The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	30839	107025	5292479	head,plate,transposase,terminase,capsid,protease,tRNA,integrase,portal,tail	uncultured_Caudovirales_phage(21.62%)	84	55929:55985	107111:107167
WP_143855809.1|30839_31736_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	33.8	2.2e-25
WP_143855810.1|31991_36032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855811.1|36165_37956_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	29.1	2.3e-21
WP_143855812.1|38046_38709_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.2	3.9e-11
WP_143855813.1|38737_39028_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_143855814.1|39287_39722_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_143855815.1|40036_40717_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143855816.1|40776_41535_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_143855817.1|41814_42297_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_143855818.1|42483_43341_+	response regulator	NA	NA	NA	NA	NA
WP_143855819.1|43337_44189_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_143855820.1|44234_44693_+	response regulator	NA	NA	NA	NA	NA
WP_143855821.1|44729_45317_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_143855822.1|45306_45897_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	36.4	4.3e-17
WP_143855823.1|45938_46280_-	YraN family protein	NA	NA	NA	NA	NA
WP_143855824.1|46324_47500_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_143855825.1|47536_48355_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	6.3e-43
WP_143855826.1|48371_50864_-	DNA ligase D	NA	NA	NA	NA	NA
WP_143855827.1|50876_51785_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	36.3	5.4e-35
WP_144280533.1|52017_52497_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_143855828.1|52579_53782_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	26.1	1.8e-14
WP_143855829.1|54285_55341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855830.1|55352_55769_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	51.0	1.5e-21
55929:55985	attL	TCTGGTGCCCGGGGTCGGACTCGAACCGACACGCCTTGCGGCGGGGGATTTTGAGTC	NA	NA	NA	NA
WP_143855831.1|56826_57612_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_143855832.1|57626_62096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855833.1|62092_64672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855834.1|64975_65350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855835.1|65383_65896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855836.1|65885_66407_-	glycoside hydrolase family protein	NA	NA	NA	NA	NA
WP_143855837.1|66403_66652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855838.1|66721_67765_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.5	2.0e-81
WP_143855839.1|67767_67974_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	46.7	2.0e-06
WP_143855840.1|67948_68863_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	48.4	5.2e-30
WP_143855841.1|68872_71260_-|tail	phage tail tape measure protein	tail	F6MIL1	Haemophilus_phage	23.9	2.3e-08
WP_143855842.1|71353_71671_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_143855843.1|71774_72425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855844.1|72451_72955_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	53.9	1.5e-47
WP_143855845.1|72966_74136_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	75.5	7.9e-164
WP_143855846.1|74282_74576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855847.1|74660_74966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855848.1|74962_75505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855849.1|75509_76424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855850.1|76423_76744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855851.1|76795_77410_-	hypothetical protein	NA	V5YST5	Pseudomonas_phage	42.2	2.1e-35
WP_143855852.1|77417_78044_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	33.3	5.9e-17
WP_144280534.1|78033_78918_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	45.0	9.1e-64
WP_143855853.1|78923_79292_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	42.5	1.7e-16
WP_143855854.1|79288_79486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855855.1|79566_79839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855856.1|79835_80333_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	28.6	1.8e-16
WP_143855857.1|80301_80862_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	43.3	1.4e-25
WP_143855858.1|80848_81397_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_143855859.1|81396_81693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855860.1|81697_82693_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.5	2.0e-115
WP_143855861.1|82811_83531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855862.1|83557_84193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855863.1|84242_84590_-|head	head decoration protein	head	NA	NA	NA	NA
WP_143855864.1|84586_85708_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	50.0	6.1e-81
WP_143855865.1|85704_87177_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	64.0	2.0e-172
WP_143855866.1|87173_87386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855867.1|87396_89307_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	45.6	3.9e-128
WP_143855868.1|89221_89716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855869.1|90340_91252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855870.1|91335_91824_-	site-specific DNA-methyltransferase	NA	K7RG04	Vibrio_phage	62.3	5.8e-28
WP_143855871.1|91848_92472_-	site-specific DNA-methyltransferase	NA	K7RG04	Vibrio_phage	46.8	5.7e-44
WP_143855872.1|92452_92629_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_143855873.1|92886_94434_-	hypothetical protein	NA	Q38324	Lactococcus_phage	25.1	8.3e-20
WP_143855874.1|94693_95302_-	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	33.5	2.0e-17
WP_143855875.1|95301_95517_-	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	49.3	8.2e-11
WP_143855876.1|95513_95954_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	52.1	1.2e-32
WP_143855877.1|96189_96498_-	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	56.1	2.2e-25
WP_144280535.1|96494_96872_-	hypothetical protein	NA	A0A059VG13	Pseudomonas_phage	57.9	1.2e-25
WP_143855878.1|96922_98317_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	40.9	9.3e-79
