The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041733	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 chromosome, complete genome	4804295	1803606	1864135	4804295	protease,tRNA,terminase,integrase,capsid,holin,tail,head,portal	Enterobacterial_phage(24.07%)	81	1806365:1806380	1844549:1844564
WP_032103856.1|1803606_1804719_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015570797.1|1804759_1805233_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017693618.1|1805232_1805895_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1806012_1807263_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
1806365:1806380	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_063135241.1|1807374_1808112_-	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	43.1	4.3e-51
WP_063135240.1|1808108_1808843_-	protein kinase family protein	NA	I6PD73	Cronobacter_phage	36.7	1.4e-33
WP_023292711.1|1809575_1809728_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.0	3.4e-19
WP_015570796.1|1809803_1810049_+	YmjA family protein	NA	NA	NA	NA	NA
WP_047735062.1|1810053_1811553_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_071524166.1|1811677_1811770_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1812139_1812388_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1812441_1812516_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1812516_1812615_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032653235.1|1812660_1813689_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.6	3.2e-12
WP_015570791.1|1814001_1814256_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|1814336_1814642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570789.1|1814642_1814987_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_047637426.1|1815138_1815846_+	CTP synthase	NA	NA	NA	NA	NA
WP_023303489.1|1815877_1817065_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_017384695.1|1817164_1817956_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1817939_1818386_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023303491.1|1818492_1820529_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_015570785.1|1820544_1821876_-	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_023303492.1|1822284_1822785_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032103854.1|1823004_1824147_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	6.4e-94
WP_022650818.1|1824121_1824385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045345724.1|1824417_1824687_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	75.3	3.1e-31
WP_032620364.1|1824766_1825111_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_063436968.1|1825708_1826536_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	86.3	2.8e-123
WP_144428040.1|1826535_1826949_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	84.7	6.2e-55
WP_144427735.1|1826997_1827318_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	54.7	1.8e-25
WP_063419993.1|1828091_1828739_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	1.9e-74
WP_016530206.1|1828843_1829041_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_063866408.1|1829066_1829537_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.3	1.4e-74
WP_063945205.1|1829777_1829957_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.1e-14
WP_144427736.1|1829946_1830825_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.0	7.0e-40
WP_144427737.1|1830821_1831316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427738.1|1831315_1831975_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.4	2.1e-97
WP_144427739.1|1831971_1832301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006809179.1|1832297_1832525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032103831.1|1832521_1832842_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	1.2e-42
WP_045325138.1|1832838_1833228_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.3	2.1e-68
WP_144427740.1|1833224_1834214_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	85.1	1.1e-166
WP_144427741.1|1834226_1834805_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	5.6e-46
WP_144427742.1|1834919_1835492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022648767.1|1835581_1835977_+	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_144427743.1|1835963_1836245_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	91.4	2.0e-41
WP_144427744.1|1836244_1836874_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	2.1e-102
WP_144427745.1|1836881_1837151_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.7	3.2e-28
WP_045334178.1|1837107_1837302_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	3.7e-18
WP_144427746.1|1837427_1838252_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	74.2	3.2e-18
WP_144427747.1|1838263_1839721_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.7	6.0e-270
WP_144427748.1|1839733_1839943_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_144427749.1|1839889_1840153_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_144428041.1|1840316_1840907_+	hypothetical protein	NA	S4TR53	Salmonella_phage	85.6	1.0e-98
WP_032619870.1|1840906_1841257_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_022650844.1|1841414_1841888_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	2.3e-85
WP_144427750.1|1841887_1843624_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_032104390.1|1843623_1844928_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.3	4.7e-234
1844549:1844564	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_144427751.1|1844941_1845790_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.1	2.7e-137
WP_144427752.1|1845799_1847011_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.7	9.9e-194
WP_144427753.1|1847053_1847380_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	86.1	1.2e-48
WP_126542737.1|1847443_1847656_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	62.5	2.1e-11
WP_144427754.1|1847657_1847990_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	85.5	1.8e-49
WP_144427755.1|1847982_1848522_+	HK97 gp10 family phage protein	NA	Q9MCV1	Escherichia_phage	85.3	6.5e-81
