The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	517626	527517	3954391		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|517626_518919_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_014469854.1|518994_519714_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	9.8e-48
WP_014469855.1|519713_519968_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	35.8	2.1e-05
WP_014469856.1|519964_520648_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014469857.1|520631_522860_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.8e-159
WP_014469858.1|522835_524266_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_014469859.1|524357_525398_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	8.2e-64
WP_014469860.1|525394_525982_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.0e-26
WP_014469861.1|525978_527517_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	2.3e-78
>prophage 2
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	995272	1086867	3954391	terminase,integrase,holin,tRNA,portal,plate,coat	uncultured_Caudovirales_phage(49.12%)	120	1026590:1026607	1048117:1048134
WP_012117281.1|995272_996265_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|997009_998644_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|998750_999686_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351826.1|999689_1000607_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1000619_1001696_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014470613.1|1001688_1002606_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_013351829.1|1002713_1003901_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1004018_1004597_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1004774_1005170_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1005227_1005884_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1006159_1006816_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1006967_1008128_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1008356_1010186_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_013351835.1|1010673_1011576_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013351836.1|1011572_1011971_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1012195_1012882_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1012886_1013459_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1013583_1013949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1013976_1014612_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1014629_1015430_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1015444_1016338_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_013351843.1|1016371_1017121_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
WP_014470611.1|1017346_1019191_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_013351845.1|1019439_1020150_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1020124_1020742_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1020725_1021835_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1021831_1022035_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1022031_1022802_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1022798_1023809_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1023831_1024644_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1024774_1025551_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_013351852.1|1025648_1026236_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1026293_1026737_-|coat	spore coat protein	coat	NA	NA	NA	NA
1026590:1026607	attL	GCACAAATGGCACTGTAT	NA	NA	NA	NA
WP_013351854.1|1026885_1027368_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1027517_1028018_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|1028110_1028425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470608.1|1028462_1028849_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351858.1|1029019_1029376_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_013351859.1|1029664_1029862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470606.1|1029953_1030133_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013351860.1|1030299_1030554_+	sporulation protein	NA	NA	NA	NA	NA
WP_014470605.1|1030621_1032907_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	32.9	5.4e-84
WP_013351862.1|1033027_1033282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351863.1|1033347_1034100_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013351864.1|1034136_1034859_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351865.1|1034851_1035589_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	6.7e-28
WP_013351866.1|1035589_1035823_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013351867.1|1035980_1036412_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351868.1|1036416_1036932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351869.1|1036957_1037680_-	esterase family protein	NA	NA	NA	NA	NA
WP_014470603.1|1038049_1039171_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013351871.1|1039163_1040339_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_014470602.1|1040680_1041910_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	50.0	4.2e-107
WP_014470601.1|1041914_1042436_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	64.0	1.6e-55
WP_014470600.1|1042502_1042985_-	hypothetical protein	NA	O64019	Bacillus_phage	90.6	4.8e-75
WP_014470599.1|1043001_1043976_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	77.5	4.5e-80
WP_014470598.1|1044294_1044681_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	70.7	1.1e-26
WP_014470597.1|1044838_1045063_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	3.6e-25
WP_014470596.1|1045073_1045265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470595.1|1045415_1045988_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.6	3.4e-59
WP_014470594.1|1045984_1046242_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.7	2.1e-08
WP_014470593.1|1046238_1046442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470592.1|1046544_1046730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470591.1|1046729_1047647_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.1	1.5e-88
WP_076983677.1|1047666_1048404_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.0	2.2e-50
1048117:1048134	attR	GCACAAATGGCACTGTAT	NA	NA	NA	NA
WP_014470589.1|1048403_1048592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472599.1|1048601_1049309_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_031378524.1|1049226_1050021_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