WP_143855879.1|98313_99144_-	replication protein	NA	NA	NA	NA	NA
WP_143855880.1|99140_99356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855881.1|99717_100446_+	helix-turn-helix domain-containing protein	NA	A0A2D1GM27	Escherichia_phage	32.1	6.2e-18
WP_143855882.1|101496_102498_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_143855883.1|102771_103011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855884.1|103321_103819_+	siphovirus Gp157 family protein	NA	A0A2I7RAE0	Vibrio_phage	39.0	4.1e-21
WP_143855885.1|103829_104495_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	53.9	4.8e-65
WP_143855886.1|104515_105172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855887.1|105343_105580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143855888.1|105691_106174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143855889.1|106023_107025_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KGX2	Edwardsiella_phage	45.2	2.6e-83
107111:107167	attR	TCTGGTGCCCGGGGTCGGACTCGAACCGACACGCCTTGCGGCGGGGGATTTTGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	448574	517360	5292479	head,plate,terminase,capsid,protease,portal,integrase,tail	uncultured_Caudovirales_phage(41.67%)	71	447392:447407	490766:490781
447392:447407	attL	GGGTGCGGCTGTTGCC	NA	NA	NA	NA
WP_143856156.1|448574_449921_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_143856157.1|449968_451156_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_143856158.1|451158_451977_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_143856159.1|451970_452732_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.6	5.0e-18
WP_143856160.1|452742_453300_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_143856161.1|453466_454186_-	UMP kinase	NA	NA	NA	NA	NA
WP_143856162.1|454318_455191_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_143856163.1|455274_455997_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_143856164.1|456183_456984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856165.1|456980_457937_-	MCE family protein	NA	NA	NA	NA	NA
WP_143856166.1|457933_458485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856167.1|458481_459192_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_143856168.1|459424_460378_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.3	1.9e-54
WP_143856169.1|460436_460640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856170.1|460634_461792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856171.1|462213_463560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856172.1|463542_464100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280551.1|464317_464899_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_143856173.1|464982_465894_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_143856174.1|465953_466433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856175.1|466468_466852_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_143856176.1|467028_467718_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_143856177.1|467714_468470_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_143856178.1|468594_470403_+	thiamine pyrophosphate-binding protein	NA	C7U069	Ostreococcus_tauri_virus	21.2	1.2e-09
WP_143856179.1|470399_471218_+	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_143856180.1|471214_472021_+	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_143856181.1|472065_474183_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_143856182.1|474218_475445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280552.1|475461_479922_+	EAL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	4.1e-51
WP_143856183.1|479940_480636_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_143856184.1|480732_482196_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	31.1	1.4e-37
WP_143856185.1|483512_483848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856186.1|483822_484149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856187.1|484613_485831_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.5	1.8e-78
WP_143856188.1|486487_488827_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_143856189.1|488702_491213_+	hypothetical protein	NA	NA	NA	NA	NA
490766:490781	attR	GGGTGCGGCTGTTGCC	NA	NA	NA	NA
WP_143856190.1|491215_491926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856191.1|492022_492334_+	excisionase	NA	NA	NA	NA	NA
WP_143856192.1|492330_492831_-	glycoside hydrolase family protein	NA	A0A023ZU91	Escherichia_phage	34.5	8.1e-17
WP_143856193.1|492827_493076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856194.1|493143_494187_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.2	3.3e-81
WP_143856195.1|494189_494396_-|tail	phage tail protein	tail	M1RZ22	Escherichia_phage	46.7	9.0e-07
WP_144280553.1|494370_495174_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	45.6	8.4e-32
WP_143856196.1|495294_497685_-|tail	phage tail tape measure protein	tail	F6MIL1	Haemophilus_phage	23.8	5.1e-08
WP_143856197.1|497778_498102_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_143856198.1|498316_498892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856199.1|498932_499436_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	52.7	2.0e-47
WP_143856200.1|499447_500617_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.5	1.4e-160
WP_143856201.1|500823_501141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856202.1|501257_501530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856203.1|501574_502186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856204.1|502182_502725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856205.1|502729_503644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856206.1|503643_503961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856207.1|504024_504639_-	hypothetical protein	NA	V5YST5	Pseudomonas_phage	42.2	1.6e-35
WP_143856208.1|504646_505273_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	32.0	5.9e-17
WP_143856209.1|505262_506156_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	45.0	6.0e-63
WP_143856210.1|506152_506518_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	41.6	3.2e-15
WP_143856211.1|506517_506712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856212.1|506783_507056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856213.1|507052_507682_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	7.5e-20