WP_049012839.1|1848518_1848884_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	68.6	1.0e-45
WP_144427756.1|1848939_1849431_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	71.6	8.1e-62
WP_047741118.1|1849484_1849862_+|tail	phage tail assembly protein	tail	K7PJU9	Enterobacteria_phage	77.2	5.1e-48
WP_058663178.1|1849873_1850128_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	62.7	3.1e-25
WP_058685377.1|1850129_1852685_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	46.8	2.1e-177
WP_048974390.1|1852684_1853158_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	1.4e-58
WP_048974389.1|1853154_1853637_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	71.2	1.5e-60
WP_048974387.1|1853646_1854027_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	2.2e-59
WP_144427757.1|1854023_1856738_+	kinase	NA	A0A286S259	Klebsiella_phage	57.5	0.0e+00
WP_023303499.1|1856787_1859163_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	32.7	1.5e-92
WP_144427758.1|1859202_1860648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144427759.1|1860644_1861562_-	glycosyltransferase	NA	U5P087	Shigella_phage	90.5	2.5e-157
WP_023303502.1|1861558_1861921_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	5.8e-49
WP_023303503.1|1862033_1862273_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	66.7	8.5e-25
WP_023303504.1|1862272_1862593_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.4e-25
WP_023303505.1|1862851_1864135_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
>prophage 2
NZ_CP041733	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 chromosome, complete genome	4804295	2033546	2144380	4804295	lysis,holin,tail,head,terminase	Salmonella_phage(28.93%)	148	NA	NA
WP_023332828.1|2033546_2034827_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	2.5e-123
WP_022650951.1|2034859_2035108_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_023306352.1|2035217_2035448_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	9.7e-34
WP_129318017.1|2035456_2035696_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	75.6	9.8e-29
WP_144428042.1|2035673_2036279_-	hypothetical protein	NA	Q71T76	Escherichia_phage	49.8	7.9e-51
WP_144427789.1|2036290_2036509_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	63.4	1.6e-17
WP_063944929.1|2036600_2036792_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	66.1	1.4e-14
WP_144427790.1|2036788_2036989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006176198.1|2036985_2037204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063944930.1|2037200_2037752_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	2.8e-55
WP_063624365.1|2037912_2038341_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	2.0e-72
WP_032105028.1|2038349_2038832_-	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	99.4	8.4e-80
WP_063944931.1|2038828_2039743_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	99.7	1.0e-171
WP_063944932.1|2039752_2040034_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	96.8	5.5e-47
WP_006809788.1|2040105_2040315_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_063944933.1|2040466_2040976_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.6	1.2e-89
WP_023330696.1|2041137_2041368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063840716.1|2042069_2042267_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	98.4	6.4e-26
WP_032667315.1|2042412_2043186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144427791.1|2043328_2043988_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	64.6	3.4e-71
WP_022650973.1|2044096_2044315_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_144427792.1|2044345_2044888_+	regulator	NA	M9NZI6	Enterobacteria_phage	85.6	9.5e-80
WP_144427793.1|2045073_2046039_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	95.5	4.5e-72
WP_144427794.1|2046035_2046725_+	phage replication protein	NA	G8C7U6	Escherichia_phage	96.1	1.7e-126
WP_144427795.1|2046726_2047071_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	96.5	6.1e-56
WP_144427796.1|2047067_2047364_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	5.4e-29
WP_144427797.1|2047360_2047813_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	49.5	7.3e-09
WP_144427798.1|2047809_2048025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045340902.1|2048021_2048282_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	91.7	3.1e-36
WP_023306327.1|2049368_2049806_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
WP_144427799.1|2050174_2050630_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	1.7e-58
WP_144427800.1|2050629_2050800_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	92.9	3.1e-21
WP_144428043.1|2050796_2051465_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	94.1	7.0e-125
WP_144427801.1|2051457_2052105_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	68.4	1.9e-79
WP_045621977.1|2052101_2052743_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	46.0	1.6e-38
WP_023330221.1|2052739_2052856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063840973.1|2052852_2053542_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	1.6e-55
WP_001514183.1|2054061_2054463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|2054459_2054735_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_144427802.1|2054738_2055179_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	79.9	3.0e-60
WP_144427803.1|2055175_2055649_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	56.0	4.2e-39
WP_144427804.1|2055683_2055959_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	72.5	5.6e-28
WP_047355357.1|2056109_2056328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427805.1|2056493_2057132_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	4.1e-114
WP_058647982.1|2057163_2057622_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	80.9	2.8e-64
WP_144427806.1|2057614_2058862_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	95.9	1.1e-211
WP_032669775.1|2058877_2060227_+	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	77.3	5.3e-204
WP_144427807.1|2060186_2061113_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.2	1.8e-163