WP_014470585.1|1050251_1050680_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	3.6e-42
WP_003155894.1|1050971_1051175_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_014470583.1|1051206_1051674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470582.1|1051670_1051901_+	hypothetical protein	NA	J9PL10	Bacillus_phage	44.2	2.3e-11
WP_014470581.1|1051897_1052299_+	hypothetical protein	NA	A0A0S2MUR2	Bacillus_phage	45.2	4.5e-26
WP_014470580.1|1052312_1052570_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
WP_014470579.1|1052573_1053413_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0S2SXP3	Bacillus_phage	57.2	7.8e-89
WP_014470578.1|1053494_1053908_+	hypothetical protein	NA	O64129	Bacillus_phage	86.8	5.0e-65
WP_076983676.1|1053904_1054168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470577.1|1054118_1054469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472595.1|1054603_1055038_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_014472594.1|1055350_1056073_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_014470573.1|1056082_1056721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470572.1|1056926_1057217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470570.1|1057561_1057768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470569.1|1057767_1058229_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	4.4e-25
WP_014470568.1|1058375_1059005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470567.1|1059133_1059445_+	hypothetical protein	NA	Q9T202	Bacillus_phage	54.6	2.1e-23
WP_014470566.1|1059622_1060378_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	57.2	7.1e-57
WP_014470565.1|1060364_1061570_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
WP_014470564.1|1061573_1063007_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.9	4.2e-151
WP_014470563.1|1062957_1063137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470562.1|1063274_1063994_+	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	50.6	2.5e-51
WP_014470561.1|1064008_1064869_+	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
WP_014470560.1|1064882_1065086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470559.1|1065097_1065967_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	3.9e-51
WP_014470558.1|1065981_1066317_+	hypothetical protein	NA	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	1.2e-29
WP_014470557.1|1066321_1066825_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	58.9	6.2e-49
WP_014470556.1|1066824_1067214_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	58.8	9.3e-29
WP_014470555.1|1067170_1067641_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	4.4e-49
WP_014470554.1|1067645_1068680_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	63.6	7.0e-124
WP_014470553.1|1068696_1069092_+	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
WP_014470552.1|1069192_1069492_+	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.7e-06
WP_014470551.1|1069650_1074306_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.7	5.2e-118
WP_014470550.1|1074306_1074864_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	67.0	2.4e-62
WP_014470549.1|1074878_1075238_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	72.9	1.1e-44
WP_014470548.1|1075221_1076190_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	58.9	7.6e-104
WP_014472588.1|1076189_1076537_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	58.3	2.9e-29
WP_014470546.1|1076533_1076890_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	5.7e-33
WP_014470545.1|1076882_1078058_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	71.9	1.1e-152
WP_014470544.1|1078054_1078684_+	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.8	1.4e-90
WP_014470543.1|1078698_1079919_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.3	6.1e-50
WP_014470542.1|1079937_1080402_+	hypothetical protein	NA	O64053	Bacillus_phage	34.9	6.6e-05
WP_014470541.1|1080391_1080586_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.5	8.2e-18
WP_013351240.1|1080649_1080928_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.7	1.1e-28
WP_014470539.1|1080943_1081207_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.0e-27
WP_014470538.1|1081261_1082419_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	64.1	4.7e-68
WP_014470537.1|1082459_1082837_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_014470536.1|1082852_1083728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470535.1|1084197_1084428_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014470534.1|1084593_1085034_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014472584.1|1085046_1086867_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	43.2	3.9e-109
>prophage 3
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	1099925	1102931	3954391		Bacillus_phage(100.0%)	6	NA	NA
WP_013351882.1|1099925_1100084_-	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
WP_013351883.1|1100243_1100573_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351884.1|1100565_1100958_+	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351885.1|1101607_1101883_-	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_014470521.1|1102333_1102543_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351886.1|1102556_1102931_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
>prophage 4
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	1138297	1174106	3954391	terminase,holin,tail,portal,plate	Bacillus_phage(30.3%)	46	NA	NA
WP_014470508.1|1138297_1139650_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.0e-13
WP_014470507.1|1140076_1140268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1140435_1141200_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1141343_1141811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144653870.1|1142015_1143152_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.6	1.4e-93
WP_003154881.1|1143141_1143276_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1143419_1144373_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1144410_1144788_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1144897_1145500_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1145642_1146233_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1146380_1146719_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1146909_1147089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1147078_1147906_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_038462769.1|1147805_1148606_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.7	1.4e-58
