The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	21828	70060	4111737	integrase,transposase,tRNA	Escherichia_phage(46.15%)	44	42389:42448	69291:70112
WP_143969973.1|21828_23718_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_143969974.1|23721_24348_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004236739.1|24951_25329_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004236738.1|25359_26184_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|26232_26472_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_024473723.1|26530_27001_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004236736.1|27013_27547_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004236735.1|27561_29103_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004240209.1|29156_30020_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_024473722.1|30055_31438_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004236731.1|31459_31885_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_143969975.1|32014_33388_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.8	3.1e-34
WP_143969976.1|33482_35312_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.1	7.0e-135
WP_001029679.1|35471_36293_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|36279_38388_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|38384_40052_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|40854_42429_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
42389:42448	attL	GGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|42453_43158_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|43347_44163_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|44313_45018_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064732565.1|45027_45432_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_004193041.1|45751_46144_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_015344972.1|46310_47510_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001206356.1|48071_48863_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|48868_49159_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|49270_49768_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845054.1|49912_50926_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_014344500.1|50894_51167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|51200_51905_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|52018_52795_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000171321.1|52815_53037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742814.1|53023_54049_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|54470_55223_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|57033_57519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|57715_58806_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|58895_59711_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|59797_60100_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|59993_60245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|61876_62182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|62209_63424_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|63640_64525_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|65449_66154_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|66238_66640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|69355_70060_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
69291:70112	attR	GGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	1093447	1101501	4111737	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_143970497.1|1093447_1094653_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	4.2e-27
WP_119312960.1|1095258_1096221_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	1.7e-135
WP_143970498.1|1096244_1098365_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.9	7.2e-208
WP_143970499.1|1098395_1098812_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
WP_024474189.1|1098833_1099052_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_143970500.1|1099360_1100443_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_143970501.1|1100624_1101092_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_143970502.1|1101291_1101501_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 3
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	1290989	1300832	4111737	protease,tRNA	Planktothrix_phage(16.67%)	8	NA	NA
WP_143970617.1|1290989_1292936_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.8	2.2e-38
WP_004235798.1|1293022_1293253_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_143970618.1|1293511_1293832_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_036415782.1|1293865_1296151_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	3.7e-173
WP_002211347.1|1296227_1296446_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_143970619.1|1296596_1297316_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_143970620.1|1297293_1299060_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_143970621.1|1299062_1300832_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	4.9e-24
>prophage 4
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	1707291	1725404	4111737	integrase,transposase	Morganella_phage(91.67%)	26	1707204:1707260	1725727:1725783
1707204:1707260	attL	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
WP_052927410.1|1707291_1708443_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	69.8	1.9e-154
WP_052927411.1|1708980_1709376_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	92.4	2.3e-67
WP_054426069.1|1709376_1709991_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	96.6	6.7e-106
WP_052927413.1|1709993_1710356_-	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	86.7	2.9e-56
WP_052927414.1|1711463_1711727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240099.1|1712081_1712291_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_048822225.1|1712319_1712628_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	98.0	8.4e-49