WP_144427808.1|2061115_2062381_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.1	6.9e-214
WP_023300384.1|2062393_2062843_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
WP_144427809.1|2062860_2063937_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.6	3.5e-190
WP_063938464.1|2063946_2064240_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	87.6	1.5e-42
WP_047052488.1|2064302_2064704_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	85.0	3.0e-62
WP_047052487.1|2064703_2064892_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	93.5	7.7e-29
WP_045332269.1|2064875_2065238_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	94.2	4.9e-64
WP_045345395.1|2065245_2065641_+	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	95.4	2.0e-66
WP_058663653.1|2065637_2066024_+	hypothetical protein	NA	I6R9A6	Salmonella_phage	96.1	3.6e-65
WP_058663651.1|2066039_2066774_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	86.8	1.5e-115
WP_096889005.1|2066814_2067468_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	90.3	1.0e-112
WP_096889003.1|2067579_2067948_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	90.8	1.1e-58
WP_063159490.1|2067944_2068247_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	98.0	2.2e-41
WP_047653434.1|2068319_2068817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144428044.1|2068878_2071119_+	tape measure protein	NA	I6S1R4	Salmonella_phage	59.7	6.3e-178
WP_063250684.1|2071118_2071466_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	94.8	7.0e-60
WP_022651024.1|2071621_2071819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303627.1|2071984_2072689_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	9.3e-136
WP_032668142.1|2072688_2073408_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	82.3	3.3e-120
WP_017385011.1|2073350_2073884_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	68.2	1.0e-54
WP_144427810.1|2073893_2077685_+	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	60.9	0.0e+00
WP_017694302.1|2077727_2078042_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
WP_006809145.1|2078042_2078714_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.0e-87
WP_039268850.1|2078821_2079055_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
WP_144427811.1|2079113_2080388_+|tail	phage tail protein	tail	K7PKG5	Enterobacteria_phage	69.4	3.1e-161
WP_144427812.1|2080470_2080710_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	69.6	1.7e-25
WP_023306078.1|2080709_2081027_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	1.1e-19
WP_023303634.1|2081540_2082569_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_023303635.1|2082670_2084197_-	YdgA family protein	NA	NA	NA	NA	NA
WP_032619780.1|2084296_2085472_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015570656.1|2085670_2087317_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_017693543.1|2087499_2088894_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_023296464.1|2088894_2089824_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_033487082.1|2089898_2091197_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	3.6e-16
WP_144427813.1|2091226_2092507_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	52.8	5.7e-123
WP_017693537.1|2092506_2092722_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	50.7	5.0e-16
WP_144427814.1|2092786_2093026_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	69.2	1.2e-23
WP_144427815.1|2093060_2094146_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.1	1.9e-103
WP_144427816.1|2094155_2097575_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	67.7	0.0e+00
WP_144427817.1|2097882_2098080_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032682189.1|2098079_2098280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704637.1|2098475_2098889_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	1.4e-06
WP_117500397.1|2099009_2099240_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	44.9	2.0e-10
WP_006811599.1|2099242_2099785_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	54.4	1.1e-46
WP_032659815.1|2099793_2100048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144428045.1|2100221_2101214_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_144427818.1|2101197_2101890_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.4	7.1e-80
WP_144427819.1|2102591_2102852_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	72.3	2.4e-28
WP_144427820.1|2102848_2103337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064489599.1|2104317_2104932_-	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	39.4	9.2e-31
WP_127348470.1|2104935_2105280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064489600.1|2105272_2106028_-	TIGR04255 family protein	NA	A0A2D1GNM9	Pseudomonas_phage	31.3	2.5e-22
WP_045332197.1|2107249_2107483_+	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	80.5	4.0e-27
WP_144427821.1|2107593_2107803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427822.1|2107887_2108487_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	87.3	7.7e-99
WP_032645668.1|2108492_2108693_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	3.7e-21
WP_144427823.1|2108695_2108977_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	97.8	1.0e-45
WP_039270102.1|2108973_2109330_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.9	3.4e-62
WP_144427824.1|2109326_2109464_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	1.6e-07
WP_144427825.1|2109463_2110297_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	79.8	1.7e-123
WP_023296485.1|2110488_2110680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651287.1|2111185_2111374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570936.1|2111467_2111854_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651286.1|2111840_2112122_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_144427826.1|2112121_2112751_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	1.3e-101
WP_144428046.1|2112758_2113028_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.3	1.1e-31
WP_063867083.1|2112984_2113164_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	1.7e-14
