The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	1744549	1754012	5311952	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1744549_1745665_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1745661_1747602_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1747678_1747900_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1748225_1748543_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1748573_1750853_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1750972_1751191_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1751544_1752246_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004179158.1|1752290_1754012_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	2231275	2305678	5311952	holin,capsid,integrase,head,plate,transposase,protease,tail,terminase,portal	Klebsiella_phage(67.27%)	83	2223737:2223752	2298206:2298221
2223737:2223752	attL	CGCGCAAAACGGTGTC	NA	NA	NA	NA
WP_004179531.1|2231275_2232037_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.4e-20
WP_004196458.1|2232253_2233786_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
WP_032422207.1|2233984_2234533_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_023304713.1|2234728_2235910_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
WP_009309074.1|2235890_2236082_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_023304714.1|2236142_2236355_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	4.4e-33
WP_023304715.1|2236351_2236576_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	1.6e-28
WP_032422208.1|2236565_2237276_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	4.7e-111
WP_021441619.1|2237281_2237800_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	99.4	1.3e-94
WP_023304718.1|2237904_2238732_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_023304719.1|2238728_2238923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2238919_2239345_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2239341_2239560_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_023304720.1|2239531_2239786_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	1.0e-36
WP_023304721.1|2239778_2240144_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|2240144_2240369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304722.1|2240551_2240965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304723.1|2241128_2241803_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_049245616.1|2241943_2242177_+	transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_032422209.1|2242301_2242586_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.5e-31
WP_023304724.1|2242895_2244554_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.4	0.0e+00
WP_004198233.1|2244555_2245518_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2245514_2245991_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_023304725.1|2245987_2246803_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	77.9	4.4e-113
WP_004184721.1|2246959_2247217_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_004197458.1|2247122_2247569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304727.1|2248132_2248528_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	97.7	5.9e-63
WP_019705280.1|2248514_2248796_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|2248795_2249425_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_023304729.1|2249432_2249708_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	68.5	4.1e-23
WP_032422211.1|2249658_2249853_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.4	1.0e-23
WP_004184720.1|2249943_2250228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304730.1|2250360_2250633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184717.1|2250956_2251202_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	52.6	2.0e-13
WP_004143907.1|2251363_2251678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422212.1|2251686_2251977_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	90.6	1.2e-49
WP_023304731.1|2252189_2252624_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	1.4e-73
WP_004143904.1|2252633_2254166_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143903.1|2254168_2255446_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.8	8.1e-247
WP_004216821.1|2255451_2256132_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_023304732.1|2256143_2257307_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
WP_044067369.1|2257343_2257586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184712.1|2257533_2257860_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	96.3	1.4e-54
WP_023304733.1|2257920_2258118_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	95.4	2.7e-24
WP_004184710.1|2258119_2258452_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|2258444_2258984_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_004184708.1|2258980_2259346_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	3.5e-62
WP_000115125.1|2259402_2259894_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004184706.1|2259937_2260291_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	97.4	4.2e-60
WP_001333686.1|2260323_2260587_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_052433481.1|2260583_2261015_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	99.2	9.6e-67
WP_023304734.1|2261078_2263514_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	98.0	0.0e+00
WP_145852097.1|2263513_2263993_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	3.9e-93
WP_023304736.1|2263979_2264462_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	1.9e-84
WP_017880229.1|2264471_2264852_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_023304737.1|2264848_2267917_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.0	0.0e+00
WP_023304738.1|2267993_2270975_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	75.7	1.6e-40
WP_023304739.1|2271060_2272155_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4J709	uncultured_Caudovirales_phage	37.7	2.3e-32
WP_072221680.1|2272264_2272810_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_048257941.1|2272838_2273408_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	94.8	1.9e-86
WP_032409522.1|2273485_2273908_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.1e-26
WP_023304742.1|2274314_2274563_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	69.1	2.0e-24
WP_004179540.1|2275408_2275900_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004179542.1|2275942_2277487_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004197477.1|2277499_2278840_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004179546.1|2278836_2279526_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004179548.1|2279522_2281229_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2281233_2281725_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004179550.1|2281989_2284644_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	2.9e-97
WP_145852099.1|2284636_2287156_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
WP_145852101.1|2287148_2288381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527865.1|2288387_2288750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197474.1|2288785_2290546_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_145852103.1|2290542_2290803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958252.1|2290789_2291557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179560.1|2291736_2292258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179562.1|2292450_2293548_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_004179566.1|2294992_2296201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179567.1|2296197_2299656_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
2298206:2298221	attR	CGCGCAAAACGGTGTC	NA	NA	NA	NA