WP_143856214.1|507518_508079_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.3	8.7e-28
WP_143856215.1|508065_508614_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.4	2.0e-13
WP_143856216.1|508610_508910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856217.1|508914_509910_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.7	1.2e-117
WP_143856218.1|510067_512221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856219.1|512273_512621_-|head	head decoration protein	head	NA	NA	NA	NA
WP_144280554.1|512620_513730_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.1	7.2e-82
WP_143856220.1|513738_515211_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	61.4	7.9e-161
WP_143856221.1|515207_515420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856222.1|515446_517360_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	45.4	8.7e-128
>prophage 3
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	526242	535417	5292479		Escherichia_phage(27.27%)	15	NA	NA
WP_143856229.1|526242_526836_-	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	36.2	6.0e-19
WP_143856230.1|526835_527054_-	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	47.8	9.2e-10
WP_143856231.1|527050_527491_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	58.4	6.2e-37
WP_143856232.1|527725_528034_-	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	55.1	7.6e-26
WP_144280556.1|528030_528408_-	hypothetical protein	NA	A0A059VG13	Pseudomonas_phage	57.9	9.4e-26
WP_143856233.1|528458_529391_-	AAA family ATPase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	31.9	3.8e-20
WP_143856234.1|529387_530782_-	replicative DNA helicase	NA	O80281	Escherichia_phage	42.0	2.3e-77
WP_143856235.1|530778_531609_-	replication protein	NA	NA	NA	NA	NA
WP_143856236.1|531605_531872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143856237.1|531895_532177_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	37.5	1.7e-11
WP_143856238.1|532259_532988_+	helix-turn-helix domain-containing protein	NA	A0A0R6PKV4	Moraxella_phage	29.3	7.6e-16
WP_143856239.1|533841_534081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856240.1|534077_534227_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_143856241.1|534245_534743_+	siphovirus Gp157 family protein	NA	A0A2I7RAE0	Vibrio_phage	35.6	1.9e-18
WP_143856242.1|534751_535417_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	53.9	4.8e-65
>prophage 4
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	964892	974317	5292479		Vibrio_phage(25.0%)	14	NA	NA
WP_143856554.1|964892_965609_-	helix-turn-helix domain-containing protein	NA	R9TNM0	Vibrio_phage	29.9	9.5e-19
WP_143856555.1|965690_965885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856556.1|966118_966334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856557.1|966330_967161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856558.1|967157_968552_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	39.4	6.7e-69
WP_144280573.1|968602_968980_+	hypothetical protein	NA	A0A059VG13	Pseudomonas_phage	60.0	7.2e-26
WP_143856559.1|968976_969285_+	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	54.1	6.5e-25
WP_143856560.1|969520_969961_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	57.1	3.6e-37
WP_143856561.1|969957_970176_+	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	47.2	6.4e-11
WP_143856562.1|970175_970802_+	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	35.2	1.8e-18
WP_143856563.1|971045_971885_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_143856564.1|971859_972372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856565.1|972381_973068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856566.1|973534_974317_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	32.7	5.0e-05
>prophage 5
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	1400460	1407639	5292479	integrase	Salmonella_phage(16.67%)	8	1388191:1388206	1425604:1425619
1388191:1388206	attL	GGCTTCGCCCTCGGCC	NA	NA	NA	NA
WP_143856898.1|1400460_1401351_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	53.9	1.0e-75
WP_143856899.1|1401616_1402654_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	46.1	4.8e-88
WP_143856900.1|1402503_1402857_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143856901.1|1403530_1404262_-	helix-turn-helix domain-containing protein	NA	A0A0P0J076	Acinetobacter_phage	54.3	2.5e-14
WP_143856902.1|1404369_1404564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856903.1|1404881_1405739_+	replication protein	NA	I6PDJ3	Cronobacter_phage	46.1	2.7e-12
WP_143856904.1|1405735_1407157_+	AAA family ATPase	NA	I6S783	Marinomonas_phage	35.9	5.4e-66
WP_143856905.1|1407072_1407639_+	hypothetical protein	NA	M4QNU5	Tetraselmis_viridis_virus	28.4	3.6e-05
1425604:1425619	attR	GGCCGAGGGCGAAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	3425041	3516923	5292479	head,plate,holin,terminase,capsid,protease,tRNA,portal,tail	Burkholderia_phage(22.5%)	96	NA	NA
WP_144279032.1|3425041_3426952_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	7.4e-111
WP_144279033.1|3427234_3428065_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	33.7	4.5e-20
WP_144279034.1|3428107_3429463_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_144279035.1|3429528_3430779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279036.1|3431073_3431898_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	35.0	1.6e-14
WP_144279037.1|3432058_3432904_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_144279038.1|3432918_3433923_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_144279039.1|3434005_3435049_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	39.6	5.6e-52
WP_144279040.1|3435509_3435863_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_144279041.1|3436090_3436459_+	NAD(P)H-quinone oxidoreductase subunit 3	NA	NA	NA	NA	NA