WP_017693500.1|2114540_2114882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427827.1|2115219_2116209_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	40.7	2.0e-35
WP_017693498.1|2116186_2117494_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	2.5e-142
WP_144427828.1|2117495_2118884_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.8e-122
WP_144427829.1|2118885_2119977_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.7	2.0e-116
WP_048229364.1|2120063_2120834_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.0	2.8e-69
WP_144427830.1|2120846_2121800_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	6.9e-134
WP_144428047.1|2122117_2122600_+	hypothetical protein	NA	A0A2I7RR81	Vibrio_phage	32.0	2.3e-08
WP_032654540.1|2122601_2122862_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	60.5	2.5e-22
WP_144427831.1|2122865_2123216_+	RNA-binding S4 domain-containing protein	NA	I6PD77	Cronobacter_phage	59.5	3.5e-35
WP_144427832.1|2123217_2123802_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	2.9e-50
WP_144427833.1|2123798_2124209_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	50.7	1.1e-32
WP_048219641.1|2124265_2124937_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.4	4.4e-50
WP_144427834.1|2124998_2125310_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.9	2.4e-35
WP_144427835.1|2125357_2125621_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	59.3	1.4e-15
WP_144427836.1|2125617_2128545_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	36.6	4.6e-136
WP_144427837.1|2128665_2128857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427838.1|2128857_2129295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144427839.1|2129331_2129679_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	61.7	2.4e-36
WP_015570920.1|2129675_2130431_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	1.5e-115
WP_144427840.1|2130432_2131143_+	peptidase P60	NA	K7PLS6	Enterobacteria_phage	96.6	5.7e-141
WP_144427841.1|2131176_2131806_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	56.9	4.2e-55
WP_144427842.1|2131857_2135403_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	89.0	0.0e+00
WP_017382568.1|2135445_2135760_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_144427843.1|2135760_2136432_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.2	8.4e-86
WP_017382566.1|2136539_2136773_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_144427844.1|2136831_2138049_+|tail	phage tail protein	tail	K7PKG5	Enterobacteria_phage	84.4	1.7e-198
WP_144427845.1|2138014_2138758_-	hypothetical protein	NA	K7P6M1	Enterobacteria_phage	70.8	1.5e-59
WP_144427846.1|2138814_2139582_-	hypothetical protein	NA	K7P6T0	Enterobacteria_phage	32.7	1.7e-26
WP_045358105.1|2139664_2140222_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.7	3.5e-77
WP_039270990.1|2140394_2140814_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.4e-35
WP_144427847.1|2140815_2142084_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.7	1.4e-230
WP_144427848.1|2142382_2144380_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	5.7e-21
>prophage 3
NZ_CP041733	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 chromosome, complete genome	4804295	2980054	2988939	4804295		Tupanvirus(28.57%)	8	NA	NA
WP_126805203.1|2980054_2980666_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.7e-14
WP_023303969.1|2980705_2981686_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_049134169.1|2981877_2982882_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.8e-34
WP_003859477.1|2982929_2984096_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_049134171.1|2984335_2985217_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	6.9e-104
WP_144427925.1|2985217_2986303_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	51.7	4.1e-98
WP_006811221.1|2986392_2987799_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_023303974.1|2987925_2988939_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	3.0e-87
>prophage 4
NZ_CP041733	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 chromosome, complete genome	4804295	3382775	3426836	4804295	terminase,holin,tail,integrase	Salmonella_phage(45.65%)	52	3378762:3378775	3425049:3425062
3378762:3378775	attL	CCGGTGTTCGGCGT	NA	NA	NA	NA
WP_088567074.1|3382775_3383258_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.8	7.0e-58
WP_063928602.1|3383254_3383884_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	90.0	2.0e-105
WP_024203029.1|3383873_3384167_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	65.7	9.2e-29
WP_040117937.1|3384153_3384558_-	membrane protein	NA	T1SA79	Salmonella_phage	83.6	1.3e-54
WP_047052272.1|3384711_3385074_+	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	4.4e-49
WP_088567075.1|3385070_3385988_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.7	2.5e-157
WP_111996595.1|3385984_3387442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111996596.1|3387472_3390178_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	74.4	7.3e-96
WP_032671830.1|3390373_3390634_+	hypothetical protein	NA	T1SA06	Salmonella_phage	80.2	1.7e-34
WP_059585505.1|3390666_3390861_-	hypothetical protein	NA	Q858F7	Salmonella_phage	70.3	1.7e-15
WP_088567077.1|3390857_3393614_-	hypothetical protein	NA	Q858F8	Salmonella_phage	97.1	0.0e+00
WP_088567078.1|3393613_3395179_-	hypothetical protein	NA	Q858F9	Salmonella_phage	75.2	1.6e-241
WP_088567079.1|3395178_3397707_-	hypothetical protein	NA	Q858G0	Salmonella_phage	94.2	0.0e+00
WP_032671835.1|3397719_3398259_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	73.9	2.0e-61
WP_088567080.1|3398258_3398723_-	hypothetical protein	NA	T1SA73	Salmonella_phage	90.3	1.8e-79
WP_088567081.1|3398722_3401200_-	hypothetical protein	NA	Q858G3	Salmonella_phage	95.4	0.0e+00
WP_045342897.1|3401199_3401805_-	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	86.6	1.9e-100
WP_045342894.1|3401804_3402128_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	71.8	2.9e-36
WP_047050241.1|3402179_3402554_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	48.8	1.1e-21
WP_045342888.1|3402558_3402999_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	4.1e-65
