The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	1118287	1131470	4857938		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1118287_1119049_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1119042_1119669_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1119808_1120948_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1121010_1122003_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1122096_1123461_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1123549_1124326_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1124330_1124969_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1124965_1126228_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1126224_1127133_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1127328_1128096_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1128146_1128803_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1128908_1131470_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	1734350	1743793	4857938		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1734350_1735277_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1735281_1736013_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1735993_1736101_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1736160_1736892_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1737113_1738799_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1738795_1739515_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1739561_1740032_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_032204114.1|1740073_1740535_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001551351.1|1740659_1742660_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1742656_1743793_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	1832057	1842972	4857938		Enterobacteria_phage(22.22%)	10	NA	NA
WP_125922846.1|1832057_1833335_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
WP_099147824.1|1833370_1834699_+	flippase	NA	NA	NA	NA	NA
WP_099147860.1|1834778_1835171_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_000043542.1|1835342_1836749_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|1836973_1838038_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_016161468.1|1838064_1838934_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_004206787.1|1838965_1839856_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_004206788.1|1839870_1840425_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_000704907.1|1840605_1841772_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_087523507.1|1841964_1842972_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 4
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	2769306	2825348	4857938	capsid,integrase,portal,tail,terminase,tRNA,holin,head	Escherichia_phage(44.44%)	64	2777498:2777512	2825450:2825464
WP_001297484.1|2769306_2770413_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2770448_2771090_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2771093_2772464_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2772632_2773304_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2773303_2774764_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2774839_2775961_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|2776009_2777236_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2777485_2778622_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2777498:2777512	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2778605_2779469_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2780023_2780692_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|2780636_2780774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|2780929_2781460_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|2782193_2782565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|2782873_2784382_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2788335_2788935_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2789002_2792482_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2792542_2793151_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2793087_2793831_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2793836_2794535_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2794534_2794891_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2794868_2798096_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2798142_2798403_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2798444_2798831_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2798830_2799535_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2799595_2799940_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2799936_2800386_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2800382_2800721_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2800729_2801047_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2801123_2802341_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2802946_2804173_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2804320_2806078_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2806077_2806560_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2806707_2807058_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_071586179.1|2807350_2807491_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
WP_000738421.1|2807583_2807877_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2807967_2808150_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2808366_2808900_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2808963_2809314_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2809318_2809534_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2809841_2810030_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2810290_2810626_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2810696_2810909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2811397_2811484_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2811878_2812700_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2812696_2813077_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2813077_2814136_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2814137_2814416_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2814583_2814796_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000786213.1|2814998_2815178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2815830_2816013_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2816106_2816463_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2816520_2816943_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2816983_2818054_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2818125_2818551_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2818534_2818777_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2819168_2819507_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_143422745.1|2819938_2820139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2820231_2820450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2820414_2820618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2821018_2821207_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2821203_2821395_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2821488_2823930_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2823991_2824261_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2824229_2825348_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2825450:2825464	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	3412420	3455253	4857938	transposase	Escherichia_phage(30.77%)	34	NA	NA
WP_001615628.1|3412420_3413533_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3413609_3413762_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085947770.1|3413859_3415229_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001130654.1|3415660_3416779_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001067855.1|3416916_3417621_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000262446.1|3417705_3418068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217395.1|3418153_3418645_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333498.1|3418815_3419073_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_001118619.1|3419716_3420640_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001276168.1|3420857_3422939_-	glycosyltransferase	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
WP_000440491.1|3422942_3424133_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000684771.1|3424180_3425335_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001581568.1|3425344_3426376_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000018742.1|3426441_3427194_-	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
WP_000665069.1|3427200_3427980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001048111.1|3427976_3430193_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000154260.1|3430226_3431243_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
WP_000609089.1|3431687_3432581_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
WP_001067855.1|3433582_3434287_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000351487.1|3434465_3435119_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3435226_3436474_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786319.1|3436554_3437931_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3438032_3441176_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3441187_3442411_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3442426_3442759_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3442916_3444290_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3444446_3445130_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3445119_3446562_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_143422755.1|3446711_3448949_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001333623.1|3448935_3451908_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3451908_3452799_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3452981_3453743_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_143422756.1|3454044_3454284_+	response regulator	NA	NA	NA	NA	NA
WP_001118619.1|3454329_3455253_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 6
