The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	1241178	1281287	5018196	transposase,integrase,protease	Escherichia_phage(16.67%)	29	1233894:1233911	1271658:1271675
1233894:1233911	attL	TGCTCGGCGCGGCCGGCG	NA	NA	NA	NA
WP_154831563.1|1241178_1243146_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	32.9	2.0e-63
WP_154831564.1|1243179_1243557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831565.1|1244315_1244882_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_154831566.1|1244908_1245337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831567.1|1245333_1245609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831568.1|1245692_1245902_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154831569.1|1245996_1246392_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_154831570.1|1246388_1247606_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	29.4	7.5e-24
WP_039511350.1|1248075_1248402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154831571.1|1248607_1250209_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_154831572.1|1250356_1251253_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_154831573.1|1251328_1252483_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_154831574.1|1252649_1255292_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_046341950.1|1255360_1256560_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_154831575.1|1256748_1258965_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_154833163.1|1259071_1260049_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_154831576.1|1260704_1265627_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_154831577.1|1266360_1269462_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_154833165.1|1269745_1270567_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.4	3.3e-07
WP_154831578.1|1270635_1271475_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_154831579.1|1271586_1274007_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
1271658:1271675	attR	TGCTCGGCGCGGCCGGCG	NA	NA	NA	NA
WP_024938597.1|1274275_1274836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016903926.1|1274879_1275362_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	38.9	9.2e-26
WP_039510602.1|1275523_1276000_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_054590856.1|1276140_1277037_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.8	1.5e-18
WP_024938599.1|1277558_1277945_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	1.3e-09
WP_046341957.1|1278408_1279548_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_039523939.1|1279547_1280411_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_065046697.1|1280822_1281287_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	1977361	1991886	5018196	tRNA	Micromonas_sp._RCC1109_virus(10.0%)	15	NA	NA
WP_154831829.1|1977361_1979038_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.7	3.4e-43
WP_104568600.1|1979131_1979779_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_016904265.1|1979951_1980986_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.6	1.3e-114
WP_024939583.1|1981264_1981753_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_154831830.1|1981854_1984503_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.4e-83
WP_024939585.1|1984641_1984854_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_109291899.1|1985074_1985299_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_154833221.1|1985291_1985507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831831.1|1985640_1985928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831832.1|1985927_1987337_-	hypothetical protein	NA	B2ZY87	Ralstonia_phage	45.1	3.6e-22
WP_154831833.1|1987340_1988249_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.2	5.4e-43
WP_154831834.1|1988270_1989041_-	hypothetical protein	NA	A0A2H4IY33	uncultured_phage	44.0	3.7e-53
WP_154831835.1|1989033_1989648_-	hypothetical protein	NA	K7R9L4	Vibrio_phage	33.3	2.8e-19
WP_154831836.1|1989640_1989919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154831837.1|1989915_1991886_-	DNA methyltransferase	NA	Q5QF27	Pseudomonas_virus	48.6	2.3e-160
>prophage 3
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	1996733	2002434	5018196		Pseudomonas_phage(42.86%)	10	NA	NA
WP_154831844.1|1996733_1997432_-	LexA family transcriptional regulator	NA	A5X9F5	Aeromonas_virus	28.8	4.0e-14
WP_104576936.1|1997507_1997984_+	hypothetical protein	NA	W6MWX8	Pseudomonas_phage	42.4	2.7e-06
WP_102256240.1|1998122_1998596_+	hypothetical protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	45.1	1.1e-20
WP_104568580.1|1998595_1998886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154831845.1|1998903_1999092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102256237.1|1999088_1999988_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	41.5	1.4e-30
WP_154831846.1|1999974_2000652_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	38.9	1.5e-29
WP_154831847.1|2000648_2001260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154831848.1|2001256_2001724_+	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	57.9	4.0e-42
WP_154831849.1|2001720_2002434_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	45.6	8.5e-36
>prophage 4
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	2006396	2018077	5018196	terminase,head,capsid,portal	Klebsiella_phage(11.11%)	14	NA	NA
WP_154831855.1|2006396_2007053_+	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	42.3	3.0e-35
WP_126962525.1|2007049_2007553_+	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.6	1.6e-20
