_-	phage protein	NA	Q9MC46	Pseudomonas_phage	92.0	5.2e-109
WP_079383490.1|3630080_3630347_-	hypothetical protein	NA	H2BDI6	Pseudomonas_virus	79.1	1.9e-33
WP_023127359.1|3630442_3630706_-	hypothetical protein	NA	A0A125RNK6	Pseudomonas_phage	95.4	4.5e-43
WP_034080121.1|3630702_3631104_-	NinB family protein	NA	A0A059VG13	Pseudomonas_phage	53.6	9.9e-34
WP_034080122.1|3631096_3631312_-	hypothetical protein	NA	A0A125RNK4	Pseudomonas_phage	93.0	1.2e-33
WP_142821790.1|3631486_3632443_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	60.3	1.6e-106
WP_034080124.1|3632391_3633882_-	DEAD/DEAH box helicase	NA	A0A0H5ARP5	Pseudomonas_phage	67.6	1.1e-194
WP_023125074.1|3634610_3634814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125075.1|3634833_3635034_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	64.6	1.1e-14
WP_023125076.1|3635047_3635287_-	hypothetical protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	64.6	9.8e-21
WP_052151071.1|3635372_3636149_+	LexA family transcriptional regulator	NA	A0A2H4J0J9	uncultured_Caudovirales_phage	35.5	1.1e-33
WP_049821776.1|3636285_3636774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033936262.1|3637030_3638071_+	ParA family protein	NA	NA	NA	NA	NA
WP_031275055.1|3638474_3638981_+	hypothetical protein	NA	A0A0S2SYL8	Pseudomonas_phage	97.6	7.3e-82
WP_023910167.1|3638989_3639430_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	98.6	1.2e-80
WP_023118145.1|3639922_3640129_+	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	94.1	4.9e-29
WP_003159008.1|3640138_3640345_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	100.0	1.5e-33
WP_077831958.1|3640341_3640551_+	hypothetical protein	NA	A0A2H4J2M2	uncultured_Caudovirales_phage	79.4	2.6e-30
WP_034080125.1|3640635_3641175_+	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	95.5	1.8e-91
WP_003116746.1|3641231_3641603_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	2.5e-63
WP_142821791.1|3642081_3643026_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	83.4	1.6e-74
WP_034078922.1|3643258_3643549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023081933.1|3644050_3644491_+	hypothetical protein	NA	W6MVG2	Pseudomonas_phage	88.4	4.7e-77
WP_034078920.1|3644499_3644865_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	96.7	6.9e-66
WP_142821792.1|3644861_3645371_+	hypothetical protein	NA	A0A125RNR8	Pseudomonas_phage	45.9	4.2e-29
WP_052151035.1|3645367_3645751_+	hypothetical protein	NA	A0A0S2SY04	Pseudomonas_phage	99.2	1.2e-65
WP_079383432.1|3645857_3646043_+	hypothetical protein	NA	A0A0S2SY66	Pseudomonas_phage	100.0	7.3e-24
WP_079383436.1|3646239_3646506_+	hypothetical protein	NA	A0A0F7LBS5	uncultured_marine_virus	38.2	5.4e-12
WP_034078917.1|3646483_3647233_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	59.1	2.6e-75
WP_124166559.1|3647409_3647862_+	hypothetical protein	NA	A0A2I6PHZ0	Pseudomonas_phage	31.9	2.4e-07
WP_034078913.1|3647904_3648651_+	hypothetical protein	NA	H2BDF8	Pseudomonas_virus	99.2	9.6e-131
WP_003124818.1|3648647_3649145_+	siphovirus Gp157 family protein	NA	H2BDF7	Pseudomonas_virus	100.0	6.4e-83
WP_034078909.1|3649152_3649488_+	LytTR family transcriptional regulator	NA	H2BDF6	Pseudomonas_virus	84.7	4.5e-48
WP_003097971.1|3649675_3649888_+	hypothetical protein	NA	H2BDF3	Pseudomonas_virus	78.6	9.9e-25
WP_003140732.1|3649851_3650058_+	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	84.1	1.3e-26
WP_025297378.1|3651401_3651668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052151033.1|3651664_3652315_+	hypothetical protein	NA	D4FUM1	Pseudomonas_phage	43.3	5.2e-24
WP_034078904.1|3652307_3652592_+	hypothetical protein	NA	H2BDE3	Pseudomonas_virus	98.9	1.2e-49
WP_079383431.1|3652815_3653310_+	ead/Ea22-like family protein	NA	J7I0U3	Pseudomonas_phage	51.8	9.4e-42
WP_079383435.1|3653390_3653663_+	hypothetical protein	NA	B5WZV2	Pseudomonas_phage	84.3	3.0e-26
WP_071537486.1|3653659_3654094_+	DUF2591 family protein	NA	A0A125RNP6	Pseudomonas_phage	96.5	3.8e-79
WP_003098018.1|3654240_3654582_+	helix-turn-helix domain-containing protein	NA	Q9MC86	Pseudomonas_phage	100.0	5.4e-49
WP_034078902.1|3654467_3655577_+|integrase	site-specific integrase	integrase	H2BDD9	Pseudomonas_virus	97.8	1.3e-211
WP_012076177.1|3656207_3657062_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
3655582:3655642	attR	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATCC	NA	NA	NA	NA
WP_003153597.1|3657120_3658503_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_034078901.1|3658512_3660183_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.1	1.8e-198
