The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041395	Bacteroides ovatus strain 3725 D1 iv chromosome, complete genome	7079631	353644	367040	7079631	protease	unidentified_phage(85.71%)	12	NA	NA
WP_004325859.1|353644_356548_+	hypothetical protein	NA	H7BUS3	unidentified_phage	99.2	0.0e+00
WP_004303400.1|356544_356859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303399.1|357453_357942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017142804.1|358062_358464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004303397.1|358525_359392_+|protease	protease	protease	H7BUS5	unidentified_phage	97.2	2.9e-163
WP_004325861.1|359416_361621_+	hypothetical protein	NA	H7BUS6	unidentified_phage	97.8	0.0e+00
WP_004325862.1|361679_362486_+	hypothetical protein	NA	H7BUS7	unidentified_phage	97.8	5.4e-148
WP_004325863.1|362600_363548_+	hypothetical protein	NA	H7BUS8	unidentified_phage	96.2	2.3e-161
WP_004325864.1|363704_364379_+	site-specific DNA-methyltransferase	NA	H9YP98	environmental_Halophage	33.6	2.0e-26
WP_004325865.1|364353_364698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004325866.1|364678_365359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004325867.1|365318_367040_+	hypothetical protein	NA	H7BUT1	unidentified_phage	98.3	0.0e+00
>prophage 2
NZ_CP041395	Bacteroides ovatus strain 3725 D1 iv chromosome, complete genome	7079631	446604	467518	7079631	portal,integrase	unidentified_phage(66.67%)	25	445804:445818	462199:462213
445804:445818	attL	TCTTTTAAAGTATAT	NA	NA	NA	NA
WP_004295895.1|446604_447027_-	hypothetical protein	NA	A0A2H4JDQ6	uncultured_Caudovirales_phage	44.7	1.1e-14
WP_004295896.1|447123_448512_+	peptide MFS transporter	NA	NA	NA	NA	NA
WP_004295897.1|448594_449398_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ36	Paenibacillus_phage	36.2	6.4e-32
WP_032846279.1|449942_451082_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	99.4	7.6e-180
WP_008647907.1|451078_451249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141758162.1|451384_451975_-	GNAT family N-acetyltransferase	NA	J7I473	Acinetobacter_phage	25.0	8.4e-05
WP_143255124.1|452120_452309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143255125.1|452335_452545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846283.1|452655_453672_-	hypothetical protein	NA	H7BUI9	unidentified_phage	97.9	1.0e-191
WP_008647899.1|453674_455252_-|portal	phage portal protein	portal	H7BUJ0	unidentified_phage	100.0	0.0e+00
WP_008768544.1|455344_455671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008647889.1|455720_456236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846307.1|456232_456661_-	hypothetical protein	NA	A0A2I7RVN5	Vibrio_phage	27.8	1.9e-06
WP_032846286.1|456665_457346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008647885.1|457347_457551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008647884.1|457559_458045_-	hypothetical protein	NA	H7BUJ2	unidentified_phage	100.0	6.2e-14
WP_008647883.1|458117_458399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846287.1|458402_459176_-	hypothetical protein	NA	H7BUJ3	unidentified_phage	99.6	3.0e-143
WP_032846288.1|459177_459705_-	ATP-binding cassette domain-containing protein	NA	A0A0E3X9J6	Bacillus_phage	39.7	2.0e-10
WP_032846289.1|459701_461897_-	hypothetical protein	NA	H7BUJ5	unidentified_phage	99.6	0.0e+00
WP_032846290.1|461903_463205_-	AAA family ATPase	NA	H7BUJ6	unidentified_phage	99.3	3.0e-249
462199:462213	attR	TCTTTTAAAGTATAT	NA	NA	NA	NA
WP_117615045.1|463211_463409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846291.1|463411_465121_-	PHP domain-containing protein	NA	H7BUJ7	unidentified_phage	97.8	2.8e-263
WP_032846293.1|465123_466161_-	hypothetical protein	NA	H7BUJ8	unidentified_phage	100.0	4.2e-201
WP_008647873.1|466162_467518_-	hypothetical protein	NA	H7BUJ9	unidentified_phage	99.8	4.3e-262
>prophage 3
NZ_CP041395	Bacteroides ovatus strain 3725 D1 iv chromosome, complete genome	7079631	1071908	1133886	7079631	protease,capsid,integrase,transposase,portal,terminase,tail,head	Cellulophaga_phage(23.08%)	70	1071470:1071486	1139999:1140014
1071470:1071486	attL	AAAAAACAGGTAAAAAA	NA	NA	NA	NA
WP_139147511.1|1071908_1073186_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1071470:1071486	attL	AAAAAACAGGTAAAAAA	NA	NA	NA	NA
WP_004326910.1|1073477_1073927_+	DUF5053 domain-containing protein	NA	NA	NA	NA	NA
WP_042994239.1|1073990_1075181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004326908.1|1075271_1075673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845717.1|1075669_1076164_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0Z0F0	Vibrio_phage	46.1	2.2e-30
WP_032845715.1|1076156_1076567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845712.1|1076609_1076930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845709.1|1076919_1077192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845707.1|1077195_1080540_-	hypothetical protein	NA	B5TR91	Bacteroides_phage	32.3	1.9e-13