WP_104576885.1|2007549_2007765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154831856.1|2007806_2008280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104568562.1|2008276_2008462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154831857.1|2008583_2009543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102256224.1|2009830_2010331_+	DUF1441 family protein	NA	A0A2H4EYX7	Aeromonas_phage	38.3	2.4e-21
WP_154831858.1|2010305_2012393_+|terminase	terminase	terminase	A5LH27	Enterobacteria_phage	42.6	5.9e-154
WP_154831859.1|2012394_2012610_+	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	41.9	8.0e-06
WP_154831860.1|2012602_2014105_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	48.1	5.5e-109
WP_154831861.1|2014094_2015504_+	S49 family peptidase	NA	G8DCP1	Silicibacter_phage	51.0	3.4e-44
WP_154831862.1|2015506_2016178_+|head	head decoration protein	head	NA	NA	NA	NA
WP_154833227.1|2016257_2017250_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	37.5	4.5e-51
WP_154831863.1|2017300_2018077_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	34.9	9.6e-25
>prophage 5
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	2600684	2621121	5018196		Xanthomonas_phage(77.78%)	33	NA	NA
WP_154832058.1|2600684_2601128_-	hypothetical protein	NA	A0A077JCZ5	Xanthomonas_phage	78.7	2.5e-46
WP_154833265.1|2601475_2602036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832059.1|2602035_2603142_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	71.2	1.4e-154
WP_017165297.1|2603138_2603432_+	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	64.9	4.3e-26
WP_154832060.1|2603435_2603627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832061.1|2603883_2605092_+	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	30.7	6.1e-10
WP_154832062.1|2605091_2605373_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_154832063.1|2605372_2606611_+	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	36.8	6.6e-52
WP_154832064.1|2606611_2606917_-	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	59.2	1.2e-28
WP_154832065.1|2606983_2607397_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	71.6	4.0e-46
WP_154833267.1|2607425_2607827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154832066.1|2607963_2608143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832067.1|2608135_2608318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832068.1|2608317_2608503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832069.1|2608629_2609268_+	replication endonuclease	NA	NA	NA	NA	NA
WP_074052432.1|2609448_2609745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832070.1|2609748_2609970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832071.1|2609983_2610223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832072.1|2610358_2611798_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	43.6	4.2e-58
WP_154832073.1|2611799_2612120_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_154832074.1|2612116_2613301_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	38.7	2.2e-57
WP_154832075.1|2613297_2613978_+	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	58.2	8.9e-67
WP_154832076.1|2613993_2614386_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	60.8	5.0e-38
WP_154832077.1|2614422_2614806_-	hypothetical protein	NA	A0A077JDD0	Xanthomonas_phage	76.4	1.1e-50
WP_154832078.1|2615013_2615379_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	54.3	2.2e-24
WP_154833268.1|2615547_2615790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154832079.1|2616021_2617185_-	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	59.5	4.8e-129
WP_039521669.1|2617181_2617499_-	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	56.5	2.0e-21
WP_154832080.1|2617498_2618977_-	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	76.2	3.7e-166
WP_154832081.1|2619090_2619342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154832082.1|2619338_2619542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154832083.1|2619657_2619954_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	65.3	3.9e-27
WP_104570018.1|2620059_2621121_-	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.1	3.4e-65
>prophage 6
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	4179184	4189266	5018196		Escherichia_phage(28.57%)	10	NA	NA
WP_024938344.1|4179184_4180531_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.3	5.3e-31
WP_024938345.1|4180576_4181980_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	9.5e-47
WP_154832655.1|4182095_4183004_-	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	33.6	7.0e-27
WP_024938347.1|4183000_4183558_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	7.8e-45
WP_024938348.1|4183554_4184442_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	2.0e-95
WP_065032868.1|4184505_4185561_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.0	6.8e-82
WP_039525367.1|4185777_4186524_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_024938351.1|4186523_4187468_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_024938352.1|4187612_4188314_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_104608247.1|4188303_4189266_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	27.7	5.3e-25
>prophage 7
NZ_CP041965	Xanthomonas citri pv. glycines strain 2098 chromosome, complete genome	5018196	4380690	4428513	5018196	integrase,portal,terminase,capsid,head,plate,holin,tRNA,tail	Stenotrophomonas_phage(58.33%)	62	4386849:4386868	4426630:4426649
WP_154832733.1|4380690_4381401_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.1	3.8e-105
