The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019791	Rubrobacter xylanophilus strain AA3-22	3022875	85755	94498	3022875		Gordonia_phage(16.67%)	7	NA	NA
WP_143526404.1|85755_87384_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0K0NKS2	Gordonia_phage	27.0	1.2e-05
WP_143526405.1|87316_87598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526406.1|87712_89338_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	52.9	1.5e-149
WP_143526407.1|89726_90887_+	GuaB3 family IMP dehydrogenase-related protein	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	33.8	5.7e-13
WP_143526408.1|90890_92411_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.4	2.2e-20
WP_143526409.1|92445_93240_+	endonuclease/exonuclease/phosphatase family protein	NA	A0A2I2L4E4	Orpheovirus	24.8	3.2e-07
WP_143526410.1|93388_94498_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	40.1	6.8e-48
>prophage 2
NZ_AP019791	Rubrobacter xylanophilus strain AA3-22	3022875	260697	302783	3022875	holin,transposase,protease,integrase	Synechococcus_phage(25.0%)	44	277649:277694	293283:293328
WP_143526559.1|260697_261654_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	30.7	2.4e-25
WP_143526560.1|261798_262071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526561.1|262070_262418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526562.1|262451_262844_-	recombinase family protein	NA	NA	NA	NA	NA
WP_172620598.1|263230_263995_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_143526564.1|264115_265405_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	37.3	4.9e-42
WP_143526565.1|265409_266687_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_143526566.1|266709_268017_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.8	4.9e-21
WP_143526567.1|268022_268736_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.7	3.3e-40
WP_143526568.1|268732_268957_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_143526569.1|268953_269616_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_143526570.1|269612_271799_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.3	3.8e-159
WP_143526571.1|271798_273232_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.5e-52
WP_143526572.1|273235_274261_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	43.0	1.1e-63
WP_143526573.1|274247_274835_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	3.7e-29
WP_143526574.1|274831_276355_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.2	7.3e-69
WP_172620599.1|276537_276801_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_143526576.1|277235_277568_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.9	1.4e-17
277649:277694	attL	GACTGAAAATCACGGTGTCCCCGGTTCGAGTCCGGGTCCCGCCACT	NA	NA	NA	NA
WP_143526577.1|277781_278912_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.8	5.6e-58
WP_172620600.1|278915_279056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526579.1|280207_283246_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	35.1	1.2e-54
WP_143526580.1|283245_286431_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_143526581.1|286517_287114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172620601.1|287885_288581_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	34.3	2.3e-22
WP_172620602.1|288606_288819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172620603.1|288891_289059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526583.1|289073_289424_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_143526584.1|289828_290047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526585.1|290036_290402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526586.1|290528_292490_-	AAA family ATPase	NA	A0A142KBZ3	Gordonia_phage	23.1	1.5e-13
WP_172620911.1|292728_292914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143526588.1|293333_293702_-	hypothetical protein	NA	NA	NA	NA	NA
293283:293328	attR	GACTGAAAATCACGGTGTCCCCGGTTCGAGTCCGGGTCCCGCCACT	NA	NA	NA	NA
WP_172620604.1|293789_295631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620605.1|295627_296101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143526590.1|296258_296567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143526591.1|296567_296936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143526592.1|297002_297872_-	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	34.6	4.8e-33
WP_143526593.1|298064_298553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143526594.1|298689_299151_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_172620606.1|299264_300158_+	EamA family transporter	NA	NA	NA	NA	NA
WP_143526596.1|300154_300526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620912.1|300633_301266_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_143526597.1|301262_302426_+	acetoin utilization protein AcuC	NA	A0A2K9L4C2	Tupanvirus	32.0	8.5e-17
WP_143526598.1|302462_302783_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
>prophage 3
NZ_AP019791	Rubrobacter xylanophilus strain AA3-22	3022875	627526	638180	3022875	tRNA	uncultured_Mediterranean_phage(28.57%)	10	NA	NA
WP_143526900.1|627526_628417_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.6	7.6e-34
WP_143526901.1|628472_628886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143526902.1|628913_630566_+	phosphotransferase	NA	A9YVW0	Ostreococcus_tauri_virus	33.3	9.4e-46
WP_143526903.1|630600_632829_+	RelA/SpoT family protein	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	37.6	4.9e-13
WP_143526904.1|632841_633420_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	28.6	4.3e-14
WP_143526905.1|633416_634697_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	2.6e-19
WP_143526906.1|634698_635439_+	NAD-dependent protein deacylase	NA	A0A0M7QDE5	Escherichia_phage	33.3	9.5e-14
WP_143526907.1|635627_635915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143526908.1|636135_636849_+	VOC family protein	NA	NA	NA	NA	NA
WP_143526909.1|636863_638180_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	27.9	3.5e-11
>prophage 4
NZ_AP019791	Rubrobacter xylanophilus strain AA3-22	3022875	1087104	1117090	3022875	transposase,integrase	Streptococcus_phage(28.57%)	26	1078135:1078150	1106833:1106848
1078135:1078150	attL	TGCTCGTCGTCTCGGC	NA	NA	NA	NA
WP_172620702.1|1087104_1087560_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	63.9	2.5e-17
WP_143527299.1|1087954_1088989_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_143527300.1|1089048_1090149_-	zinc-binding dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	4.4e-31
WP_143527301.1|1090524_1091790_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_143527302.1|1092003_1092825_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_143529225.1|1092891_1094511_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.7	3.8e-15
WP_143529226.1|1096482_1097139_+	CoA transferase	NA	NA	NA	NA	NA
WP_132692984.1|1097251_1098577_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	31.4	4.9e-37
WP_143527303.1|1098762_1099788_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_143529227.1|1099999_1101397_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_143527304.1|1101534_1102818_-	CoA transferase	NA	NA	NA	NA	NA
WP_143527305.1|1102814_1104053_-	cytochrome P450	NA	NA	NA	NA	NA
WP_172620703.1|1104198_1105086_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_172620704.1|1105156_1105936_-	PaaX family transcriptional regulator	NA	NA	NA	NA	NA
WP_172620705.1|1106178_1106346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143527309.1|1106738_1107065_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	49.0	4.8e-18
1106833:1106848	attR	GCCGAGACGACGAGCA	NA	NA	NA	NA
WP_143527310.1|1107113_1107380_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	41.1	5.1e-10
WP_172620706.1|1107612_1108431_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	35.8	4.4e-28
WP_143527312.1|1108555_1109881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143527313.1|1109881_1111975_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_143527314.1|1112109_1112448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143527315.1|1113144_1113360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143527316.1|1113517_1113715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143529228.1|1114359_1115625_+	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_172620707.1|1115813_1116566_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_172620708.1|1116535_1117090_-|transposase	transposase	transposase	NA	NA	NA	NA