WP_012076179.1|3660305_3660803_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.9e-13
WP_034078899.1|3660807_3661530_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_074197322.1|3661662_3662994_+|protease	membrane protease subunit, stomatin/prohibitin	protease	A0A0F6WCV7	Sinorhizobium_phage	28.1	6.9e-39
>prophage 6
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	4616911	4636068	6527298	plate,holin,tail,tRNA	Haemophilus_phage(50.0%)	21	NA	NA
WP_052151074.1|4616911_4617862_-	FkbM family methyltransferase	NA	A0A0A0V284	uncultured_virus	34.9	1.9e-14
WP_052151075.1|4618015_4618996_-|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	47.0	1.1e-28
WP_034080171.1|4618992_4619646_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	51.6	5.2e-48
WP_034080172.1|4619642_4620788_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	50.3	9.9e-95
WP_034080173.1|4620884_4621238_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	53.6	1.6e-27
WP_034080174.1|4621234_4621876_-	hypothetical protein	NA	D0UIH7	Aggregatibacter_phage	38.8	1.4e-34
WP_034080175.1|4621868_4622711_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	44.3	7.6e-68
WP_034080176.1|4622707_4623025_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.4	3.2e-27
WP_034080177.1|4623021_4623771_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.9	3.9e-31
WP_123809547.1|4623780_4625655_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	35.5	3.5e-20
WP_034080179.1|4625805_4626204_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	48.4	2.7e-23
WP_034080180.1|4626206_4626638_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	60.6	1.0e-44
WP_034080181.1|4626707_4628207_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	52.5	2.1e-137
WP_034080182.1|4628208_4628742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023443062.1|4628833_4629109_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	52.1	2.2e-16
WP_003153528.1|4629101_4629476_-	hypothetical protein	NA	H2BD73	Pseudomonas_phage	52.0	2.1e-25
WP_034080184.1|4629640_4630171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034080185.1|4630342_4631059_+	helix-turn-helix transcriptional regulator	NA	A0A1B0VRI7	Pseudomonas_phage	48.6	6.1e-58
WP_003085981.1|4631687_4631873_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	9.9e-13
WP_003153523.1|4632057_4633296_-	aspartate kinase	NA	NA	NA	NA	NA
WP_034080187.1|4633443_4636068_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.8	1.8e-75
>prophage 7
NZ_CP041354	Pseudomonas aeruginosa strain AZPAE15042 chromosome, complete genome	6527298	5122332	5188446	6527298	protease,tRNA,integrase,tail,head,terminase,capsid	Synechococcus_phage(14.29%)	59	5177727:5177773	5188709:5188755
WP_003106543.1|5122332_5122623_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_079383551.1|5122635_5124090_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_071537175.1|5124163_5125642_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_012077245.1|5125701_5126079_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	61.9	1.2e-20
WP_003154549.1|5126110_5126497_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_052151118.1|5126632_5127424_-	YfaP family protein	NA	A0A0K1YAD9	Cronobacter_phage	50.0	1.3e-05
WP_079383550.1|5127428_5129078_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_033998176.1|5129074_5133625_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_003152479.1|5133651_5134290_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_034081363.1|5134286_5136056_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_012077250.1|5136095_5136905_-	YfaP family protein	NA	NA	NA	NA	NA
WP_003094419.1|5137066_5137627_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012077251.1|5137652_5138921_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003157828.1|5139198_5139909_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_034081362.1|5140162_5141776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_034081361.1|5141869_5143468_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_034081360.1|5143525_5144743_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012077255.1|5144911_5145475_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012077256.1|5145739_5147341_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010895675.1|5147566_5149021_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_034081359.1|5149070_5150666_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_034081357.1|5150733_5151744_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004347993.1|5151755_5152667_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003094451.1|5152719_5153694_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.8	2.3e-15