WP_036414486.1|1713024_1713222_+	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
WP_052927415.1|1713374_1713716_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	98.2	1.2e-59
WP_036414490.1|1713754_1714402_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_036414492.1|1714501_1714711_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
WP_143970843.1|1714841_1715168_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	99.1	9.2e-54
WP_048822229.1|1715309_1716101_+	replication protein	NA	A0A1W6JNY0	Morganella_phage	98.5	1.1e-132
WP_052927416.1|1716100_1716829_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
WP_046024444.1|1717077_1717521_+	NinB protein	NA	A0A1W6JNZ4	Morganella_phage	100.0	1.1e-81
WP_052927417.1|1717726_1718176_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	90.6	3.8e-74
WP_036414499.1|1718161_1718590_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	100.0	9.8e-72
WP_080989310.1|1718866_1719505_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	99.1	5.3e-106
WP_087825464.1|1719506_1719674_+	NinH	NA	A0A1W6JNW3	Morganella_phage	97.4	5.6e-15
WP_048822286.1|1719794_1720232_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.2	3.2e-78
WP_046024440.1|1720606_1720819_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
WP_036414508.1|1721044_1721974_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.6	5.7e-149
WP_036414510.1|1722242_1722677_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_087825463.1|1723282_1723435_+	MbeCy	NA	A0A1W6JNZ9	Morganella_phage	100.0	8.9e-20
WP_036414512.1|1723604_1723811_+	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	100.0	1.3e-32
WP_143970486.1|1724256_1725404_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.3e-147
1725727:1725783	attR	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	1729460	1739720	4111737	tail	Burkholderia_phage(30.0%)	12	NA	NA
WP_143970848.1|1729460_1730948_+	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	36.9	1.4e-80
WP_143970849.1|1730962_1731415_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.5	2.9e-21
WP_004239642.1|1731456_1731915_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	3.5e-27
WP_143970850.1|1731997_1733968_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.8	9.9e-18
WP_143970851.1|1733964_1734504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143970852.1|1734500_1734794_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	33.3	1.8e-08
WP_004237444.1|1734786_1735602_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_143970853.1|1735618_1736311_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.6	2.2e-36
WP_004237440.1|1736307_1736652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143970854.1|1736644_1737832_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.4	1.7e-76
WP_143970855.1|1737828_1738491_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
WP_143970856.1|1738496_1739720_+|tail	phage tail protein	tail	A0A2K9V2I0	Shigella_phage	43.7	7.0e-30
>prophage 6
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	1762707	1776283	4111737	integrase	Salmonella_phage(33.33%)	20	1758714:1758728	1780394:1780408
1758714:1758728	attL	GTGACGGATCACGGC	NA	NA	NA	NA
WP_143970873.1|1762707_1763910_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	63.7	1.0e-142
WP_125112407.1|1764096_1764294_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	63.5	1.4e-17
WP_143970874.1|1764321_1765461_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	48.7	1.3e-86
WP_143970875.1|1765680_1766025_-	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	48.0	4.2e-17
WP_143970876.1|1766008_1766197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143970877.1|1766351_1766714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049246559.1|1766732_1767005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143970878.1|1767222_1767441_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_143970879.1|1767481_1768534_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.0	5.7e-97
WP_143970880.1|1768582_1770277_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	50.1	5.4e-105
WP_036407682.1|1770749_1771340_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	35.0	1.6e-27
WP_048822387.1|1771471_1771690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143970881.1|1771823_1772033_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.6	5.7e-09
WP_143970882.1|1772025_1772790_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	46.3	4.5e-59
WP_143970883.1|1772767_1773721_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	55.7	5.4e-70
WP_143972148.1|1773764_1774106_+	replication protein	NA	NA	NA	NA	NA
WP_143970884.1|1774322_1774691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143970885.1|1774914_1775310_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	59.6	4.9e-33
WP_143970886.1|1775299_1775722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143972149.1|1775959_1776283_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	63.9	4.5e-29
1780394:1780408	attR	GCCGTGATCCGTCAC	NA	NA	NA	NA
>prophage 7
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	2453113	2456037	4111737		Morganella_phage(83.33%)	6	NA	NA
WP_143971269.1|2453113_2453320_-	peptidase	NA	A0A1W6JP52	Morganella_phage	66.0	7.1e-12
WP_143971270.1|2453276_2453654_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	5.3e-13
WP_143971271.1|2453790_2454267_-	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	79.6	4.3e-68
WP_004239823.1|2454256_2454451_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	3.4e-24
WP_143971272.1|2454523_2454961_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	48.2	1.4e-28
WP_143971273.1|2455329_2456037_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	5.8e-69
>prophage 8
