The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	235861	249110	4130958	terminase,portal	Riemerella_phage(28.57%)	15	NA	NA
WP_142783359.1|235861_238015_-	DUF559 domain-containing protein	NA	F5A3C5	Riemerella_phage	34.6	4.7e-29
WP_142783360.1|238020_238260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783361.1|238261_238597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783362.1|238586_238799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783363.1|239161_239347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783364.1|239394_240771_-|portal	phage portal protein	portal	F5A3C6	Riemerella_phage	28.0	9.0e-34
WP_142783365.1|240801_242382_-	hypothetical protein	NA	K4F6Z3	Cronobacter_phage	40.0	2.4e-54
WP_142783366.1|242308_242833_-|terminase	terminase small subunit	terminase	A0A2I7RB14	Vibrio_phage	40.4	5.7e-21
WP_142783367.1|242874_243060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783368.1|243114_243342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783369.1|243402_243828_-	hypothetical protein	NA	D5L2H4	uncultured_virus	63.6	1.1e-17
WP_142783370.1|243830_245321_-	replicative DNA helicase	NA	S0A403	Cellulophaga_phage	40.7	1.2e-84
WP_142783371.1|245322_246126_-	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_142783372.1|246129_246567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783373.1|246566_249110_-	DNA methylase N-4	NA	A0A0A0YNQ8	Flavobacterium_phage	63.6	0.0e+00
>prophage 2
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	626721	679268	4130958	transposase,protease,integrase	Lactococcus_phage(25.0%)	57	626050:626068	684208:684226
626050:626068	attL	GCAGGATTCGAACCTGCGA	NA	NA	NA	NA
WP_142783710.1|626721_627612_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.3	1.3e-25
WP_142783711.1|627792_627987_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_142783712.1|628071_629463_-	alpha-amylase	NA	NA	NA	NA	NA
WP_142783713.1|629735_630902_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_142783714.1|630949_631840_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142783715.1|631890_633537_-	amino acid carrier protein	NA	NA	NA	NA	NA
WP_142783716.1|633645_634680_-	potassium channel protein	NA	NA	NA	NA	NA
WP_142783718.1|634669_634897_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_142783719.1|634914_636186_-	DUF2851 family protein	NA	NA	NA	NA	NA
WP_142783721.1|636292_636703_+	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_142783722.1|636783_637296_+	glyoxalase	NA	NA	NA	NA	NA
WP_142783723.1|637499_638264_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	28.5	2.8e-21
WP_142783725.1|638268_639177_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	40.0	3.9e-17
WP_142786521.1|639220_639781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142783727.1|639782_640484_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_142783729.1|640504_640861_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_142783731.1|640898_642488_+	signal peptidase I	NA	NA	NA	NA	NA
WP_142786522.1|642648_643302_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_142783732.1|643301_643928_+	WbqC family protein	NA	NA	NA	NA	NA
WP_142783733.1|643924_644233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142783734.1|644281_645304_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_142783735.1|645309_646155_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_142783736.1|646151_646883_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_142783737.1|646886_648737_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.4	2.4e-58
WP_142783738.1|648741_649029_-	riboflavin synthase subunit beta	NA	NA	NA	NA	NA
WP_142783739.1|649456_649942_-	6,7-dimethyl-8-ribityllumazine synthase	NA	NA	NA	NA	NA
WP_142783740.1|649943_650714_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_142783741.1|650854_651934_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_142783742.1|651940_652237_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_034044451.1|652336_652528_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	48.4	2.0e-08
WP_072402704.1|652654_652846_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	48.4	2.0e-08
WP_142783743.1|653001_653193_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	48.4	5.8e-08
WP_142783744.1|653270_653690_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	34.8	1.5e-08
WP_142783745.1|653861_654881_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_142783746.1|654873_655419_+	gliding motility-associated peptidyl-prolyl isomerase GldI	NA	NA	NA	NA	NA
WP_142783747.1|655420_656548_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.8	5.3e-24
WP_142783748.1|656603_657536_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_142786523.1|657558_658038_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_142783749.1|658269_659505_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_142783750.1|660280_660688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142783751.1|660812_661688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142783752.1|661698_662040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142786524.1|662127_663669_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_142783753.1|663766_664792_-	mobilization protein	NA	NA	NA	NA	NA
WP_142783754.1|664840_665398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783755.1|665985_666183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783756.1|666200_666650_-	DNA repair protein	NA	NA	NA	NA	NA
WP_142783757.1|666731_667067_-	single-stranded DNA-binding protein	NA	A0A2I6UG15	Salinibacter_virus	36.5	2.1e-16
WP_142783758.1|668050_668434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783759.1|668582_669689_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.4	1.3e-22
WP_142783760.1|669800_671531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142783761.1|671628_672405_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_142783376.1|672505_673786_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142783762.1|674422_675253_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	37.1	1.3e-43
WP_142783376.1|675346_676627_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142786525.1|677320_677836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142783763.1|678119_679268_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
684208:684226	attR	GCAGGATTCGAACCTGCGA	NA	NA	NA	NA
>prophage 3
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	1570850	1580472	4130958		Escherichia_phage(37.5%)	8	NA	NA
WP_142784481.1|1570850_1571996_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.2	3.6e-12