WP_144279042.1|3436449_3436944_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_144279043.1|3436958_3437552_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_144279044.1|3437544_3438798_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_144279045.1|3438797_3439271_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_144279046.1|3439286_3440576_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_144279047.1|3440667_3442998_+	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_144279048.1|3443008_3444067_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_144279049.1|3444077_3444566_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_144279050.1|3444596_3445247_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_144279051.1|3445262_3445565_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_144279052.1|3445644_3447699_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_144279053.1|3447750_3449247_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_144279054.1|3449281_3450736_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_144279055.1|3450732_3451035_+	DUF2818 family protein	NA	NA	NA	NA	NA
WP_144279056.1|3451353_3453252_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.6	4.2e-130
WP_144280705.1|3453336_3453858_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	3.8e-09
WP_028445459.1|3454007_3454208_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_144279057.1|3454230_3454590_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_144279058.1|3454730_3455729_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.3	3.2e-33
WP_144279059.1|3455826_3458190_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_144280706.1|3458227_3458542_+	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	42.2	4.4e-13
WP_144280707.1|3458516_3458924_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144279060.1|3459145_3459991_-	DUF817 family protein	NA	NA	NA	NA	NA
WP_144279061.1|3460586_3461096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279062.1|3461656_3461815_+	DUF3309 family protein	NA	NA	NA	NA	NA
WP_144279063.1|3462130_3462643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279064.1|3462643_3464914_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_144279065.1|3464910_3466536_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_144279066.1|3466640_3467567_-	flavohemoprotein	NA	NA	NA	NA	NA
WP_144279067.1|3467656_3469330_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	45.1	3.2e-126
WP_144279068.1|3469272_3469554_-	hypothetical protein	NA	A8YQQ5	Burkholderia_virus	40.0	2.4e-10
WP_144280708.1|3469679_3469907_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_144279069.1|3469938_3470250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279070.1|3470338_3472411_-	replication endonuclease	NA	Q1I108	Pasteurella_virus	29.2	7.4e-32
WP_143855781.1|3472407_3472725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855780.1|3472727_3473099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855779.1|3473155_3473488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143855778.1|3473614_3473986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279071.1|3474468_3475044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279072.1|3475358_3475907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279073.1|3476079_3477117_-	phage late control D family protein	NA	A0A077KES1	Ralstonia_phage	51.0	5.1e-90
WP_144279074.1|3477103_3477520_-|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	59.0	1.8e-38
WP_144279075.1|3477532_3480202_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	36.4	1.3e-105
WP_144279076.1|3480400_3481249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279077.1|3481376_3482501_-	site-specific DNA-methyltransferase	NA	K7RG04	Vibrio_phage	51.0	4.3e-74
WP_144279078.1|3482541_3482661_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	69.2	1.9e-09
WP_144279079.1|3482811_3482928_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_144280709.1|3482936_3483251_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	58.5	3.1e-22
WP_144279080.1|3483313_3483823_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	64.9	2.5e-58
WP_144279081.1|3483849_3485022_-|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	73.1	8.7e-163
WP_144279082.1|3486228_3487236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279083.1|3487328_3488174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279084.1|3488321_3488909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279085.1|3488993_3489935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279086.1|3490095_3492537_-	S8 family serine peptidase	NA	A0A2K9L570	Tupanvirus	30.8	1.4e-13
WP_144279087.1|3492647_3493073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279088.1|3493461_3494004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279089.1|3494006_3494921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279090.1|3494924_3495245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279091.1|3495299_3495914_-	hypothetical protein	NA	V5YST5	Pseudomonas_phage	49.2	5.6e-44
WP_144279092.1|3495922_3497632_-	hypothetical protein	NA	A0A1B0XUH9	Freshwater_phage	36.1	2.4e-20
WP_144279093.1|3497635_3498331_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	34.7	3.0e-25
WP_144279094.1|3498287_3499172_-	hypothetical protein	NA	E5G6N8	Salmonella_phage	44.7	3.6e-60
WP_144280710.1|3499168_3499525_-	hypothetical protein	NA	E5E3R0	Burkholderia_phage	52.1	1.0e-26
WP_144279095.1|3499532_3500258_-|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	43.5	3.1e-41
WP_144279096.1|3500349_3500886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279097.1|3500852_3501302_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	44.5	1.3e-26
WP_144279098.1|3501298_3501775_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	51.4	6.5e-32
WP_144279099.1|3501749_3502028_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	44.6	3.3e-12
WP_144279100.1|3502301_3503111_-	DUF3380 domain-containing protein	NA	A0A077K808	Ralstonia_phage	58.7	5.4e-79
WP_144279101.1|3503107_3503422_-|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	42.5	7.8e-10
WP_144279102.1|3503418_3503808_-	hypothetical protein	NA	E5E3R9	Burkholderia_phage	42.4	8.8e-19
WP_144279103.1|3503810_3504017_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	3.7e-16
WP_144279104.1|3504016_3504490_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	52.2	2.2e-32
WP_144279105.1|3504594_3505293_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	51.3	2.8e-52
WP_144279106.1|3505289_3506318_-|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	66.5	1.3e-125
WP_144279107.1|3506354_3507161_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	42.6	1.2e-49