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	2591352	2628802	4111737	head,tRNA,tail,holin,terminase	Burkholderia_phage(14.63%)	51	NA	NA
WP_143971359.1|2591352_2592474_+	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.4	3.8e-30
WP_143971360.1|2592496_2593732_-|tail	phage tail protein	tail	A0A2K9V2I0	Shigella_phage	40.3	1.3e-28
WP_143971361.1|2593738_2594401_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.2	3.4e-39
WP_143971362.1|2594397_2595585_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.7	5.1e-78
WP_036415258.1|2595577_2595922_-	phage related-protein	NA	NA	NA	NA	NA
WP_143971363.1|2595918_2596611_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.1	5.0e-33
WP_101924146.1|2596624_2597440_-	hypothetical protein	NA	A0A0H4M7L6	Pseudomonas_phage	28.7	7.5e-20
WP_143971364.1|2597432_2597726_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.4	3.6e-09
WP_101924148.1|2597722_2598262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971365.1|2598258_2600397_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	29.3	1.3e-18
WP_004240342.1|2600479_2600941_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.3	3.3e-25
WP_004240341.1|2600983_2601436_-	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	43.5	1.5e-25
WP_143971366.1|2601445_2602933_-	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	36.9	9.6e-82
WP_143971367.1|2602942_2603458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971368.1|2603447_2603816_-	hypothetical protein	NA	I7A8K9	Escherichia_phage	36.3	3.8e-16
WP_143971369.1|2603815_2604274_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	42.0	2.5e-20
WP_143971370.1|2604270_2604699_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	30.9	1.7e-07
WP_143971371.1|2604708_2605062_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.8	2.4e-07
WP_143971372.1|2605117_2606185_-	DUF2184 domain-containing protein	NA	A1Z021	Burkholderia_virus	39.1	7.2e-55
WP_036406841.1|2606184_2606682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971373.1|2606681_2607962_-	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	40.4	1.1e-38
WP_143972184.1|2607958_2608672_-|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	38.2	1.3e-36
WP_143971374.1|2608694_2610206_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	46.4	3.9e-107
WP_036423315.1|2610207_2611608_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.7	9.3e-87
WP_143971375.1|2611808_2612825_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.6	5.1e-34
WP_004240327.1|2612882_2613068_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.0	2.4e-11
WP_143971376.1|2613365_2613893_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	41.8	1.3e-20
WP_143971377.1|2614029_2614506_-	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	89.2	6.4e-80
WP_036418393.1|2614498_2614690_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	88.9	8.6e-28
WP_143971378.1|2614932_2615445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087825561.1|2615736_2616270_-	DUF1133 family protein	NA	K7PHU3	Enterobacteria_phage	51.0	1.3e-36
WP_143971379.1|2616257_2616569_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	70.8	1.8e-35
WP_049246697.1|2616581_2617175_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	59.2	1.5e-62
WP_143971380.1|2617266_2617605_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	61.6	8.4e-34
WP_143971381.1|2617597_2618002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971382.1|2617998_2618664_-	phage N-6-adenine-methyltransferase	NA	S5M7S1	Escherichia_phage	67.5	2.8e-81
WP_143971383.1|2618663_2618897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075204902.1|2618899_2619076_-	palmdelphin	NA	NA	NA	NA	NA
WP_143971384.1|2619096_2620467_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.8	5.5e-100
WP_143971385.1|2620469_2621042_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	49.7	1.0e-47
WP_143971386.1|2621034_2621886_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.5	4.7e-33
WP_143971387.1|2621887_2622112_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	59.5	5.9e-20
WP_143971388.1|2622129_2622582_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	58.5	1.0e-34
WP_143971389.1|2622646_2622844_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	60.9	1.9e-14
WP_048822549.1|2622945_2623632_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	52.2	1.2e-68
WP_048822550.1|2623640_2624795_+	type I restriction enzyme R protein	NA	A0A1S5SAB0	Streptococcus_phage	29.2	1.8e-35
WP_143971390.1|2625191_2625506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415342.1|2625498_2625717_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	60.6	8.1e-14
WP_143971391.1|2625974_2626307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143971392.1|2626322_2628308_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.7	9.1e-128
WP_125112313.1|2628304_2628802_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	65.1	3.2e-50
>prophage 9
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	2671420	2718247	4111737	head,integrase,holin,coat,terminase	Cronobacter_phage(26.67%)	64	2686277:2686292	2729390:2729405
WP_143971415.1|2671420_2671648_+	DNA polymerase II	NA	H9C187	Pectobacterium_phage	62.7	1.5e-18
WP_143971416.1|2671745_2673743_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	52.1	9.3e-40
WP_143971417.1|2673804_2676276_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	50.7	1.9e-244
WP_143971418.1|2676262_2676655_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	59.5	7.4e-42
WP_079549358.1|2676651_2677122_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	50.0	5.8e-41
WP_111759603.1|2677121_2677598_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	64.6	1.6e-59
WP_143971419.1|2677630_2678254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971420.1|2678257_2681323_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	58.2	5.1e-279
WP_143971421.1|2681386_2681908_-	hypothetical protein	NA	A0A0S0N7I7	Pseudomonas_phage	36.2	4.9e-25