WP_013351938.1|1148870_1149212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1149201_1149405_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1149517_1150027_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_014470502.1|1150141_1150936_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.4	1.2e-59
WP_013351942.1|1150932_1152231_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1152279_1153671_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1153690_1154533_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1154559_1155495_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_014470501.1|1155511_1155895_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_013351946.1|1155891_1156248_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1156244_1156748_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351948.1|1156744_1157191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351949.1|1157187_1157397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1157396_1158794_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1158795_1159239_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1159313_1159760_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1159801_1159954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118977604.1|1159941_1165146_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	9.0e-42
WP_013351953.1|1165138_1165798_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1165811_1166789_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1166788_1167055_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_014470499.1|1167204_1167630_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	3.3e-11
WP_014471720.1|1167622_1168669_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	2.3e-69
WP_014470497.1|1168652_1169231_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	1.8e-12
WP_013351959.1|1169227_1169500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470496.1|1169502_1171266_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	50.0	6.6e-13
WP_014470495.1|1171277_1171604_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	1.2e-13
WP_014470494.1|1171603_1171768_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.4	1.0e-13
WP_014470493.1|1171822_1172620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1172673_1172937_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_014470492.1|1172950_1173214_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	6.7e-23
WP_014470491.1|1173227_1174106_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
>prophage 5
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	1715730	1726079	3954391		Bacillus_phage(71.43%)	12	NA	NA
WP_013352403.1|1715730_1716351_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
WP_016935991.1|1716512_1716602_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352404.1|1717018_1717555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470354.1|1718204_1720622_-	peptidase G2	NA	D6R401	Bacillus_phage	50.1	5.0e-221
WP_013352407.1|1720909_1721149_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352408.1|1721319_1721754_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352409.1|1721763_1721949_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352410.1|1722154_1722976_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352412.1|1723218_1724049_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352413.1|1724076_1724526_-	YndM family protein	NA	NA	NA	NA	NA
WP_013352414.1|1724681_1725110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611720.1|1725458_1726079_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 6
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	1974588	2002256	3954391	tRNA	Bacillus_phage(90.62%)	41	NA	NA
WP_014470255.1|1974588_1975143_-	hypothetical protein	NA	O64195	Bacillus_phage	92.7	1.1e-91
WP_014470254.1|1975240_1975480_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014470252.1|1975710_1976064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470251.1|1976063_1976423_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.3	1.9e-20
WP_014470250.1|1976419_1976803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470249.1|1976814_1977141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470248.1|1977239_1977758_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.6	7.1e-32
WP_014470247.1|1977757_1978597_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	9.4e-151
WP_080292729.1|1978611_1979022_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	60.0	5.8e-37
WP_014470245.1|1979068_1979368_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	57.0	3.2e-21
WP_014470244.1|1979360_1979633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470242.1|1980260_1980689_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	2.0e-72
WP_014470241.1|1980737_1981094_-|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_014470238.1|1981564_1982284_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	44.7	5.2e-49
WP_014470236.1|1982842_1983364_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	88.4	4.0e-83
WP_104843608.1|1986196_1986874_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.4e-120
WP_014470230.1|1986881_1987277_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	1.5e-63
WP_014470229.1|1987273_1987630_-	hypothetical protein	NA	O64171	Bacillus_phage	96.6	2.3e-58
WP_014470228.1|1987681_1988014_-	hypothetical protein	NA	O64168	Bacillus_phage	86.0	5.5e-14
WP_014470227.1|1988027_1988240_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.4	2.3e-29
WP_014470226.1|1988246_1988624_-	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	4.2e-18
WP_014470225.1|1988657_1988951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470224.1|1988992_1989298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470223.1|1989342_1989690_-	hypothetical protein	NA	O64164	Bacillus_phage	89.5	4.5e-51
WP_014470222.1|1989703_1990111_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	74.0	1.3e-49
WP_014470221.1|1990123_1990444_-	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	79.2	8.4e-44
WP_014470219.1|1990597_1991071_-	hypothetical protein	NA	O64162	Bacillus_phage	67.3	2.1e-59
WP_014470218.1|1991188_1991368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470217.1|1991397_1991622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038462847.1|1991664_1991862_-	hypothetical protein	NA	O64159	Bacillus_phage	64.6	2.6e-19