WP_142784482.1|1571995_1573015_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	35.0	1.9e-41
WP_142784483.1|1574824_1575937_-	NAD-dependent epimerase/dehydratase family protein	NA	M1HKX0	Paramecium_bursaria_Chlorella_virus	49.3	5.9e-92
WP_142784484.1|1576029_1577148_-	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	61.7	4.8e-126
WP_142784485.1|1577160_1577988_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.9	6.0e-33
WP_142784486.1|1577998_1578547_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	45.1	7.7e-37
WP_142784487.1|1578551_1579409_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	61.8	6.7e-96
WP_142784488.1|1579425_1580472_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	48.7	3.6e-83
>prophage 4
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	1778950	1837769	4130958	transposase,protease,integrase	Leptospira_phage(50.0%)	59	1788313:1788335	1824716:1824738
WP_142784028.1|1778950_1779982_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.1	2.6e-41
WP_142784639.1|1780346_1780769_+	OsmC family protein	NA	NA	NA	NA	NA
WP_142784640.1|1780798_1782493_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A218KBX3	Bacillus_phage	28.1	4.8e-45
WP_142784641.1|1782496_1783765_+	MFS transporter	NA	NA	NA	NA	NA
WP_142784642.1|1783761_1784514_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_142784643.1|1784734_1785187_-	6-carboxytetrahydropterin synthase	NA	A0A1U9WRB3	Streptococcus_virus	32.9	2.9e-13
WP_142784644.1|1785502_1786837_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_142784645.1|1786833_1787334_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142784646.1|1787391_1788186_+	universal stress protein	NA	NA	NA	NA	NA
1788313:1788335	attL	AATTTGCACGCAATTTGCACGCA	NA	NA	NA	NA
WP_142784647.1|1788485_1789790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142784648.1|1789947_1792350_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_142784649.1|1792453_1794100_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_142784650.1|1794105_1795110_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_142784651.1|1795118_1797185_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_142784652.1|1797181_1798852_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_142784653.1|1798875_1799190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784654.1|1799282_1800140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784655.1|1800150_1801431_+	permease	NA	NA	NA	NA	NA
WP_142784656.1|1801431_1802616_+	proline dehydrogenase	NA	NA	NA	NA	NA
WP_142784657.1|1803170_1803458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142784658.1|1804907_1805768_+	DNA primase	NA	NA	NA	NA	NA
WP_142786573.1|1805958_1806264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784659.1|1806260_1807118_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_142784660.1|1807129_1807444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784661.1|1807740_1808301_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142784662.1|1808412_1808823_+	DUF1348 family protein	NA	NA	NA	NA	NA
WP_142784663.1|1809426_1809981_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_142784664.1|1810010_1810997_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_142784665.1|1811109_1811535_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_142784666.1|1811590_1811803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784667.1|1812567_1813026_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_142784668.1|1813090_1813708_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_142784669.1|1813720_1814716_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_103474586.1|1814739_1814955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784028.1|1814992_1816024_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.1	2.6e-41
WP_142784670.1|1816065_1816359_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_142784671.1|1816640_1817042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784672.1|1817087_1817342_+	serine hydrolase	NA	NA	NA	NA	NA
WP_142784673.1|1817454_1817913_+	RidA family protein	NA	NA	NA	NA	NA
WP_142784674.1|1817916_1818684_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_142784675.1|1818724_1819453_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_142784676.1|1820380_1821307_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_142784677.1|1821299_1821614_-	toxin HipA	NA	NA	NA	NA	NA
WP_142784678.1|1821616_1821826_-	type II toxin-antitoxin system Y4mF family antitoxin	NA	NA	NA	NA	NA
WP_142784679.1|1822335_1823457_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_142784680.1|1823478_1824696_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_142784681.1|1825173_1827720_-	TonB-dependent receptor	NA	NA	NA	NA	NA
1824716:1824738	attR	AATTTGCACGCAATTTGCACGCA	NA	NA	NA	NA
WP_142784682.1|1827706_1828627_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_142784683.1|1828684_1829206_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_142784684.1|1829401_1830460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784685.1|1830544_1831321_+|protease	membrane metalloprotease	protease	NA	NA	NA	NA
WP_142784686.1|1831451_1831904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784687.1|1832544_1833465_+	DUF4350 domain-containing protein	NA	NA	NA	NA	NA
WP_142784688.1|1833457_1834384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784689.1|1834399_1834798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142784690.1|1834834_1835467_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_142784691.1|1835582_1836416_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_142784692.1|1836427_1836814_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_142783597.1|1836851_1837769_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	2497040	2529246	4130958	transposase,integrase	unidentified_phage(20.0%)	32	2489748:2489794	2533057:2533103
2489748:2489794	attL	GAACCGCCGTATACGAGACCCGTACGTACGGTGGTGTGAGAGGCGCA	NA	NA	NA	NA
WP_142783597.1|2497040_2497958_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_142785195.1|2497995_2498367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785196.1|2498370_2498907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785197.1|2499003_2499621_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_142785198.1|2499684_2500296_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_142786602.1|2500368_2501133_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_142786603.1|2501429_2501900_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_142785199.1|2501874_2502783_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_142785200.1|2502783_2503107_+	S-adenosyl-methyltransferase	NA	NA	NA	NA	NA