WP_143971422.1|2682032_2682965_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	50.5	1.0e-52
WP_143971423.1|2683031_2683196_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	53.1	2.0e-09
WP_143971424.1|2683280_2683532_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	63.4	1.1e-22
WP_143971425.1|2683555_2684581_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.2	3.9e-74
WP_143971426.1|2685105_2685594_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_143971427.1|2685597_2685777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971428.1|2686075_2686768_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	97.0	1.8e-123
2686277:2686292	attL	GGCACTGATGTAATCG	NA	NA	NA	NA
WP_143971429.1|2686818_2687574_-	Ig domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	96.0	9.7e-131
WP_143971430.1|2687638_2688007_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	31.4	2.2e-11
WP_143971431.1|2688003_2688372_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	69.7	9.1e-42
WP_143971432.1|2688373_2688715_-	hypothetical protein	NA	R9TRK0	Aeromonas_phage	43.4	4.5e-19
WP_025154868.1|2688711_2689083_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	46.3	7.6e-20
WP_143971433.1|2689082_2689307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971434.1|2689316_2690393_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	66.4	5.6e-132
WP_046024086.1|2690403_2690841_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.0	3.1e-41
WP_143971435.1|2690847_2692251_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	65.2	5.7e-161
WP_143971436.1|2692267_2693263_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	62.4	1.9e-105
WP_143972190.1|2693216_2694602_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	59.2	1.0e-149
WP_143971437.1|2694664_2695957_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	1.1e-147
WP_143971438.1|2696656_2696854_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	92.3	3.0e-28
WP_143971439.1|2697222_2697756_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	67.0	1.9e-64
WP_143971440.1|2698185_2698545_-	Rz1 lytic protein	NA	NA	NA	NA	NA
WP_143971441.1|2698892_2699369_-	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	94.3	7.3e-84
WP_052927923.1|2699365_2699554_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	72.9	2.9e-20
WP_143971442.1|2699742_2700201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115072134.1|2700434_2701565_-	DUF1133 family protein	NA	I7HBD4	Xanthomonas_virus	40.9	4.5e-23
WP_143971443.1|2701561_2701762_-	NinH	NA	NA	NA	NA	NA
WP_143971444.1|2701751_2702345_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	84.5	5.0e-82
WP_143971445.1|2702697_2703027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971446.1|2703023_2703467_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	55.6	2.1e-37
WP_143971447.1|2703489_2704269_-	DNA adenine methylase	NA	A0A2L0UZ77	Agrobacterium_phage	56.2	1.2e-67
WP_143971448.1|2704226_2704511_-	hypothetical protein	NA	V9SHM3	Achromobacter_phage	49.5	4.4e-20
WP_143971449.1|2704510_2704720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971450.1|2704706_2704916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143971451.1|2704940_2705636_-	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	49.6	2.0e-58
WP_143972191.1|2705632_2706034_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	58.2	1.0e-38
WP_143971452.1|2706579_2707374_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	51.5	7.9e-67
WP_036412777.1|2707674_2708007_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.2	6.9e-41
WP_015422887.1|2708126_2708318_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	50.8	9.9e-08
WP_004904144.1|2708413_2709124_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	65.3	3.3e-80
WP_143971453.1|2709177_2710095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143971454.1|2710098_2710842_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_143971455.1|2711239_2711521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143971456.1|2711609_2711831_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	52.9	6.9e-05
WP_143971457.1|2711888_2712122_+	DUF551 domain-containing protein	NA	A0A1B1W256	Salmonella_phage	49.4	1.1e-13
WP_046024055.1|2712528_2712759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098935849.1|2712736_2713555_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	78.7	1.8e-130
WP_143971458.1|2713547_2714348_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	89.0	2.7e-131
WP_049246559.1|2714404_2714677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143970877.1|2714695_2715058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143970876.1|2715212_2715401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143971459.1|2715384_2715735_+	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	48.0	4.3e-17
WP_143971460.1|2715712_2715946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143971461.1|2716922_2717279_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143971462.1|2717179_2718247_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	53.2	6.8e-114
2729390:2729405	attR	GGCACTGATGTAATCG	NA	NA	NA	NA
>prophage 10
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	2788555	2821289	4111737	transposase	Escherichia_phage(100.0%)	33	NA	NA
WP_023464298.1|2788555_2789320_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	8.7e-87