WP_144279108.1|3507293_3509078_+|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	66.0	1.2e-232
WP_144279109.1|3509077_3510118_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.4	3.0e-130
WP_144279110.1|3510910_3511363_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_144279111.1|3511532_3512255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279112.1|3512451_3513111_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_144279113.1|3513113_3513608_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_144279114.1|3513674_3514937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279115.1|3515043_3515985_-	TerC/Alx family metal homeostasis membrane protein	NA	K4F9T9	Cronobacter_phage	35.0	2.6e-40
WP_144279116.1|3516044_3516923_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	4079562	4156221	5292479	head,plate,terminase,capsid,protease,portal,tRNA,integrase,tail	uncultured_Caudovirales_phage(26.47%)	82	4099015:4099030	4157456:4157471
WP_144279576.1|4079562_4080921_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_144279577.1|4080915_4081335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279578.1|4082087_4082510_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	45.5	1.7e-20
WP_144279579.1|4082527_4083634_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_144279580.1|4083637_4084384_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_144279581.1|4084413_4085409_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_144279582.1|4085412_4086690_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_144279583.1|4086694_4087951_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144279584.1|4087955_4088216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279585.1|4088221_4088854_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144279586.1|4088853_4089969_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_144279587.1|4089981_4091436_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144279588.1|4091572_4091830_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_144279589.1|4091941_4093048_+	GTPase HflX	NA	NA	NA	NA	NA
WP_144279590.1|4093055_4094228_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_144279591.1|4094229_4095099_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_144279592.1|4095295_4096450_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_144279593.1|4096528_4097824_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	34.4	3.8e-66
WP_144279594.1|4097872_4098631_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_144279595.1|4098769_4099516_+	hypothetical protein	NA	NA	NA	NA	NA
4099015:4099030	attL	TGGCCTGGATGCCACG	NA	NA	NA	NA
WP_144279596.1|4100637_4101027_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_144279597.1|4101277_4102282_-|integrase	tyrosine-type recombinase/integrase	integrase	B6SCW8	Bacteriophage	40.2	2.6e-70
WP_144279598.1|4102152_4102578_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144279599.1|4102818_4103055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279600.1|4103234_4103891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279601.1|4103911_4104577_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	52.7	1.8e-64
WP_144279602.1|4104586_4105084_-	siphovirus Gp157 family protein	NA	A0A2I7RAE0	Vibrio_phage	38.4	1.6e-20
WP_144279603.1|4105394_4105634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279604.1|4105914_4106169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279605.1|4106485_4107214_-	helix-turn-helix domain-containing protein	NA	A0A2D1GM27	Escherichia_phage	32.1	1.6e-18
WP_144279606.1|4107575_4107791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279607.1|4107787_4108618_+	replication protein	NA	NA	NA	NA	NA
WP_144279608.1|4108614_4110009_+	replicative DNA helicase	NA	O80281	Escherichia_phage	41.1	8.7e-77
WP_144279609.1|4110005_4110938_+	AAA family ATPase	NA	A0A125RNK2	Pseudomonas_phage	36.7	2.2e-20
WP_144280746.1|4110988_4111366_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	58.9	9.4e-26
WP_144279610.1|4111362_4111671_+	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	57.1	4.5e-26
WP_144279611.1|4111667_4111883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279612.1|4111906_4112347_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	56.2	1.1e-36
WP_144279613.1|4112343_4112547_+	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	57.7	1.3e-10
WP_144279614.1|4112546_4113155_+	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	34.0	2.0e-17
WP_144279615.1|4113314_4115015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279616.1|4115600_4117037_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.7e-19
WP_144280747.1|4117429_4117783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279617.1|4118061_4118526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279618.1|4119020_4119557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279619.1|4119471_4121373_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	45.2	3.3e-127
WP_144279620.1|4121395_4121608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279621.1|4121604_4123077_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	62.1	2.1e-161
WP_144279622.1|4123073_4124195_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.3	2.1e-81
WP_144279623.1|4124194_4124542_+|head	head decoration protein	head	NA	NA	NA	NA
WP_144279624.1|4124609_4126844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279625.1|4126915_4127911_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.1	5.6e-118
WP_144279626.1|4127915_4128215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279627.1|4128211_4128760_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_144279628.1|4128746_4129307_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	45.5	7.4e-27
WP_144279629.1|4129296_4129773_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	33.1	6.3e-19
WP_144279630.1|4129769_4130042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279631.1|4130122_4130317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279632.1|4130316_4130682_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	41.6	1.9e-15
WP_144279633.1|4130678_4131572_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	44.0	5.1e-62
WP_144279634.1|4131561_4132188_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	32.5	4.5e-17
WP_144279635.1|4132195_4132810_+	hypothetical protein	NA	V5YST5	Pseudomonas_phage	42.2	1.6e-35