WP_032845705.1|1080539_1082678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845703.1|1082671_1084711_-	hypothetical protein	NA	R9ZYD7	Cellulophaga_phage	73.8	6.7e-09
1082681:1082697	attR	TTTTTTACCTGTTTTTT	NA	NA	NA	NA
WP_032845701.1|1084703_1084961_-	hypothetical protein	NA	NA	NA	NA	NA
1082681:1082697	attR	TTTTTTACCTGTTTTTT	NA	NA	NA	NA
WP_032845699.1|1085029_1085353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008999305.1|1085394_1085850_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_032845697.1|1085871_1086258_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_032845696.1|1086254_1086758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845694.1|1086750_1087068_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_032845692.1|1087067_1087364_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_032845690.1|1087433_1088564_-|capsid	phage major capsid protein	capsid	S0A3Y1	Cellulophaga_phage	25.2	1.4e-13
WP_032845688.1|1088567_1089167_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1PA08	Enterococcus_phage	35.3	2.5e-17
WP_032845685.1|1089187_1090462_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	28.3	4.6e-32
WP_032845683.1|1090461_1092177_-|terminase	terminase large subunit	terminase	X2KRB1	Campylobacter_phage	30.9	1.4e-52
WP_032845681.1|1092160_1092526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845679.1|1092742_1093084_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_061448127.1|1093223_1093505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310945.1|1093501_1093687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310946.1|1094066_1094822_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	68.7	8.5e-103
WP_004310947.1|1094835_1095192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310948.1|1095193_1095523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310949.1|1095539_1096043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846076.1|1096140_1096899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080706905.1|1097064_1097433_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_032846078.1|1097599_1098388_-	hypothetical protein	NA	A0A0S2MWS7	Cellulophaga_phage	31.2	6.7e-26
WP_032846074.1|1098530_1098992_-	DUF4494 domain-containing protein	NA	NA	NA	NA	NA
WP_032854379.1|1099042_1099351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845391.1|1099347_1100163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004310954.1|1100149_1100635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845392.1|1100646_1100874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080558415.1|1100845_1101037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845393.1|1101047_1101257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008999279.1|1101238_1101448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845394.1|1101493_1101724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845395.1|1101766_1101955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032845949.1|1102090_1102762_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032854378.1|1102782_1103412_+	DUF4468 domain-containing protein	NA	NA	NA	NA	NA
WP_032845298.1|1103455_1103779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008999271.1|1103943_1105155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008999270.1|1105168_1105642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128132042.1|1105629_1105824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032846171.1|1106143_1106965_-	DUF3845 domain-containing protein	NA	NA	NA	NA	NA
WP_004306385.1|1106980_1107565_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_032846169.1|1107567_1108470_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032846167.1|1108563_1110306_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_032846175.1|1110302_1112231_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	35.3	1.1e-26
WP_004297861.1|1112349_1114482_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_004297862.1|1114453_1115350_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032846173.1|1115453_1116503_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004307670.1|1116919_1117324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004296723.1|1117311_1117662_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_143255130.1|1117748_1119314_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_004297886.1|1119551_1120109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004297887.1|1120215_1121835_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	1.6e-45
WP_004297892.1|1122100_1122682_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004307195.1|1122721_1123906_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	24.1	1.1e-16
