The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041616	Ornithinimicrobium sp. H23M54 chromosome, complete genome	4092907	2111768	2138905	4092907	integrase,transposase	Gordonia_phage(33.33%)	20	2108418:2108439	2139073:2139094
2108418:2108439	attL	GTTCAAACCCAGTATCGCCCAC	NA	NA	NA	NA
WP_143783242.1|2111768_2112958_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	5.6e-32
WP_143783243.1|2113109_2114714_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_143783244.1|2114701_2115301_-	hypothetical protein	NA	A0A0F6SJ14	Sinorhizobium_phage	29.0	5.5e-12
WP_165700075.1|2115297_2116062_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_143783246.1|2116582_2116927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143785052.1|2117051_2117591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143783247.1|2117753_2118461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143783248.1|2118524_2119073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143783249.1|2119721_2120072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143783250.1|2120501_2121446_+	phosphotransferase	NA	NA	NA	NA	NA
WP_165700076.1|2122386_2126205_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_165700077.1|2127317_2127761_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	44.5	3.0e-23
WP_143783253.1|2127757_2128084_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	56.3	9.3e-22
WP_143783254.1|2128104_2128566_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_143783255.1|2128855_2130169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143785053.1|2131255_2132275_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	1.6e-27
WP_143783256.1|2134589_2135129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143783257.1|2135632_2136403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143783258.1|2136828_2137242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143783259.1|2137735_2138905_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GJ95	Mycobacterium_phage	37.5	1.2e-55
2139073:2139094	attR	GTTCAAACCCAGTATCGCCCAC	NA	NA	NA	NA
>prophage 2
NZ_CP041616	Ornithinimicrobium sp. H23M54 chromosome, complete genome	4092907	3890445	3946391	4092907	protease,integrase,tail	Mycobacterium_phage(20.0%)	50	3880789:3880805	3906731:3906747
3880789:3880805	attL	ACCGGACCGCGTGGCGG	NA	NA	NA	NA
WP_143784699.1|3890445_3891399_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_165700172.1|3891577_3892240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165700173.1|3892188_3892545_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_143784702.1|3892611_3893208_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143784703.1|3893208_3893997_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_143784704.1|3893993_3894611_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_143784705.1|3894893_3895469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784142.1|3895468_3895954_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_143784706.1|3896701_3897496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165700174.1|3897693_3898158_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143784708.1|3898692_3898881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784709.1|3899712_3900255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143784710.1|3900914_3902102_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M7Q6	Mycobacterium_phage	38.2	8.2e-68
WP_165700175.1|3902599_3902917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165700176.1|3902913_3903447_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_143784712.1|3905672_3906548_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.7	6.8e-11
WP_143784713.1|3906635_3907664_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
3906731:3906747	attR	ACCGGACCGCGTGGCGG	NA	NA	NA	NA
WP_143784714.1|3907667_3908519_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_143784715.1|3908439_3909234_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_143784716.1|3909230_3909893_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_143784717.1|3909889_3910435_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_143784718.1|3910454_3911153_-	sortase	NA	NA	NA	NA	NA
WP_143784719.1|3911156_3911960_-	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_165700177.1|3912257_3913343_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_143784721.1|3913342_3914218_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_143784722.1|3914214_3915807_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_143784723.1|3915806_3916145_+	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_143784724.1|3916141_3916453_+	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_143785232.1|3916518_3917385_+	prenyltransferase	NA	NA	NA	NA	NA
WP_143784725.1|3917374_3917944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143784726.1|3917840_3918710_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_143784727.1|3918706_3919300_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_143784728.1|3919532_3920159_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_143784729.1|3920155_3921634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784730.1|3921649_3923479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784731.1|3923883_3924981_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_143784732.1|3925039_3926701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784733.1|3926905_3927574_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_143785233.1|3927597_3929640_+	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	40.5	3.1e-06
WP_143784734.1|3929639_3931634_+	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	27.3	4.7e-23
WP_143784735.1|3931665_3936165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784736.1|3936161_3937193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143784737.1|3937383_3938112_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_143784738.1|3938193_3939513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143784739.1|3939710_3941267_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.4	2.8e-68
WP_143784740.1|3941316_3941760_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_143784741.1|3941759_3942230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165700178.1|3942226_3942385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143784742.1|3944938_3945949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143784743.1|3945959_3946391_+|tail	phage tail protein	tail	NA	NA	NA	NA