WP_144279636.1|4132861_4133182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279637.1|4133181_4134096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279638.1|4134100_4134643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279639.1|4134688_4135006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279640.1|4135219_4136389_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.9	4.8e-161
WP_144279641.1|4136400_4136904_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	54.5	5.2e-48
WP_144279642.1|4136912_4137572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279643.1|4137675_4138002_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_144279644.1|4138095_4140486_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	22.4	5.1e-08
WP_144280748.1|4140606_4141410_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.4	1.1e-28
WP_144279645.1|4141384_4141591_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	46.7	1.2e-06
WP_144279646.1|4141593_4142637_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.2	3.3e-81
WP_144279647.1|4142706_4142955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279648.1|4142951_4143473_+	glycoside hydrolase family protein	NA	A0A173GD86	Pseudomonas_phage	40.3	8.4e-17
WP_144279649.1|4143462_4143960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279650.1|4144051_4146061_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.6	4.2e-24
WP_144279651.1|4146283_4153243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279652.1|4153249_4153984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279653.1|4154215_4154878_+	SOS response-associated peptidase	NA	A0A2D1GMM4	Marinobacter_phage	52.9	1.2e-63
WP_144279654.1|4155177_4156221_-|integrase	tyrosine-type recombinase/integrase	integrase	S5FNS2	Shigella_phage	42.5	2.1e-83
4157456:4157471	attR	TGGCCTGGATGCCACG	NA	NA	NA	NA
>prophage 8
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	4160276	4166165	5292479		Vibrio_phage(28.57%)	11	NA	NA
WP_143856554.1|4160276_4160993_-	helix-turn-helix domain-containing protein	NA	R9TNM0	Vibrio_phage	29.9	9.5e-19
WP_143856555.1|4161074_4161269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143856556.1|4161502_4161718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279660.1|4161714_4162545_+	replication protein	NA	NA	NA	NA	NA
WP_144279661.1|4162541_4163936_+	replicative DNA helicase	NA	O80281	Escherichia_phage	40.9	5.6e-76
WP_144280749.1|4163986_4164364_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	56.8	2.1e-25
WP_144279662.1|4164360_4164669_+	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	55.1	8.4e-25
WP_144279663.1|4164665_4164881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279664.1|4164904_4165345_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	56.6	2.8e-37
WP_144279665.1|4165341_4165557_+	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	52.5	1.1e-10
WP_144279666.1|4165556_4166165_+	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	35.0	3.1e-18
>prophage 9
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	4173713	4207314	5292479	head,plate,terminase,capsid,protease,portal,tail	uncultured_Caudovirales_phage(55.0%)	45	NA	NA
WP_144279675.1|4173713_4175624_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	44.2	7.9e-129
WP_144279676.1|4175651_4175864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279677.1|4175860_4177336_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	61.4	2.2e-163
WP_144279678.1|4177332_4178454_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	1.2e-81
WP_144279679.1|4178453_4178801_+|head	head decoration protein	head	NA	NA	NA	NA
WP_144279680.1|4178901_4179735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279681.1|4179813_4180809_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.1	5.6e-118
WP_144279682.1|4180813_4181110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279683.1|4181177_4181429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280752.1|4181415_4181961_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.6	2.9e-12
WP_144279684.1|4181947_4182508_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	44.0	2.1e-26
WP_144279685.1|4182383_4182974_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	32.5	1.0e-18
WP_144279686.1|4182970_4183240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279687.1|4183533_4184211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279688.1|4184516_4184714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279689.1|4184713_4185079_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	41.6	1.4e-15
WP_144279690.1|4185075_4185969_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	45.0	2.1e-63
WP_144279691.1|4185958_4186585_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	42.1	1.2e-17
WP_144279692.1|4186592_4187207_+	hypothetical protein	NA	V5YST5	Pseudomonas_phage	42.2	1.6e-35
WP_144279693.1|4187257_4187578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279694.1|4187577_4188492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279695.1|4188496_4189039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279696.1|4189035_4189341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279697.1|4189602_4190772_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	75.0	9.6e-162
WP_144279698.1|4190783_4191287_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	53.9	5.2e-48
WP_144279699.1|4191304_4191964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279700.1|4192067_4192394_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_144279701.1|4192487_4194878_+|tail	phage tail tape measure protein	tail	F6MIL1	Haemophilus_phage	23.6	8.6e-08
WP_144280753.1|4194998_4195802_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	39.2	9.9e-33
WP_144279702.1|4195776_4195983_+|tail	phage tail protein	tail	M1RZ22	Escherichia_phage	46.7	9.0e-07
WP_144279703.1|4195985_4197029_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	45.3	4.1e-79
WP_144279704.1|4197098_4197347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279705.1|4197343_4197865_+	glycoside hydrolase family protein	NA	NA	NA	NA	NA
WP_144279706.1|4197905_4198136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279707.1|4198116_4198311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279708.1|4198443_4200453_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	2.5e-24