WP_045342886.1|3403050_3404037_-	phage protein	NA	G9L6C5	Escherichia_phage	86.0	2.8e-162
WP_088567082.1|3404054_3404753_-	peptidase	NA	G9L6C4	Escherichia_phage	81.9	1.5e-72
WP_045342883.1|3404764_3405088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111996597.1|3405084_3405384_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	71.9	5.3e-32
WP_088567084.1|3405380_3407051_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	94.2	4.4e-301
WP_032636549.1|3407065_3407272_-	hypothetical protein	NA	T1SA67	Salmonella_phage	95.6	1.3e-08
WP_088567085.1|3408109_3408904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088567086.1|3408900_3410376_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	95.9	1.4e-287
WP_088567087.1|3410372_3410975_-|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	82.9	6.4e-85
WP_088567088.1|3411031_3411361_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	1.3e-28
WP_088567089.1|3411634_3411982_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	83.9	2.8e-48
WP_088567090.1|3411974_3412154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088567091.1|3412141_3412405_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	64.8	5.0e-10
WP_088567105.1|3412604_3412988_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.6	2.0e-44
WP_088567092.1|3413520_3413898_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	50.0	1.9e-10
WP_088567093.1|3413894_3414461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088567094.1|3414842_3415187_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	96.5	2.4e-60
WP_088567095.1|3415307_3416138_-	Pyocin large subunit	NA	T1SA92	Salmonella_phage	79.5	4.2e-119
WP_088567096.1|3416147_3416900_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	89.2	7.6e-136
WP_063150712.1|3416896_3417100_-	hypothetical protein	NA	Q858D5	Salmonella_phage	84.4	2.3e-23
WP_032634928.1|3417247_3417478_-	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	84.0	1.5e-31
WP_088567097.1|3417632_3418223_+	transcriptional regulator	NA	G9L6A6	Escherichia_phage	75.0	1.8e-79
WP_063149225.1|3418520_3418820_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	8.8e-19
WP_088567098.1|3418816_3419716_+	endonuclease	NA	Q858E0	Salmonella_phage	95.3	1.1e-162
WP_088567099.1|3419725_3420748_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	97.4	7.8e-184
WP_032634922.1|3420796_3421045_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	79.3	1.2e-32
WP_032634921.1|3421154_3421451_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.1e-33
WP_088567100.1|3421443_3421602_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	88.5	7.1e-20
WP_088567101.1|3421598_3422246_+	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	91.6	3.0e-120
WP_047050290.1|3422281_3423532_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	80.1	1.4e-190
WP_006811514.1|3423724_3425302_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3425049:3425062	attR	ACGCCGAACACCGG	NA	NA	NA	NA
WP_003860601.1|3425369_3426836_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
>prophage 5
NZ_CP041733	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 chromosome, complete genome	4804295	3486524	3567930	4804295	portal,tRNA,lysis,plate,integrase,capsid,holin,tail,head,terminase	Escherichia_phage(23.91%)	86	3529005:3529021	3559592:3559608
WP_023295164.1|3486524_3487064_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_017383550.1|3487088_3487724_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_015572146.1|3487727_3489092_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_017692906.1|3489101_3489998_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003860702.1|3490116_3490965_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860704.1|3491021_3491282_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_015572144.1|3491278_3491659_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_015572143.1|3491658_3492390_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015572142.1|3492465_3493173_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_126805082.1|3493190_3494096_-	GTPase Era	NA	NA	NA	NA	NA
WP_003860711.1|3494092_3494773_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_047732551.1|3494996_3495959_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|3495974_3497780_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_006811609.1|3497965_3498442_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|3498438_3499392_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3499391_3500042_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3500073_3500649_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_017692868.1|3501074_3502694_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_144427958.1|3502678_3503416_-	methyltransferase	NA	NA	NA	NA	NA
WP_017383554.1|3503548_3504877_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|3504930_3505314_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860729.1|3505629_3506319_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_017383555.1|3506358_3507444_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032649129.1|3507648_3508068_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_015572132.1|3508138_3508837_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_126805084.1|3508872_3511536_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_126805087.1|3511645_3513001_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3513046_3513370_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_017383558.1|3513366_3514674_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.5e-43
WP_017692863.1|3514825_3515278_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	1.3e-34
WP_017692862.1|3520806_3523380_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_126804714.1|3523509_3524241_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017383977.1|3524237_3525218_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3525349_3526087_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3526354_3526696_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3526800_3526848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571567.1|3526955_3528116_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_017383978.1|3528112_3528985_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