WP_142786604.1|2503165_2505124_+	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_142785201.1|2505120_2506584_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_142785202.1|2506605_2507841_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_142786605.1|2507937_2509269_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_142785203.1|2509366_2510560_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_142785204.1|2510687_2511041_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_142786606.1|2511077_2512157_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_142785205.1|2512153_2513506_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_142785206.1|2513495_2514215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142785207.1|2514218_2515526_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_142785208.1|2515591_2517568_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_142785209.1|2517706_2518156_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_142785210.1|2518533_2519805_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	38.6	6.8e-36
WP_142785211.1|2520238_2520523_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	45.3	1.5e-12
WP_142785212.1|2520526_2520826_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	45.4	6.3e-17
WP_142785213.1|2521078_2521951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785214.1|2522049_2522841_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_142785215.1|2522993_2523674_-	response regulator	NA	NA	NA	NA	NA
WP_142785216.1|2523670_2524699_-	hypothetical protein	NA	Q9EYF3	Enterobacteria_phage	32.7	9.8e-09
WP_142785217.1|2525092_2525560_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_142783871.1|2525655_2526951_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_142785218.1|2527237_2528107_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	3.9e-27
WP_142785219.1|2528106_2529246_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2533057:2533103	attR	TGCGCCTCTCACACCACCGTACGTACGGGTCTCGTATACGGCGGTTC	NA	NA	NA	NA
>prophage 6
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	3093669	3139418	4130958	transposase,protease,integrase	unidentified_phage(22.22%)	40	3132949:3132968	3138111:3138130
WP_142785678.1|3093669_3094485_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_142785679.1|3094573_3095869_+	MFS transporter	NA	NA	NA	NA	NA
WP_142785680.1|3096053_3096767_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_142786635.1|3096792_3097839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785681.1|3097858_3098416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785682.1|3098423_3098990_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_142785683.1|3099107_3101657_-	AAA domain-containing protein	NA	H6X3M6	Enterobacteria_phage	34.9	9.2e-125
WP_142785684.1|3101917_3104452_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	2.9e-110
WP_142785685.1|3104468_3105722_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_142785686.1|3105769_3106519_-	SH3 domain-containing protein	NA	D2KRB9	Lactobacillus_phage	29.5	2.5e-06
WP_142785687.1|3106528_3107707_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_142785688.1|3107917_3109966_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_142785689.1|3110481_3111738_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	38.4	1.0e-31
WP_142785690.1|3111926_3112334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142785691.1|3112506_3112773_+	addiction module protein	NA	NA	NA	NA	NA
WP_142785692.1|3112762_3113056_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_142785693.1|3113310_3113826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785694.1|3113976_3114537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783376.1|3115193_3116474_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142785222.1|3117075_3118329_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142785695.1|3118434_3118968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783376.1|3119668_3120949_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142785696.1|3121449_3122796_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	40.2	2.3e-74
WP_142785697.1|3123205_3123979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142783376.1|3124377_3125658_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_142785698.1|3125749_3126109_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_142785699.1|3126105_3126996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142785700.1|3127094_3127862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142785701.1|3128042_3128858_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	29.7	7.7e-09
WP_142785702.1|3128950_3130057_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.4	1.3e-22
WP_142783758.1|3130205_3130589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142785703.1|3131548_3131887_+	single-stranded DNA-binding protein	NA	E1ABY7	Pseudoalteromonas_phage	45.7	6.9e-20
WP_142785704.1|3131957_3132341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142785705.1|3132358_3132556_+	hypothetical protein	NA	NA	NA	NA	NA
3132949:3132968	attL	AGCAAGAGGGTAACACGCTG	NA	NA	NA	NA
WP_142785706.1|3133633_3133996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785707.1|3134006_3134879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785708.1|3135003_3135420_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_142785709.1|3136028_3137288_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	36.2	4.1e-33
WP_142785710.1|3137436_3137973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142785711.1|3138422_3139418_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3138111:3138130	attR	CAGCGTGTTACCCTCTTGCT	NA	NA	NA	NA
>prophage 7
NZ_CP039456	Changchengzhania lutea strain SM1355 chromosome, complete genome	4130958	3532719	3541413	4130958		Catovirus(33.33%)	6	NA	NA
WP_142786034.1|3532719_3534000_-	nucleotide sugar dehydrogenase	NA	M1H5A7	Paramecium_bursaria_Chlorella_virus	28.1	2.4e-28
WP_142786035.1|3534007_3535387_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.1	8.4e-64
WP_142786036.1|3535485_3536481_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	52.3	5.2e-92
WP_142786037.1|3536629_3537685_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	32.6	6.9e-42
WP_142786038.1|3538345_3539476_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	24.9	3.3e-18
WP_142786039.1|3539472_3541413_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	32.3	5.0e-30