WP_014470215.1|1992126_1992354_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	69.3	1.2e-23
WP_014470214.1|1992391_1992610_-	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.1e-15
WP_144653880.1|1992656_1994150_-	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	99.2	1.8e-266
WP_014470212.1|1994235_1994478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470211.1|1994498_1995017_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	87.2	4.5e-87
WP_014470210.1|1995025_1995523_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	81.2	8.7e-72
WP_014470208.1|1995682_1995886_-	YorP family protein	NA	O64150	Bacillus_phage	82.1	3.5e-27
WP_014470205.1|1996428_1997175_-	3D domain-containing protein	NA	O64147	Bacillus_phage	53.0	1.6e-53
WP_014470204.1|1997182_1999474_-	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	7.8e-06
WP_014470203.1|1999491_2001180_-	single-stranded DNA endonuclease	NA	A0A1P8CX07	Bacillus_phage	43.3	3.3e-123
WP_014470202.1|2001191_2002256_-	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	38.9	6.5e-64
>prophage 7
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2005655	2032888	3954391	integrase	Bacillus_phage(83.78%)	48	1997530:1997543	2028862:2028875
1997530:1997543	attL	TCTTTTGTACTTTA	NA	NA	NA	NA
WP_014470199.1|2005655_2006993_-	hypothetical protein	NA	A0A0K2FMB7	Brevibacillus_phage	28.5	7.7e-06
WP_014470198.1|2007025_2007382_-	hypothetical protein	NA	O64139	Bacillus_phage	76.1	2.0e-41
WP_014470197.1|2007532_2007910_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	4.5e-52
WP_014470196.1|2007931_2008648_-	serine/threonine protein phosphatase	NA	M4H0M1	Listeria_phage	38.3	9.7e-40
WP_014470195.1|2008686_2010429_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.5	1.0e-220
WP_014470194.1|2010425_2011247_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	61.0	1.3e-85
WP_014470193.1|2011357_2011576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470192.1|2011650_2011923_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470191.1|2011912_2012800_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470190.1|2012848_2013328_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	35.4	4.0e-13
WP_014471975.1|2013343_2013595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470188.1|2013620_2013866_-	hypothetical protein	NA	O64132	Bacillus_phage	84.1	2.5e-27
WP_014470187.1|2013936_2014611_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_014470186.1|2014680_2015493_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.1	4.2e-140
WP_014470184.1|2015710_2015908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470183.1|2016213_2016459_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	91.5	6.7e-33
WP_014470181.1|2016758_2017121_-	hypothetical protein	NA	A0A0S2MUT8	Bacillus_phage	49.0	4.4e-33
WP_014470180.1|2017160_2017412_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.5	1.6e-18
WP_014470178.1|2017776_2018151_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.7e-35
WP_096034861.1|2018164_2018386_-	hypothetical protein	NA	O64123	Bacillus_phage	93.0	3.7e-30
WP_014470176.1|2018508_2019348_-	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	59.1	1.6e-78
WP_014470175.1|2019386_2019779_-	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_014470174.1|2019811_2020006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470173.1|2020029_2020266_-	hypothetical protein	NA	O64116	Bacillus_phage	82.1	2.2e-33
WP_014470172.1|2020286_2020472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470171.1|2020505_2021303_-	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.2	1.6e-70
WP_014470170.1|2021371_2021707_-	hypothetical protein	NA	O64111	Bacillus_phage	76.6	2.2e-42
WP_014470169.1|2021703_2021913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470168.1|2021912_2022290_-	hypothetical protein	NA	R4JKA5	Bacillus_phage	38.8	1.9e-18
WP_038463252.1|2022286_2022487_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	84.4	2.5e-25
WP_014470166.1|2022615_2022864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470165.1|2022850_2023030_-	hypothetical protein	NA	O64105	Bacillus_phage	59.3	1.1e-08
WP_014472526.1|2023148_2023346_-	hypothetical protein	NA	O64104	Bacillus_phage	61.5	6.0e-16
WP_014470163.1|2023424_2023640_-	YopT family protein	NA	O64103	Bacillus_phage	64.3	2.8e-19
WP_014470161.1|2024271_2025249_-	hypothetical protein	NA	O64101	Bacillus_phage	74.5	7.6e-136
WP_014470160.1|2025269_2026661_-	hypothetical protein	NA	O64100	Bacillus_phage	74.6	9.6e-201
WP_014470159.1|2026747_2027830_-|integrase	tyrosine-type recombinase/integrase	integrase	O64099	Bacillus_phage	63.3	1.1e-124
WP_014470158.1|2027813_2028047_-	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	60.0	8.9e-11
WP_038462857.1|2028091_2028430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470156.1|2028435_2028636_-	hypothetical protein	NA	O64096	Bacillus_phage	61.5	1.9e-14
WP_014470155.1|2028962_2029091_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
2028862:2028875	attR	TAAAGTACAAAAGA	NA	NA	NA	NA
WP_014470154.1|2029117_2030278_-	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	23.2	1.6e-07
WP_014470151.1|2030704_2031367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470150.1|2031385_2031922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470148.1|2032022_2032154_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	2.7e-17
WP_014470147.1|2032165_2032381_-	hypothetical protein	NA	O64089	Bacillus_phage	52.1	8.8e-13
WP_014470146.1|2032383_2032635_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	7.1e-22
WP_014417903.1|2032705_2032888_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
>prophage 8
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2041272	2063016	3954391		Bacillus_phage(87.5%)	21	NA	NA
WP_014470130.1|2041272_2041980_-	DNA-binding protein	NA	A0A1P8CWY0	Bacillus_phage	49.2	1.3e-52
WP_014470129.1|2042248_2044045_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.7	0.0e+00
WP_014472015.1|2044046_2044649_-	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
WP_014470127.1|2044650_2045568_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	87.9	2.4e-139
WP_014470126.1|2045573_2046428_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	85.6	5.3e-125
WP_014470125.1|2046743_2047961_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.7	6.4e-201
