The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036281	Planctomycetes bacterium Pla110 chromosome, complete genome	6125480	2339891	2438764	6125480	coat,transposase	Acanthamoeba_castellanii_mimivirus(28.57%)	57	NA	NA
WP_144995212.1|2339891_2340959_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995214.1|2340960_2341281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995216.1|2341370_2341931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995218.1|2342024_2343779_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_144995220.1|2343881_2344403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995222.1|2344465_2344963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995224.1|2344968_2346384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995225.1|2346729_2347593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995227.1|2348457_2349096_+	heme-binding protein	NA	NA	NA	NA	NA
WP_144999649.1|2349590_2351288_+	hypothetical protein	NA	A7IVK2	Paramecium_bursaria_Chlorella_virus	29.4	9.4e-17
WP_144995229.1|2351615_2352422_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_144995231.1|2352970_2353855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995233.1|2353930_2354440_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_144995235.1|2354830_2356006_+	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_144995237.1|2356202_2357816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995239.1|2358096_2358234_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995241.1|2358524_2358701_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_144995243.1|2358709_2359225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995245.1|2359424_2359820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995247.1|2360239_2361232_+	YHYH protein	NA	NA	NA	NA	NA
WP_144995249.1|2361423_2364603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144999650.1|2365002_2365611_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144995251.1|2365607_2367857_+	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	34.3	6.0e-11
WP_144995253.1|2368097_2368781_-	DUF4956 domain-containing protein	NA	NA	NA	NA	NA
WP_144995255.1|2368773_2369547_-	VTC domain-containing protein	NA	NA	NA	NA	NA
WP_144995257.1|2369600_2371436_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_144995259.1|2373598_2382910_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_144995261.1|2383528_2383837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995263.1|2383852_2384161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995265.1|2384397_2389557_-	protein kinase	NA	M1HZT4	Acanthocystis_turfacea_Chlorella_virus	29.1	3.9e-21
WP_144995267.1|2389720_2390329_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144995269.1|2390619_2390889_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995271.1|2391087_2393181_-	protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	31.3	9.5e-19
WP_144995273.1|2393305_2394049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995275.1|2394024_2396268_-	caspase family protein	NA	A0A1V0SLK6	Klosneuvirus	31.2	4.8e-08
WP_144995277.1|2396318_2402648_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144995279.1|2403648_2406783_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144995281.1|2407259_2408954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995284.1|2409308_2409881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995286.1|2412476_2413772_-	serpin family protein	NA	Q9DHG4	Yaba-like_disease_virus	33.6	8.5e-42
WP_144995288.1|2413987_2415634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995289.1|2416074_2417553_-	sodium/proline symporter	NA	NA	NA	NA	NA
WP_144995291.1|2417655_2418444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995293.1|2418595_2421481_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144995295.1|2421673_2422132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995297.1|2422191_2423967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995299.1|2424320_2425439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995302.1|2426667_2430210_-	protein kinase	NA	A0A146JFA3	Tokyovirus	38.0	9.8e-16
WP_144995304.1|2430304_2430949_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144995306.1|2431859_2432744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995308.1|2433740_2433938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995310.1|2434055_2434355_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_144995312.1|2434777_2435008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995314.1|2435358_2435949_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995316.1|2436607_2436988_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144995318.1|2436990_2437290_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_144995320.1|2437696_2438764_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP036281	Planctomycetes bacterium Pla110 chromosome, complete genome	6125480	3167200	3218825	6125480	integrase,transposase	unidentified_phage(33.33%)	40	3183041:3183054	3233816:3233829
WP_144995963.1|3167200_3168406_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_144995964.1|3168696_3169968_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_144995965.1|3170122_3170272_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144999689.1|3170483_3171029_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	1.5e-11
WP_144995966.1|3171183_3173100_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_144999690.1|3173673_3173856_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995967.1|3174177_3175278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995968.1|3175533_3176139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995969.1|3176151_3177591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995970.1|3178363_3180355_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.5	8.2e-28
WP_144995971.1|3180406_3181438_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_144995972.1|3181885_3182812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995973.1|3182803_3183772_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