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	3691961	3790567	4857938	capsid,integrase,portal,lysis,tail,terminase,holin,head	Enterobacteria_phage(33.33%)	108	3741224:3741271	3786664:3786711
WP_001159094.1|3691961_3693632_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3693844_3694513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3694755_3695451_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3695443_3696871_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3696881_3697601_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3698127_3698982_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3699207_3700533_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3700641_3700878_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3700889_3701483_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3702072_3702924_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020221.1|3703063_3707320_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3708436_3708538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3708901_3709165_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3709164_3709305_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3709339_3709567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3710389_3710932_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3711006_3711594_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3711651_3712320_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3712345_3714871_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3714860_3716504_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3716472_3717183_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3717495_3717825_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3718072_3718687_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3719104_3719794_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3719790_3720747_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3720743_3722942_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3722951_3723908_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3723886_3724297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350215.1|3724640_3725000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284450.1|3724992_3725535_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000188903.1|3725655_3725841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000617443.1|3726136_3726418_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000230707.1|3726678_3727134_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
WP_000678612.1|3727213_3727414_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_050571080.1|3727639_3727876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231257.1|3727897_3728335_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_016231258.1|3728397_3730503_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
WP_016231259.1|3730502_3731969_-	hypothetical protein	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
WP_014639558.1|3732413_3732665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087523544.1|3732731_3735488_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
WP_001058739.1|3735500_3736103_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|3736095_3736317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|3736313_3736577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3736573_3736768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077900594.1|3736760_3737828_-	ash family protein	NA	NA	NA	NA	NA
WP_033554327.1|3737821_3738004_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_087523546.1|3737996_3738806_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
WP_000412539.1|3738818_3739250_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_074525659.1|3739249_3739453_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_074525658.1|3739500_3739734_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_021531046.1|3739845_3741060_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
3741224:3741271	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_061359862.1|3741654_3746109_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
WP_072240810.1|3746643_3746772_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_143422757.1|3746826_3750585_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	94.0	0.0e+00
WP_001233546.1|3750649_3751249_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_143422758.1|3751316_3754796_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	91.2	0.0e+00
WP_000090873.1|3754856_3755489_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_000194732.1|3755425_3756169_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.9e-148
WP_143422759.1|3756174_3756843_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.5	8.6e-115
WP_000847345.1|3756874_3757204_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_061359859.1|3757200_3759780_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.2	0.0e+00
WP_000459457.1|3759772_3760207_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001535872.1|3760188_3760611_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_044502411.1|3760626_3761367_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000683105.1|3761374_3761770_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_061359858.1|3761766_3762345_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	1.7e-79
WP_000785282.1|3762356_3762710_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158878.1|3762721_3763117_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000063238.1|3763158_3764184_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_061359857.1|3764238_3764571_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_061359856.1|3764580_3765900_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001316285.1|3765880_3767482_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000198149.1|3767478_3767685_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_061359855.1|3767681_3769607_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453587.1|3769581_3770127_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000105084.1|3770515_3770749_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3770805_3771216_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_024205918.1|3771502_3771760_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
WP_000839225.1|3771756_3772254_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001408742.1|3772455_3772914_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.3	6.2e-56
WP_004010964.1|3772910_3773408_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	8.4e-91
WP_000839596.1|3773407_3773623_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|3773690_3774743_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|3774893_3775097_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|3775416_3776436_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|3776450_3776831_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_047928510.1|3776845_3777835_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_023352843.1|3777842_3778640_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
WP_000767113.1|3778659_3779049_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_021518589.1|3779045_3779372_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	4.5e-53
WP_001332382.1|3779371_3779866_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_047928509.1|3779862_3780804_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	3.6e-143
WP_001250269.1|3780793_3780973_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3781148_3781700_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_000205494.1|3781737_3781938_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3782035_3782662_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549623.1|3782909_3783116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3783087_3783522_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_077628661.1|3783440_3783644_-	hypothetical protein	NA	U5P0J5	Shigella_phage	97.0	1.0e-31
WP_077251367.1|3783789_3784011_+	hypothetical protein	NA	S5FNS4	Shigella_phage	97.3	1.1e-37
WP_000008236.1|3784066_3784603_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3784593_3784956_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3784955_3785261_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077941726.1|3785176_3785611_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
WP_000051887.1|3785487_3786651_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3786855_3788109_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3786664:3786711	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3788120_3789224_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3789511_3790567_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 7
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	3800701	3866516	4857938	transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	57	NA	NA