WP_033896018.1|2789359_2789566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|2789584_2789764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2789693_2790533_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2790526_2790874_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2791096_2791549_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2792289_2793102_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2793105_2793471_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2794147_2795689_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2796093_2796933_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2796926_2797274_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2797496_2797949_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2798689_2799502_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2799505_2799871_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2800547_2802089_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2802493_2803333_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2803326_2803674_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2803896_2804349_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2805089_2805902_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2805905_2806271_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2806947_2808489_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2808893_2809733_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2809726_2810074_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2810296_2810749_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2811489_2812302_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2812305_2812671_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2813347_2814889_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2815293_2816133_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2816126_2816474_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2816696_2817149_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2817889_2818702_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2818705_2819071_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2819747_2821289_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP041655	Morganella morganii strain SCMM102 chromosome, complete genome	4111737	2826147	2893939	4111737	transposase	Salmonella_phage(66.67%)	55	NA	NA
WP_000050481.1|2826147_2827689_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2828093_2828933_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2828926_2829274_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2829496_2829949_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2830689_2831502_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2831505_2831871_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2832547_2834089_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2834493_2835333_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2835326_2835674_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2835896_2836349_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2837089_2837902_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2837905_2838271_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2838947_2840489_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2840893_2841733_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2841726_2842074_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2842296_2842749_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2843489_2844302_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2844305_2844671_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2845347_2846889_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2847293_2848133_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2848126_2848474_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2848696_2849149_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2849889_2850702_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2850705_2851071_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2851747_2853289_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2853693_2854533_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2854526_2854874_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2855096_2855549_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2856289_2857102_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2857105_2857471_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2858147_2859689_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2860093_2860933_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2860926_2861274_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|2861496_2861949_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|2862689_2863502_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2863505_2863871_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|2864547_2866089_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2866493_2867333_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2867326_2867674_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000427614.1|2869798_2870803_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_100245271.1|2871108_2871345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219387.1|2872408_2873314_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|2873310_2874549_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|2874548_2875133_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|2875078_2875435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297012.1|2876473_2876587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|2876892_2877393_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143971500.1|2879270_2880797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014386410.1|2881195_2881975_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_143971501.1|2882315_2883848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_092594005.1|2884113_2885019_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_071534648.1|2886643_2887069_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|2887199_2887760_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_003158660.1|2890640_2893556_+|transposase	Tn3-like element IS1071 family transposase	transposase	NA	NA	NA	NA
WP_077260283.1|2893720_2893939_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	70.1	8.9e-21