WP_144279709.1|4200675_4201869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279710.1|4203227_4203431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279711.1|4203624_4204470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279712.1|4204469_4204982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279713.1|4205348_4205615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144279714.1|4205759_4206224_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	49.0	2.0e-30
WP_144279715.1|4206270_4206627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279716.1|4206655_4206919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144279717.1|4207005_4207314_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	54.5	9.0e-27
>prophage 10
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	5033244	5088347	5292479	protease,transposase,plate	Bacillus_phage(50.0%)	46	NA	NA
WP_144280546.1|5033244_5034324_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144280340.1|5034379_5035759_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.7	1.1e-26
WP_144280341.1|5036536_5040391_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	28.5	1.8e-10
WP_144280342.1|5040387_5041746_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_144280343.1|5042128_5042980_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_144280344.1|5043109_5044219_+	Vps62-related protein	NA	NA	NA	NA	NA
WP_144280345.1|5044291_5045755_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.4	1.3e-27
WP_144280795.1|5045754_5046432_+	response regulator	NA	W8CYM9	Bacillus_phage	33.2	4.3e-29
WP_144280346.1|5046462_5047467_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_144280347.1|5047611_5048490_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144280348.1|5048561_5051351_+	HAD-IC family P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	28.2	8.1e-74
WP_144280349.1|5051493_5051886_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_144280796.1|5051928_5052153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280350.1|5053505_5054522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280351.1|5054667_5055126_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_144280797.1|5057077_5057560_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_144280352.1|5058600_5059002_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_144280353.1|5059001_5059238_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_144280354.1|5059451_5060309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280355.1|5060802_5062275_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_144280356.1|5062304_5062532_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_144280357.1|5062513_5062945_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_144280798.1|5063355_5064561_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_144280358.1|5064610_5065207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280359.1|5065390_5066044_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_144280360.1|5066124_5066610_+	DUF3291 domain-containing protein	NA	NA	NA	NA	NA
WP_144280361.1|5066632_5067160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144280362.1|5067198_5068584_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_144280363.1|5068700_5069339_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_144280364.1|5069335_5070313_+	phosphotransferase	NA	NA	NA	NA	NA
WP_144280365.1|5070738_5071125_-	VOC family protein	NA	NA	NA	NA	NA
WP_144280366.1|5071350_5073216_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_144280367.1|5073300_5074215_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_144280368.1|5074167_5074887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144280369.1|5074959_5075358_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_144280370.1|5075354_5076053_+	amino acid racemase	NA	NA	NA	NA	NA
WP_144280371.1|5076117_5076888_+	DUF1275 family protein	NA	NA	NA	NA	NA
WP_144280372.1|5076921_5077197_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144280373.1|5077196_5077472_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_144280374.1|5077621_5078977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280375.1|5079035_5081273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280376.1|5081275_5084497_-|plate	putative baseplate assembly protein	plate	J9PV89	Bacillus_phage	28.4	9.5e-18
WP_144280377.1|5084483_5087030_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_144280378.1|5087042_5087399_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_144280379.1|5087427_5087751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280380.1|5087807_5088347_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 11
NZ_CP041730	Chitinimonas sp. R3-44 chromosome, complete genome	5292479	5190017	5285790	5292479	head,plate,holin,transposase,terminase,capsid,protease,portal,tRNA,tail	Burkholderia_phage(23.08%)	89	NA	NA
WP_144280454.1|5190017_5190335_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_144280455.1|5190814_5191774_-	peptidase	NA	A0A2P1ELG2	Moumouvirus	34.0	8.8e-12
WP_144280456.1|5192582_5192921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280457.1|5193520_5194129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280458.1|5194580_5195669_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	3.3e-15
WP_144280459.1|5195668_5197537_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	5.7e-15
WP_144280460.1|5197684_5198728_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_144280461.1|5198866_5199706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280462.1|5200012_5200648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280090.1|5200736_5201908_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.9e-63
WP_144280463.1|5201969_5203541_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_144280090.1|5203597_5204769_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.9e-63
WP_144280464.1|5204790_5208492_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	24.9	1.1e-70
WP_144280465.1|5208460_5211940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280466.1|5212009_5212219_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_144280467.1|5213489_5213843_-	copper-binding protein	NA	NA	NA	NA	NA