3529005:3529021	attL	AAAAGCCAGCAATGCTG	NA	NA	NA	NA
WP_023323577.1|3529129_3529351_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_109909770.1|3529427_3530597_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	81.9	2.3e-179
WP_063132915.1|3530593_3531058_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.7	2.5e-60
WP_144427959.1|3531068_3533519_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	76.0	1.1e-305
WP_017382998.1|3533508_3533631_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032659931.1|3533663_3533987_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	65.2	1.2e-24
WP_023295232.1|3534044_3534563_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_023323582.1|3534575_3535769_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_032659926.1|3536143_3536575_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	39.6	1.2e-16
WP_144427960.1|3536576_3538925_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	50.6	1.7e-112
WP_026080583.1|3538936_3539467_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.1	2.8e-92
WP_144427961.1|3539459_3540368_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	82.8	1.1e-133
WP_144427962.1|3540373_3540724_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	72.4	3.6e-40
WP_144427963.1|3540720_3541356_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.3	4.8e-99
WP_060614460.1|3541626_3542526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614459.1|3542589_3543036_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	1.5e-46
WP_060614458.1|3543028_3543496_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	3.0e-58
WP_072204597.1|3543458_3543704_-|holin	holin	holin	S4TNY4	Salmonella_phage	72.8	9.4e-27
WP_058687916.1|3543591_3544008_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	68.0	7.1e-43
WP_144427964.1|3544007_3544439_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	79.0	5.6e-59
WP_144427965.1|3544435_3544948_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	88.8	1.0e-83
WP_144427966.1|3544931_3545153_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.7e-25
WP_017382979.1|3545143_3545347_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_080469633.1|3545346_3545853_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	1.7e-62
WP_063940391.1|3545952_3546708_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.1	6.4e-74
WP_047721716.1|3546711_3547779_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.3	2.8e-168
WP_017382975.1|3547834_3548689_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	2.4e-114
WP_045339905.1|3548854_3550624_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.6	9.4e-302
WP_144427967.1|3550625_3551651_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.4	6.7e-167
WP_116329066.1|3552421_3553513_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_116329072.1|3553527_3554016_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_023323606.1|3556423_3556699_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	59.3	2.2e-24
WP_044596220.1|3556715_3556931_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_023323608.1|3556995_3557496_-	hypothetical protein	NA	M1SV55	Escherichia_phage	89.2	8.5e-83
WP_032627926.1|3557486_3557666_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	66.7	6.2e-12
WP_023295263.1|3557668_3557941_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_023295264.1|3558100_3558394_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	71.1	7.7e-36
WP_044596219.1|3558463_3559444_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	81.0	4.0e-153
WP_006811631.1|3559632_3560754_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
3559592:3559608	attR	AAAAGCCAGCAATGCTG	NA	NA	NA	NA
WP_006811632.1|3560764_3561835_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_126804715.1|3562047_3562422_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_032619208.1|3562575_3563112_+	YfiR family protein	NA	NA	NA	NA	NA
WP_017692859.1|3563104_3564325_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_017382956.1|3564337_3564823_+	OmpA family protein	NA	NA	NA	NA	NA
WP_126804716.1|3564825_3566196_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_126804717.1|3566234_3566639_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3566771_3567119_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|3567162_3567930_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP041734	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 plasmid pME-1a, complete sequence	276520	59136	102104	276520	protease,transposase,integrase	Acinetobacter_phage(20.0%)	45	58671:58684	109995:110008
58671:58684	attL	TGTTTTCTGTTTCA	NA	NA	NA	NA
WP_000795949.1|59136_60312_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60481_60694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|61054_62137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|62302_63802_-	kinase	NA	NA	NA	NA	NA
WP_107535687.1|63827_65465_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|65464_66505_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66589_67228_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67227_67869_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|67891_68530_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|68992_69460_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|69477_70686_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|70696_71653_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|71652_72732_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|72733_73507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|73499_74642_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|74651_75710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|76030_76612_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_044704557.1|76611_77769_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|77791_78247_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78269_79310_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79358_79937_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|80005_80581_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