WP_003153098.1|5153693_5154665_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	8.3e-18
WP_012077258.1|5154698_5155331_-	LysE family translocator	NA	NA	NA	NA	NA
WP_003094456.1|5155472_5155946_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079383549.1|5155950_5156880_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_034081355.1|5156876_5157554_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_034081354.1|5157550_5158306_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_012077262.1|5158435_5159335_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.2	5.3e-35
WP_034081353.1|5159589_5162142_-	flavodoxin	NA	NA	NA	NA	NA
WP_034081352.1|5162360_5164661_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_034081372.1|5164879_5165560_+	Fe2+-dependent dioxygenase	NA	A0A127KMW2	Cyanophage	27.2	1.1e-16
WP_034081351.1|5165562_5166378_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_034081350.1|5166498_5168301_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_052151119.1|5168393_5168765_-	glyoxalase	NA	NA	NA	NA	NA
WP_034081349.1|5168900_5170064_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_071537171.1|5170136_5170319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081347.1|5170534_5172556_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.2	1.6e-34
WP_034081345.1|5172744_5173581_-	regulatory signaling modulator protein AmpE	NA	NA	NA	NA	NA
WP_003152756.1|5173577_5174144_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	31.9	1.8e-12
WP_034081343.1|5174293_5176543_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_003152758.1|5176828_5177677_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
5177727:5177773	attL	ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA	NA	NA	NA	NA
WP_034081342.1|5177897_5179112_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	42.9	1.5e-27
WP_034081341.1|5179104_5179710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077278.1|5179853_5180054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034081340.1|5180175_5180445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052151117.1|5180441_5180744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077281.1|5180831_5181068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081338.1|5181121_5181523_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034081337.1|5181784_5182003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081335.1|5182540_5183770_+|capsid	phage major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	36.2	2.8e-42
WP_034081334.1|5183772_5184282_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	51.4	1.2e-31
WP_034081333.1|5185513_5185900_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.8	3.3e-10
WP_034081332.1|5185905_5186370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081331.1|5186366_5187863_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	65.4	2.8e-182
WP_012077290.1|5187859_5188135_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_034081329.1|5188131_5188446_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	30.2	3.6e-07
5188709:5188755	attR	ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA	NA	NA	NA	NA
>prophage 1
NZ_CP041355	Pseudomonas aeruginosa strain AZPAE15042 plasmid pIHMA87, complete sequence	185168	127536	135918	185168		Pseudomonas_virus(16.67%)	10	NA	NA
WP_003149178.1|127536_129273_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	65.0	1.6e-197
WP_003149180.1|129276_130143_-	hypothetical protein	NA	A0A291L9X9	Bordetella_phage	44.9	1.7e-14
WP_023980655.1|130158_130932_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	35.1	2.8e-24
WP_130202099.1|131182_131746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003149187.1|131742_132150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023442598.1|132175_132505_-	hypothetical protein	NA	Q9MC61	Pseudomonas_phage	45.9	1.2e-05
WP_003149190.1|132497_132941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003149194.1|133967_134258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003149196.1|134254_134746_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	47.8	7.9e-17
WP_023442599.1|134763_135918_-	phage Gp37/Gp68 family protein	NA	R9TNA8	Rhizobium_phage	45.2	5.9e-79