WP_032845937.1|1124069_1125095_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_032845935.1|1125128_1126268_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_032845933.1|1126436_1128167_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_008775980.1|1128166_1130911_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_032845939.1|1131316_1132540_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	38.8	1.1e-35
WP_032845938.1|1132560_1133886_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1139999:1140014	attR	AATAGATGATTCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP041395	Bacteroides ovatus strain 3725 D1 iv chromosome, complete genome	7079631	4580839	4619960	7079631	integrase	unidentified_phage(28.57%)	35	4617809:4617840	4621315:4621346
WP_004292635.1|4580839_4581982_+|integrase	site-specific integrase	integrase	A0A1Y0T0H2	Sinorhizobium_phage	24.7	3.9e-06
WP_004292636.1|4581996_4583142_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.3	1.1e-13
WP_004292637.1|4583451_4584882_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004312206.1|4584887_4585508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004312207.1|4585504_4585918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292639.1|4586151_4586394_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004292640.1|4586424_4586898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005942618.1|4587009_4587525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292642.1|4587666_4588104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292643.1|4588100_4589333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292644.1|4589339_4589876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004312210.1|4589903_4590326_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_005942627.1|4590790_4596955_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.6	4.3e-59
WP_004292648.1|4596957_4597548_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_004292649.1|4597586_4599959_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004292650.1|4599997_4601185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004293712.1|4601595_4602321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008627669.1|4602843_4603215_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_032854397.1|4603251_4603821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008999098.1|4603949_4605317_-	mobilization protein	NA	NA	NA	NA	NA
WP_029429312.1|4605580_4605913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004293707.1|4605909_4606302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004293706.1|4606319_4607552_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.8	4.1e-30
WP_017140786.1|4607981_4608266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004292655.1|4608314_4609397_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004292658.1|4609401_4610511_+	dehydrogenase	NA	NA	NA	NA	NA
WP_004292659.1|4610494_4611301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292661.1|4611290_4612085_+	methyltransferase domain-containing protein	NA	A0A0N9SHZ9	Staphylococcus_phage	41.4	2.7e-46
WP_004292663.1|4612081_4612759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292666.1|4612755_4613451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004292668.1|4613458_4615255_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	9.0e-34
WP_004292670.1|4615261_4617004_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	1.5e-41
WP_100069981.1|4617112_4617385_+	hypothetical protein	NA	NA	NA	NA	NA
4617809:4617840	attL	TGGTTTATCCAAACTTTTTAGTTATCCTAACT	NA	NA	NA	NA
WP_032854307.1|4617905_4618973_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032854306.1|4618976_4619960_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4621315:4621346	attR	AGTTAGGATAACTAAAAAGTTTGGATAAACCA	NA	NA	NA	NA
>prophage 5
NZ_CP041395	Bacteroides ovatus strain 3725 D1 iv chromosome, complete genome	7079631	5841420	5850203	7079631		Listeria_phage(16.67%)	8	NA	NA
WP_004305395.1|5841420_5842389_+	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	40.1	4.4e-19
WP_004301384.1|5842409_5842754_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032845965.1|5842877_5845118_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.0	1.2e-11
WP_004301388.1|5845190_5846486_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	42.5	5.7e-14
WP_032845963.1|5846520_5847408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301392.1|5847408_5848299_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.3	3.3e-13
WP_004301394.1|5848314_5849079_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.3	7.5e-22
WP_004305393.1|5849435_5850203_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.1	3.0e-31