WP_144280801.1|5213839_5214250_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_144280468.1|5214359_5215730_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_144280469.1|5215746_5217174_-	TolC family protein	NA	NA	NA	NA	NA
WP_144280470.1|5217318_5217990_+	heavy metal response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	24.8	9.5e-05
WP_144280471.1|5217986_5219372_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.9	2.6e-12
WP_144280472.1|5219382_5220588_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_144280473.1|5220607_5222023_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_144280474.1|5222103_5223042_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144280475.1|5223086_5223566_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	43.2	3.8e-08
WP_144280476.1|5223578_5224610_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144280477.1|5224681_5226340_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_144280478.1|5226400_5227279_-	NAD kinase	NA	NA	NA	NA	NA
WP_144280479.1|5227334_5227607_-	mitomycin resistance protein	NA	NA	NA	NA	NA
WP_144280802.1|5227618_5228368_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144280480.1|5228728_5229745_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_144280803.1|5229916_5230864_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_144280546.1|5230941_5232021_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144280481.1|5232083_5232437_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	32.3	7.0e-07
WP_144280482.1|5232436_5232679_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144280483.1|5232967_5234302_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_144280484.1|5234345_5236124_-	DUF1800 family protein	NA	NA	NA	NA	NA
WP_144280485.1|5236196_5237546_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_144280486.1|5237672_5238257_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_144280487.1|5238249_5238819_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_144280488.1|5240269_5242078_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_144280489.1|5242109_5242439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280490.1|5242504_5242873_-	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_144280491.1|5242950_5244669_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_144280492.1|5244691_5246173_+	amidase	NA	NA	NA	NA	NA
WP_144280493.1|5246186_5247332_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	34.0	6.4e-17
WP_144280494.1|5247592_5247997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280495.1|5248085_5248850_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144280496.1|5248854_5249919_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_144280497.1|5249915_5251745_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_144280498.1|5251791_5253453_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	53.9	7.8e-157
WP_144280499.1|5253774_5254701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280500.1|5254704_5255445_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_144280501.1|5255504_5256476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280804.1|5256622_5257669_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	63.5	5.6e-129
WP_144280502.1|5257677_5259462_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	66.2	1.4e-233
WP_144280503.1|5259429_5260401_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	43.3	5.7e-51
WP_144280504.1|5260436_5261465_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	66.2	1.7e-125
WP_144279105.1|5261461_5262160_+|terminase	terminase	terminase	A4PE31	Ralstonia_virus	51.3	2.8e-52
WP_144279104.1|5262264_5262738_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	52.2	2.2e-32
WP_144279103.1|5262737_5262944_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	3.7e-16
WP_144279102.1|5262946_5263336_+	hypothetical protein	NA	E5E3R9	Burkholderia_phage	42.4	8.8e-19
WP_144279101.1|5263332_5263647_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	42.5	7.8e-10
WP_144280505.1|5263643_5264453_+	DUF3380 domain-containing protein	NA	A0A077K808	Ralstonia_phage	57.9	7.0e-79
WP_144280506.1|5264726_5265005_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	43.8	4.3e-12
WP_144280507.1|5264979_5265456_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	47.2	1.4e-26
WP_144280508.1|5265452_5265920_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	40.3	5.6e-20
WP_144280509.1|5265967_5266615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280510.1|5266637_5267039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280511.1|5267198_5267810_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	46.4	1.4e-42
WP_144280512.1|5267817_5268174_+	hypothetical protein	NA	E5E3R0	Burkholderia_phage	52.1	3.6e-27
WP_144280513.1|5268170_5269055_+	hypothetical protein	NA	V9IQV9	Stenotrophomonas_phage	44.9	1.1e-61
WP_144280514.1|5269008_5269707_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	33.7	2.1e-23
WP_144280515.1|5269710_5271420_+	hypothetical protein	NA	A0A1B0XUH9	Freshwater_phage	45.0	9.2e-20
WP_144280516.1|5271428_5272043_+	hypothetical protein	NA	V5YST5	Pseudomonas_phage	48.1	3.6e-43
WP_144279090.1|5272097_5272418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280517.1|5272421_5273336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280518.1|5273338_5273881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280519.1|5274312_5274750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280520.1|5274902_5277311_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	29.1	3.9e-24
WP_144280521.1|5277485_5278658_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	73.3	2.3e-163
WP_144280522.1|5278684_5279194_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	63.7	2.1e-57
WP_144280805.1|5279256_5279571_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	59.8	1.5e-21
WP_144280523.1|5279579_5279696_+|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	70.6	4.3e-06
WP_144280524.1|5279882_5280068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144280525.1|5280313_5280958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144280526.1|5281667_5284337_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	36.6	5.3e-107
WP_144279074.1|5284349_5284766_+|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	59.0	1.8e-38
WP_144279073.1|5284752_5285790_+	phage late control D family protein	NA	A0A077KES1	Ralstonia_phage	51.0	5.1e-90