|81009_82251_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|82341_82797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|83037_83229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|83320_83662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|84648_84903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|84905_86945_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_000211823.1|86941_87928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88848_89241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|89219_89531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|89899_90556_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|90595_90778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|90758_91256_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|91260_92649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|93049_93343_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|93347_94673_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|94733_94940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|95040_95451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805097.1|95463_95988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|96169_97174_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|97252_100225_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|100227_100785_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001447826.1|100822_101146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845054.1|101090_102104_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
109995:110008	attR	TGAAACAGAAAACA	NA	NA	NA	NA
>prophage 2
NZ_CP041734	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 plasmid pME-1a, complete sequence	276520	105717	142658	276520	transposase,integrase	Escherichia_phage(33.33%)	43	112412:112471	133927:135060
WP_032492010.1|105717_106761_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000679427.1|106983_107331_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|107324_108164_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|108568_110110_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|110373_111030_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_004193231.1|111215_112091_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|112094_112460_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|112352_112688_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
112412:112471	attL	CGAGGGCTTTACTAAGCTTGCCCCTTCCGCCGTTGTCATAATCGGTTATGGCATCGCATT	NA	NA	NA	NA
WP_000259031.1|112681_113521_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|113450_113630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|113648_114149_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|114454_114568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|114655_115420_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_021242992.1|115594_115813_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|115775_115895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|115878_116115_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|116111_116477_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|116494_118180_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|118218_118644_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|118671_118947_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|118962_119328_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|119399_119855_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001194554.1|120590_120794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|121135_121540_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|121717_122011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|122036_122273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|122313_122769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447900.1|122828_123494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|123551_123932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|127841_128546_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|129154_129859_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|129749_130709_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_032490158.1|130864_131338_+	trimethoprim-resistant dihydrofolate reductase DfrA16	NA	G3MBI7	Bacillus_virus	30.8	1.4e-18
WP_001261740.1|131442_132234_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_144428063.1|132364_132796_+	trimethoprim-resistant dihydrofolate reductase DfrA	NA	A0A1B4XX05	Tenacibaculum_phage	35.2	6.7e-12
WP_001261740.1|132900_133692_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|133855_134203_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|134196_135036_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|135440_136982_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
133927:135060	attR	CGAGGGCTTTACTAAGCTTGCCCCTTCCGCCGTTGTCATAATCGGTTATGGCATCGCATTTTATTTTCTTTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGGCGTCGTCATAATTACAGCCATTGCCTGGTTGCTTCATGGGCAAAAGCTTGATGCGTGGGGCTTTGTAGGTATGGGGCTCATAATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGCCGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
WP_032489926.1|137308_138184_+	class A extended-spectrum beta-lactamase CTX-M-9	NA	A0A1B0VBP7	Salmonella_phage	99.3	2.3e-152
WP_144428061.1|138647_139187_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044704969.1|139923_141546_-	MCR-9 family phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_001572374.1|141734_142658_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
>prophage 3
NZ_CP041734	Enterobacter hormaechei subsp. steigerwaltii strain ME-1 plasmid pME-1a, complete sequence	276520	156684	161953	276520		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
WP_000927306.1|156684_158163_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|158181_159009_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|159068_159494_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|159506_160796_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|160841_161162_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|161248_161953_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