WP_003230987.1|2048042_2048231_-	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_076983670.1|2048275_2048491_-	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	1.6e-30
WP_014470124.1|2048544_2048721_-	hypothetical protein	NA	O64080	Bacillus_phage	92.1	1.3e-09
WP_014470123.1|2049683_2050796_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_014470122.1|2050795_2051095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102421742.1|2051249_2051528_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470120.1|2051602_2051782_+	hypothetical protein	NA	O64077	Bacillus_phage	58.9	1.5e-10
WP_014470119.1|2051822_2054339_+	hypothetical protein	NA	O64076	Bacillus_phage	83.1	0.0e+00
WP_014470118.1|2054596_2054872_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	7.0e-39
WP_014470117.1|2056026_2056227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470116.1|2056495_2056705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470115.1|2056716_2057934_+	hypothetical protein	NA	O64073	Bacillus_phage	97.3	9.8e-226
WP_014470112.1|2058334_2058835_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	32.5	1.1e-18
WP_014470111.1|2058943_2059951_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.5	9.6e-09
WP_014470110.1|2059950_2063016_+	heavy metal transporter	NA	A0A0K2FLD6	Brevibacillus_phage	30.0	8.1e-51
>prophage 9
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2068320	2079998	3954391	integrase	Bacillus_phage(83.33%)	19	2061735:2061750	2089117:2089132
2061735:2061750	attL	CTTTTCAAAAGACAGT	NA	NA	NA	NA
WP_014470103.1|2068320_2068986_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	51.1	1.6e-49
WP_014470102.1|2068982_2069489_+	hypothetical protein	NA	O64060	Bacillus_phage	66.7	1.7e-62
WP_014470101.1|2069485_2070211_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_038462869.1|2070249_2071047_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.2	1.5e-17
WP_014470099.1|2071067_2071535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470098.1|2071606_2071963_+	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
WP_014470097.1|2071962_2073294_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.6	1.3e-21
WP_014470096.1|2073307_2073583_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470095.1|2073583_2073736_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014470094.1|2073754_2074603_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470093.1|2074691_2075177_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.5	2.2e-59
WP_014470092.1|2075176_2075593_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	5.3e-46
WP_014470091.1|2075606_2076608_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	87.0	5.7e-171
WP_014472516.1|2076652_2076868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470089.1|2077035_2077536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470088.1|2077532_2078585_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
WP_014470087.1|2078613_2078796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470086.1|2078889_2079300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470085.1|2079371_2079998_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.8	1.9e-23
2089117:2089132	attR	ACTGTCTTTTGAAAAG	NA	NA	NA	NA
>prophage 10
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2096184	2107435	3954391	holin	Bacillus_phage(100.0%)	11	NA	NA
WP_014470077.1|2096184_2096436_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472510.1|2096791_2097052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470073.1|2098529_2099780_-	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	91.8	1.0e-222
WP_014470072.1|2099772_2100105_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	5.3e-41
WP_014470071.1|2101222_2101426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967548.1|2101654_2101771_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_014470070.1|2102078_2102537_-	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
WP_014470069.1|2102549_2104436_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	55.0	5.6e-111
WP_014470068.1|2104942_2105713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076982859.1|2105756_2106191_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470066.1|2106454_2107435_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.9	8.5e-79
>prophage 11
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2210115	2216368	3954391		Staphylococcus_phage(66.67%)	10	NA	NA
WP_013352726.1|2210115_2210709_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2210698_2211454_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2211661_2211751_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352728.1|2211838_2212360_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_014470034.1|2212304_2212520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352729.1|2212425_2212800_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2212916_2213381_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2213413_2214610_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_014470033.1|2214624_2215272_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2215252_2216368_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 12
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2780686	2856232	3954391	head,capsid,holin,protease,terminase,integrase,tail,portal,plate	Bacillus_phage(30.0%)	82	2818637:2818684	2856404:2856451
WP_014470850.1|2780686_2781091_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2781226_2781664_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2781788_2781938_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2781934_2782378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353278.1|2782494_2782968_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2783093_2783321_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2783317_2783887_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2784013_2784262_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2784458_2785790_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2785812_2786853_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2786910_2787069_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2787241_2788357_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_013353286.1|2788353_2789817_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	2.4e-77