3183041:3183054	attL	ATGATTTCGTTTTT	NA	NA	NA	NA
WP_144995974.1|3183804_3184575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995975.1|3185053_3185383_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144995976.1|3185379_3185601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144999691.1|3185830_3186082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995977.1|3186330_3186729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995978.1|3186734_3189575_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_144995979.1|3189702_3190200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995980.1|3190340_3190589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995981.1|3190725_3191163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995982.1|3191217_3191532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995983.1|3191536_3193213_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_144995984.1|3193271_3194711_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_144995985.1|3194780_3195977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995986.1|3196829_3198152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995987.1|3198196_3201562_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144995988.1|3201751_3202729_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	44.0	4.3e-54
WP_144995989.1|3202698_3203778_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_144995990.1|3203756_3204299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144995991.1|3205018_3206437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995992.1|3207527_3207800_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_144995993.1|3207792_3208185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144995994.1|3208224_3209079_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_144995995.1|3209107_3209848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144995996.1|3210157_3212347_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_144995997.1|3212739_3213975_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_144995998.1|3214304_3217724_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144995999.1|3218576_3218825_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3233816:3233829	attR	ATGATTTCGTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP036281	Planctomycetes bacterium Pla110 chromosome, complete genome	6125480	5545896	5613804	6125480	integrase,transposase	Aureococcus_anophage(20.0%)	46	5551460:5551517	5587306:5587363
WP_144999793.1|5545896_5546964_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998684.1|5547574_5547802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998686.1|5547839_5549096_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_144998688.1|5549099_5549426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998690.1|5549566_5549923_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144998692.1|5549922_5550273_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_144998694.1|5550355_5550703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998696.1|5550777_5551047_-	hypothetical protein	NA	NA	NA	NA	NA
5551460:5551517	attL	GAATCCCGTTCTCTCCGCTATATAAGGACTTACGTCGAAAGATGTGAGTCCTTTTTTC	NA	NA	NA	NA
WP_144998698.1|5551566_5552343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998700.1|5552648_5553167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998702.1|5553710_5555420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998704.1|5556267_5556465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998706.1|5556883_5557816_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_144998708.1|5558423_5560277_+	TolC family protein	NA	NA	NA	NA	NA
WP_144998710.1|5560448_5562599_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	22.1	1.4e-09
WP_144998712.1|5562665_5564084_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_144998714.1|5564275_5564671_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_144998716.1|5564894_5565749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998718.1|5565776_5565974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998720.1|5566435_5567968_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_144998722.1|5568074_5569517_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	48.2	3.0e-120
WP_144999795.1|5569596_5570634_+	DUF1214 domain-containing protein	NA	A0A2P0VP21	Tetraselmis_virus	37.5	3.6e-43
WP_144999797.1|5570749_5572222_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_144998724.1|5572637_5572859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144998726.1|5572875_5574099_+|integrase	tyrosine-type recombinase/integrase	integrase	G9FGY1	Rhodococcus_phage	22.8	1.4e-06
WP_144998728.1|5574417_5585982_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_144998730.1|5586090_5586453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998731.1|5586535_5586904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998733.1|5587519_5589889_+	recombinase family protein	NA	C7F8K5	Bacillus_phage	22.3	2.3e-05
5587306:5587363	attR	GAAAAAAGGACTCACATCTTTCGACGTAAGTCCTTATATAGCGGAGAGAACGGGATTC	NA	NA	NA	NA
WP_144998735.1|5590282_5590492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998737.1|5590680_5591760_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998739.1|5592345_5594877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998741.1|5595991_5596882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998743.1|5597080_5598721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998745.1|5600843_5601362_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144998747.1|5601358_5602369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998749.1|5602375_5603113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998751.1|5603153_5604965_+	YHYH protein	NA	NA	NA	NA	NA