WP_000006255.1|3800701_3801199_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3801374_3802124_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3802333_3802594_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3802596_3802875_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3803030_3803771_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3803741_3804509_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3804714_3805293_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3805532_3807977_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3808019_3808493_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_087523548.1|3808646_3809417_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3809457_3810594_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024198219.1|3811184_3811418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3811395_3815628_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3815703_3817845_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3818054_3818573_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3819267_3819768_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3819802_3820027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3820077_3821553_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3821559_3821973_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3821976_3823827_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3823790_3824873_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3824897_3826178_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3826174_3826699_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3826701_3828033_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3828037_3828799_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3828807_3831573_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3831569_3832313_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3832317_3833730_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3833838_3837273_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3837283_3838636_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3838659_3839142_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_087523582.1|3839185_3840100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3840109_3840589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3840725_3841511_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3842047_3842779_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3842843_3843311_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3843307_3844030_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3844063_3844819_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3844890_3846249_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3846296_3846920_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3846923_3847724_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3847964_3848879_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3848875_3849679_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3855438_3856014_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3856201_3857233_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3857225_3857879_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3857918_3858734_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3858851_3859256_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3859252_3859960_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3860071_3861790_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3861843_3862668_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3862867_3863578_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3863591_3864014_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3864010_3864556_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3864721_3864922_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3864908_3865169_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3865217_3866516_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP041392	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 chromosome, complete genome	4857938	4556346	4635699	4857938	transposase,integrase,tail,protease,tRNA	Escherichia_phage(40.0%)	77	4566046:4566081	4644584:4644619
WP_000187022.1|4556346_4557447_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4557486_4557846_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4557845_4558496_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4558826_4560227_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4560209_4561127_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4561393_4562767_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4562827_4563604_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4563611_4564616_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4564769_4565921_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4566046:4566081	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4566518_4569170_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4569351_4571085_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4571299_4572151_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4572137_4572479_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4572480_4573359_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4573324_4575622_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4575672_4575993_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4576007_4577087_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4577395_4579897_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4579908_4580571_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4580581_4581685_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4581959_4582577_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4582603_4583509_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4583601_4585782_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4586110_4587001_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4587349_4589782_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4589784_4590945_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4591221_4591539_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4591722_4592331_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4592391_4592604_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4592806_4595005_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4595160_4596186_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4596277_4597237_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4597329_4597860_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4597869_4599201_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4599267_4600194_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4600286_4600772_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4600856_4601102_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4601526_4602372_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4602394_4603903_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4604037_4605048_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4605144_4605891_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4605895_4606324_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4606350_4606650_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4606861_4607302_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4607402_4608002_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4608109_4608877_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4608931_4609687_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4609793_4610783_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4611102_4612065_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4612245_4613148_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|4613355_4613868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4614141_4615511_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4615583_4615802_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4615883_4617047_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4617046_4617526_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4617540_4619988_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4619980_4620100_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4620132_4620408_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4620464_4620983_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4620995_4622186_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4622245_4622848_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4622855_4624391_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4624439_4624787_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4624783_4625188_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001016257.1|4625508_4626255_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4626269_4627811_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4629285_4629561_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4629557_4629782_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4629781_4630084_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4630083_4630308_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4630371_4630872_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4631041_4631314_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4631450_4631744_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4631813_4632794_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4632980_4633481_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4633630_4634329_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4634325_4635699_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4644584:4644619	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
NZ_CP041393	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_1, complete sequence	139547	31818	62733	139547	transposase,tRNA,protease	Acidithiobacillus_phage(25.0%)	32	NA	NA
WP_039023147.1|31818_32217_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_086531934.1|32216_32447_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_039023145.1|32525_37796_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_002431311.1|38071_39613_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|39627_40374_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_052273601.1|40401_41148_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.7e-08
WP_001567328.1|41202_41763_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_039023209.1|41893_42103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702149.1|42514_43141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702150.1|43292_43862_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_071550058.1|44448_44691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367749.1|44746_44896_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|45179_45437_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071586949.1|45472_45589_-	replication protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|45672_45747_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_029702152.1|45739_46597_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071940963.1|46959_47346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|47535_48189_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|48281_48539_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|48540_48873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|49009_51907_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|52001_52607_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|53383_53776_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|53913_54798_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|54829_56029_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|56107_56785_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|56816_57059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|58680_59385_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|59528_60083_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|60213_61044_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|61675_62380_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050011420.1|62370_62733_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