WP_013353287.1|2789904_2790723_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2790781_2791606_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014470854.1|2791593_2793330_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2793326_2794739_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2795022_2795742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353292.1|2795885_2796356_+	membrane protein	NA	NA	NA	NA	NA
WP_014470856.1|2803703_2804285_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2804316_2805846_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2805865_2806396_-	membrane protein	NA	NA	NA	NA	NA
WP_013353296.1|2806542_2807031_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2807032_2807614_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2807684_2808893_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2808910_2810383_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2810583_2811144_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2811310_2811850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353302.1|2812013_2812682_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2812705_2813551_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2813690_2814866_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2815782_2816106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2816798_2817929_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2818316_2818520_+	hypothetical protein	NA	NA	NA	NA	NA
2818637:2818684	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_144653877.1|2819057_2819249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470865.1|2820782_2821016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353310.1|2821212_2821608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2821597_2822011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127721122.1|2822193_2822421_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2822543_2822846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2822901_2823207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2823221_2824637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2824687_2825053_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2825083_2825326_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2825789_2826461_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2826502_2826910_-|holin	holin	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2826947_2827121_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2827123_2827405_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_044051888.1|2827401_2828649_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	54.5	1.3e-79
WP_013353321.1|2828692_2831281_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2831295_2833176_-	autolysin	NA	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2833190_2834024_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013353324.1|2834035_2837809_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
WP_013353325.1|2837875_2838061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2838072_2838423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2838510_2839095_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2839127_2839511_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2839507_2839891_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2839890_2840214_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2840200_2840497_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2840552_2841746_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2841783_2842380_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2842372_2843617_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2843621_2843825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2843836_2845540_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2845536_2846010_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2846281_2846515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2846529_2846913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2846927_2847218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2847211_2847403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470879.1|2847406_2847790_-	hypothetical protein	NA	A0A2H4JI60	uncultured_Caudovirales_phage	36.2	4.3e-10
WP_013353336.1|2847789_2848068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2848064_2848244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2848666_2848858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353338.1|2848850_2849039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353339.1|2849223_2849973_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.8	1.6e-21
WP_076983889.1|2851544_2851790_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	67.5	1.2e-05
WP_014470885.1|2852835_2852970_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2853014_2853977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2854181_2854361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013353341.1|2854547_2855081_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013353342.1|2855080_2856232_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.8	7.8e-31
2856404:2856451	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 13
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	2961440	2991584	3954391	holin,terminase,integrase,tail,portal,plate,bacteriocin	Paenibacillus_phage(36.36%)	34	2974767:2974782	2990534:2990549
WP_003151973.1|2961440_2961776_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_014470922.1|2961842_2962415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470925.1|2963587_2964349_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470927.1|2964834_2965137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470928.1|2965263_2965521_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	6.6e-23
WP_038463031.1|2965541_2966480_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	65.0	1.4e-94
WP_013351581.1|2966559_2966769_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_014470930.1|2966772_2966961_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|2966961_2967231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080292733.1|2967245_2968796_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	6.1e-55
WP_038463035.1|2968841_2971406_-	peptidase G2	NA	D6R401	Bacillus_phage	74.5	0.0e+00
WP_014470934.1|2971420_2972821_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_014470935.1|2972832_2974257_-	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	3.1e-61
WP_014470936.1|2974263_2976486_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	37.8	3.4e-59
2974767:2974782	attL	TAATATCCGCGACCCG	NA	NA	NA	NA