WP_144998753.1|5605438_5605657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998755.1|5606023_5606410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998757.1|5606598_5606826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998759.1|5607060_5608128_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998761.1|5608329_5608896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998763.1|5608919_5611955_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_144998765.1|5612206_5613286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998767.1|5613549_5613804_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP036281	Planctomycetes bacterium Pla110 chromosome, complete genome	6125480	5617565	5706503	6125480	transposase	Acanthamoeba_polyphaga_mimivirus(66.67%)	56	NA	NA
WP_144998776.1|5617565_5617940_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998778.1|5617936_5618215_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998780.1|5618236_5618527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998782.1|5618989_5619193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998784.1|5619333_5619636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998786.1|5619599_5621078_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144998788.1|5621517_5621904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998789.1|5622859_5623585_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144998792.1|5623944_5628771_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7F1	Microcystis_virus	44.3	5.1e-23
WP_144998794.1|5628970_5629459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998796.1|5629892_5630825_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_144998798.1|5630821_5631643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998800.1|5631639_5632938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998802.1|5632965_5634375_-	MFS transporter	NA	NA	NA	NA	NA
WP_144998804.1|5634909_5635089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998806.1|5635728_5636787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144999799.1|5637501_5637699_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144998808.1|5638141_5640361_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_144998810.1|5640433_5641162_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_144998812.1|5641583_5642339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998814.1|5642450_5643869_-	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_144998816.1|5643974_5646698_-	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_144998818.1|5647990_5648458_-	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_144999801.1|5648634_5649078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998820.1|5650808_5656784_+	hypothetical protein	NA	A0A0G2Y0B2	Acanthamoeba_polyphaga_mimivirus	24.0	3.8e-12
WP_144998822.1|5657077_5657611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998824.1|5657678_5659070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998826.1|5659307_5659544_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998828.1|5659629_5659977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998830.1|5660033_5662442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998832.1|5662958_5668415_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_144998834.1|5668715_5673368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998837.1|5674020_5676567_+	DUF1592 domain-containing protein	NA	NA	NA	NA	NA
WP_144998839.1|5676621_5677977_+	DUF1552 domain-containing protein	NA	NA	NA	NA	NA
WP_144998841.1|5678086_5679451_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_144998843.1|5679480_5680455_-	phosphoesterase	NA	NA	NA	NA	NA
WP_144998845.1|5681683_5682391_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998847.1|5682651_5683170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998849.1|5683773_5683998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998851.1|5684985_5685504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998853.1|5685803_5687246_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_144998855.1|5687314_5689846_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_144998857.1|5689854_5690718_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_144998859.1|5691538_5691766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998861.1|5691988_5692783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144998863.1|5692814_5693186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998865.1|5693570_5694122_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998867.1|5694128_5694650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998869.1|5694871_5695099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998871.1|5695524_5697225_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144998873.1|5697272_5701760_-	protein kinase	NA	A0A0G2YB36	Acanthamoeba_polyphaga_mimivirus	31.2	4.6e-18
WP_144998875.1|5701840_5702452_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144998877.1|5702708_5702855_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144998880.1|5703382_5703904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998882.1|5704039_5704924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144998884.1|5705435_5706503_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP036281	Planctomycetes bacterium Pla110 chromosome, complete genome	6125480	5824827	5830242	6125480		Pseudomonas_phage(42.86%)	10	NA	NA
WP_144999003.1|5824827_5825007_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	58.8	1.3e-09
WP_144999005.1|5825003_5825765_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_144999007.1|5825839_5826283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144999009.1|5826333_5826870_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	39.8	3.5e-18
WP_144999011.1|5826949_5827996_+	hypothetical protein	NA	A0A0A0YR83	Pseudomonas_phage	38.8	6.6e-21
WP_144999807.1|5828266_5828611_+	hypothetical protein	NA	A0A1S5R1P2	Pseudomonas_phage	62.3	6.3e-29
WP_144999013.1|5828610_5828943_+	hypothetical protein	NA	A0A2H4J4U3	uncultured_Caudovirales_phage	45.0	9.1e-17
WP_144999015.1|5829277_5829484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144999017.1|5829652_5829937_+	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	50.0	1.6e-14
WP_144999019.1|5830035_5830242_+	hypothetical protein	NA	A0A142K991	Gordonia_phage	51.8	1.5e-09