>prophage 2
NZ_CP041393	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_1, complete sequence	139547	66564	110228	139547	transposase,integrase	Escherichia_phage(33.33%)	50	56580:56595	114995:115010
56580:56595	attL	AGGCCGGCGACAGCGA	NA	NA	NA	NA
WP_001067855.1|66564_67269_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|67772_68786_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|68943_69417_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|69547_70336_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|70541_70889_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|70882_71722_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|72126_73668_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|73980_75012_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|75022_75661_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|75665_76031_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|76034_76847_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|77405_78110_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_060591625.1|78143_79031_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	9.2e-56
WP_001083725.1|79175_79673_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|79784_80075_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|80080_80872_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|81035_81383_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|81376_82216_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|82145_82325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|82343_82547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|82702_83908_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|83918_84224_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|84239_84422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|84450_85215_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|85405_85762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|85707_86292_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|86291_87530_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|87526_88432_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|88553_89258_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|92771_93257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|93281_93767_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|93753_94449_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729219.1|94453_95584_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|95573_96857_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|96859_98239_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|98342_98870_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|98910_100797_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_071528361.1|100799_100985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372823.1|101143_101959_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|102141_102648_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|102637_102796_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_001323225.1|102817_103000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361402.1|105045_106068_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|106052_107618_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|107692_108109_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|108105_108336_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001336213.1|108615_108894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|108895_109114_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|109115_109421_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016970.1|109421_110228_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
114995:115010	attR	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP041394	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2	137828	46463	86021	137828	integrase,transposase	Enterobacteria_phage(22.22%)	49	74271:74285	86002:86016
WP_001139958.1|46463_47618_-|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
WP_001213803.1|47601_47928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071589225.1|47929_48235_-	shufflon protein B	NA	NA	NA	NA	NA
WP_001302705.1|48463_48619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071779819.1|48621_48819_-	pilus assembly protein PilV	NA	NA	NA	NA	NA
WP_071527775.1|48785_49004_+	shufflon protein D'	NA	NA	NA	NA	NA
WP_001349157.1|49138_49387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417545.1|49383_50676_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_001193553.1|50675_51332_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000014116.1|51316_51877_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000959786.1|51886_52501_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_001208805.1|52518_53616_-	pilus biosynthesis protein PilR	NA	NA	NA	NA	NA
WP_000362202.1|53628_55182_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_001247334.1|55192_55645_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000752772.1|55631_56927_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_000748143.1|56919_58602_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000539807.1|58615_59053_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001302629.1|59052_60120_-	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_001324593.1|60153_60747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494779.1|60743_61040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|61215_61470_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_001324595.1|61351_61651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744644.1|61631_62183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213859.1|62355_63039_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_001303318.1|63141_63321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372168.1|63292_63826_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_001372179.1|63831_63954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483804.1|64267_64504_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001387472.1|64472_64736_-	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	4.7e-08
WP_000637324.1|65209_65416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527963.1|65412_65733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907866.1|65708_66740_+	replication initiation protein	NA	NA	NA	NA	NA
WP_071533334.1|67307_67439_-	replication protein RepA4	NA	NA	NA	NA	NA
WP_001579760.1|67649_68642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000521604.1|68700_69318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001579759.1|69512_71069_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194568.1|71333_71924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|72193_73054_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|73516_74221_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_095597217.1|74211_74454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
74271:74285	attL	TTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001120888.1|74565_76059_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|76089_76974_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|77190_78405_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001067856.1|78628_79333_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000110242.1|79651_80860_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_001288435.1|80893_82327_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_032491824.1|83814_84606_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_000845048.1|84754_85768_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_130624313.1|85736_86021_+|transposase	transposase	transposase	NA	NA	NA	NA
86002:86016	attR	CGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP041394	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2	137828	100683	108460	137828	integrase	Escherichia_phage(28.57%)	11	100615:100629	111620:111634
100615:100629	attL	GACAGCCAGAAACGG	NA	NA	NA	NA
WP_001372173.1|100683_101466_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_000239529.1|101603_101879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|101872_102517_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|102745_103717_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|103721_104114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457523.1|104118_105390_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000109071.1|105389_105827_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|105823_106072_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_032072581.1|106182_106452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072748701.1|106489_107392_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086147.1|107776_108460_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
111620:111634	attR	CCGTTTCTGGCTGTC	NA	NA	NA	NA
>prophage 3
NZ_CP041394	Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2	137828	111723	120153	137828		Pseudomonas_phage(16.67%)	9	NA	NA
WP_012372796.1|111723_113391_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_032158038.1|114104_114611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001276107.1|114557_115085_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
WP_000006020.1|115142_115376_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001145485.1|115434_117393_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_001387500.1|117447_117882_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|117878_118598_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001579745.1|118594_119053_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117611.1|119652_120153_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