WP_014470937.1|2976734_2977343_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_013351572.1|2977343_2977580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470938.1|2977675_2978047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470939.1|2978104_2978659_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_014470940.1|2978683_2979073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470941.1|2979079_2979487_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_038463040.1|2979483_2979819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470943.1|2979819_2980206_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	4.6e-20
WP_014470944.1|2980219_2980411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470945.1|2980467_2981376_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	9.3e-80
WP_014470946.1|2981407_2981974_-	hypothetical protein	NA	M1NRH2	Streptococcus_phage	30.7	6.1e-05
WP_014470947.1|2982064_2982889_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.4	2.0e-73
WP_014470948.1|2982888_2984529_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.5	1.4e-163
WP_014470949.1|2984534_2984966_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	2.5e-30
WP_014470950.1|2984982_2986737_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_014470951.1|2986819_2987368_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_014470954.1|2987868_2988114_-	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	68.3	1.6e-05
WP_014470955.1|2988385_2988664_-	hypothetical protein	NA	A0A217EQU8	Bacillus_phage	42.4	3.9e-13
WP_014470956.1|2989500_2990100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470957.1|2990792_2991584_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	31.9	7.2e-28
2990534:2990549	attR	CGGGTCGCGGATATTA	NA	NA	NA	NA
>prophage 14
NZ_CP041693	Bacillus amyloliquefaciens strain H chromosome, complete genome	3954391	3507438	3563424	3954391	coat,protease,tRNA	Bacillus_phage(11.11%)	57	NA	NA
WP_013353950.1|3507438_3509109_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013353951.1|3509105_3509534_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_014471164.1|3509919_3510147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471165.1|3510152_3511547_-	YncE family protein	NA	NA	NA	NA	NA
WP_013353955.1|3511775_3512921_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.9	6.5e-78
WP_014471166.1|3512904_3513024_+	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_013353956.1|3513137_3514010_-	agmatinase	NA	NA	NA	NA	NA
WP_013353957.1|3514068_3514899_-	spermidine synthase	NA	NA	NA	NA	NA
WP_013353958.1|3515098_3517171_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_013353959.1|3517195_3517627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353960.1|3517770_3518292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471167.1|3518304_3518964_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3519068_3519257_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_013353962.1|3519295_3519715_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014471168.1|3520094_3521474_+	amino acid permease	NA	NA	NA	NA	NA
WP_014471169.1|3521538_3522039_-	YwgA family protein	NA	NA	NA	NA	NA
WP_014471170.1|3522078_3523380_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	1.0e-23
WP_003151034.1|3523541_3523766_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_014472347.1|3523969_3524743_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014471173.1|3525043_3525319_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014471174.1|3525319_3525874_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_014471175.1|3526888_3527842_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014471176.1|3527831_3528668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472350.1|3528658_3529456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471177.1|3529424_3530348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353974.1|3530397_3530577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471178.1|3530730_3531594_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_014471179.1|3531649_3532540_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
WP_014471180.1|3532654_3533632_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_013353978.1|3533670_3534642_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014471181.1|3534898_3535663_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014471182.1|3535781_3536561_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014471183.1|3536575_3537775_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3537787_3538969_-	MFS transporter	NA	NA	NA	NA	NA
WP_014471184.1|3538965_3540384_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_013353985.1|3540400_3541162_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
WP_014471185.1|3541158_3541869_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014471186.1|3541858_3542473_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_014471187.1|3542634_3543873_-	MFS transporter	NA	NA	NA	NA	NA
WP_014471188.1|3544093_3545296_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	3.8e-28
WP_014471189.1|3545327_3546746_-	amino acid permease	NA	NA	NA	NA	NA
WP_014471190.1|3546770_3548453_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014471191.1|3548524_3550072_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353994.1|3550279_3551566_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_014471192.1|3551752_3552214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471193.1|3552440_3552896_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014471194.1|3552892_3553741_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.7e-36
WP_038463135.1|3553761_3554709_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.5	4.5e-69
WP_014471196.1|3554711_3555449_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.3	5.0e-47
WP_014471197.1|3555476_3556481_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014471198.1|3556482_3557223_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014471199.1|3557215_3558337_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013354003.1|3558336_3559200_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014471200.1|3559200_3560370_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_013354005.1|3560392_3561817_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_013354006.1|3561821_3562592_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	30.7	7.6e-06
WP_013354007.1|3562872_3563424_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