WP_154832734.1|4381318_4381564_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	2.4e-14
WP_154832735.1|4381589_4382603_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	2.4e-140
WP_154832736.1|4382602_4384387_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.3	3.5e-272
WP_154832737.1|4384508_4385351_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	1.7e-67
WP_154832738.1|4385397_4386417_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	69.7	7.9e-136
WP_154832739.1|4386420_4387140_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.6	4.1e-70
4386849:4386868	attL	CGGCCAGCCGTTCGATGCGG	NA	NA	NA	NA
WP_154832740.1|4387238_4387706_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	1.2e-30
WP_005917735.1|4387705_4387915_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005929454.1|4387919_4388276_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_078589944.1|4388268_4388544_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_154832741.1|4388540_4389182_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	5.1e-48
WP_154832742.1|4389181_4389670_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	53.1	2.0e-28
WP_154832743.1|4389666_4390086_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.5e-40
WP_154832744.1|4390073_4390520_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.8	5.7e-38
WP_154832745.1|4390796_4391225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832746.1|4391778_4392669_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	54.4	1.5e-85
WP_104542543.1|4392661_4393210_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.1	2.7e-50
WP_154832747.1|4393213_4394419_+|tail	phage tail protein	tail	A0A1S5NTG6	Burkholderia_phage	45.0	2.8e-31
WP_145508605.1|4394372_4394648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832748.1|4394726_4395290_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.5	5.7e-27
WP_154832749.1|4395286_4395646_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.2e-35
WP_154832750.1|4395657_4396824_+|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	63.9	1.3e-134
WP_006450505.1|4396854_4397364_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	2.2e-70
WP_104554051.1|4397409_4397712_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	1.7e-25
WP_005922203.1|4397720_4397834_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_154832751.1|4397863_4400734_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	1.7e-188
WP_016851190.1|4400746_4401148_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
WP_154832752.1|4401144_4402134_+	phage late control D family protein	NA	E5FFG3	Burkholderia_phage	48.8	3.0e-87
WP_154832753.1|4402277_4402754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832754.1|4402776_4403886_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_154832755.1|4404143_4404581_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	30.5	2.7e-08
WP_039408422.1|4404651_4404909_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	44.6	8.6e-07
WP_154832756.1|4404911_4405232_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.8	4.8e-23
WP_154832757.1|4405242_4405521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042826473.1|4405517_4405730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154833414.1|4405763_4408436_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	70.1	0.0e+00
WP_154832758.1|4408759_4408978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832759.1|4408974_4409262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832760.1|4409261_4409534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154833418.1|4409663_4410038_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	47.3	6.4e-19
WP_154832761.1|4410030_4410213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154832762.1|4410205_4410478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154833416.1|4410570_4410699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145508748.1|4410764_4410968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029820461.1|4410964_4411174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029820462.1|4411170_4411395_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.5	5.7e-15
WP_154832763.1|4411394_4412582_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	51.4	1.5e-109
WP_053051396.1|4413000_4413315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016902493.1|4413501_4415376_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_046344664.1|4415483_4415924_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_154832764.1|4416024_4416939_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_016902496.1|4416987_4417509_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_046344665.1|4417753_4418887_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	41.5	2.1e-28
WP_047129748.1|4419025_4419502_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_154832765.1|4419498_4421004_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_154832766.1|4421072_4422131_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_154832767.1|4422131_4422956_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_154832768.1|4423078_4424356_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_154832769.1|4424509_4426231_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_154832770.1|4426279_4427590_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
4426630:4426649	attR	CCGCATCGAACGGCTGGCCG	NA	NA	NA	NA
WP_047127467.1|4427589_4428513_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