WP_004179568.1|2299652_2301251_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190508.1|2302333_2302804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304747.1|2302880_2304635_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004179571.1|2304598_2305678_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	2498984	2509871	5311952		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2498984_2499605_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|2499597_2500863_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|2500874_2501777_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2502037_2502799_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|2502819_2503680_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|2503977_2504238_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|2504324_2505413_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|2505443_2506709_-	MFS transporter	NA	NA	NA	NA	NA
WP_145852113.1|2506763_2509871_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	3392579	3437188	5311952	capsid,holin,head,integrase,protease,tail,terminase,portal	Klebsiella_phage(37.25%)	60	3397518:3397577	3437299:3437363
WP_002911592.1|3392579_3393074_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_022631353.1|3393054_3394488_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.1e-101
WP_002911594.1|3394531_3395239_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004151461.1|3395281_3395563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072157838.1|3395443_3395710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|3396101_3397247_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
3397518:3397577	attL	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAG	NA	NA	NA	NA
WP_031591633.1|3397852_3398179_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	2.8e-26
WP_023149922.1|3398181_3398421_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	3.4e-21
WP_145852294.1|3398531_3399116_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.4	1.5e-86
WP_145852155.1|3399441_3399696_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023304739.1|3399805_3400900_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4J709	uncultured_Caudovirales_phage	37.7	2.3e-32
WP_145852157.1|3400984_3403966_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	63.4	1.3e-40
WP_145852159.1|3404043_3407112_-	kinase	NA	A0A286S259	Klebsiella_phage	96.2	0.0e+00
WP_145852161.1|3407108_3407489_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	3.1e-69
WP_004104211.1|3407498_3407981_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	9.6e-84
WP_117048847.1|3407967_3408447_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	3.0e-93
WP_145852296.1|3408446_3410981_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	75.2	0.0e+00
WP_135697717.1|3411029_3411407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104224.1|3411465_3411729_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
WP_004899623.1|3411731_3412115_-	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_131025723.1|3412158_3412650_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	98.8	5.6e-87
WP_004104227.1|3412706_3413072_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
WP_004143897.1|3413068_3413608_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.9	3.0e-94
WP_145852162.1|3413600_3413933_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.3e-55
WP_004143899.1|3413934_3414132_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_040186339.1|3414201_3414522_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_105166389.1|3414518_3414734_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	40.9	1.2e-06
WP_040186336.1|3414760_3415969_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	1.7e-193
WP_004884313.1|3415983_3416637_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_004899640.1|3416623_3417853_-|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_049162791.1|3417852_3418038_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	65.6	2.8e-15
WP_117048965.1|3418047_3419778_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	6.6e-300
WP_004884285.1|3419774_3420269_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032432323.1|3420398_3420749_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	3.2e-52
WP_040200671.1|3420751_3421072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032732966.1|3421137_3421383_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.9e-35
WP_130939208.1|3421490_3421721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032446331.1|3422057_3422249_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	93.2	1.5e-24
WP_145852165.1|3422199_3422475_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	40.4	4.9e-08
WP_023320787.1|3422471_3422819_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_023301209.1|3422815_3423355_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_024176410.1|3423351_3423651_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_145852167.1|3424564_3425596_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_145852169.1|3425585_3426764_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	29.1	7.0e-43
WP_145852171.1|3426787_3427135_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	4.7e-56
WP_064156533.1|3427153_3428134_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_000779146.1|3428146_3428524_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_064081157.1|3428533_3429343_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.7e-110
WP_145852173.1|3429339_3430254_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_023317571.1|3430210_3430423_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_000230161.1|3430660_3431122_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_102804891.1|3431156_3431345_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.7	2.0e-16
WP_058228644.1|3431444_3432077_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	54.5	1.0e-48
WP_145852175.1|3433660_3433960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130995579.1|3433959_3434745_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.1e-63
WP_104457896.1|3435046_3435469_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	65.7	5.2e-33
WP_130995580.1|3435455_3435659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077267956.1|3435655_3435934_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	46.1	3.9e-13
WP_004184757.1|3435966_3436194_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_023317562.1|3436195_3437188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
3437299:3437363	attR	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACCGG	NA	NA	NA	NA
>prophage 5
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	3783862	3836681	5311952	integrase,terminase,head,holin	Enterobacteria_phage(13.11%)	74	3780462:3780477	3789156:3789171
3780462:3780477	attL	GCCAGCATCTCGCCAA	NA	NA	NA	NA
WP_004149224.1|3783862_3784792_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
WP_032281327.1|3785117_3786278_+|integrase	tyrosine-type recombinase/integrase	integrase	Q716F9	Shigella_phage	85.6	6.1e-193
WP_117272954.1|3786451_3786658_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.5e-09
WP_021518677.1|3786767_3787007_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	2.1e-15
WP_145852197.1|3787078_3790351_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	27.9	3.7e-62
3789156:3789171	attR	GCCAGCATCTCGCCAA	NA	NA	NA	NA
WP_077265457.1|3790360_3791404_-	hypothetical protein	NA	A0A2R3UAP8	Myoviridae_environmental_samples	43.3	1.3e-16
WP_004177045.1|3791405_3791993_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_060613534.1|3791985_3793218_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.0	1.8e-105
WP_001518114.1|3793225_3793582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060613536.1|3793657_3794446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042932519.1|3794609_3795059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060613538.1|3795125_3795713_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.1	2.5e-25
WP_060613540.1|3795702_3796572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725008.1|3796568_3796874_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_060613543.1|3796875_3797715_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.9	2.0e-28
WP_060613546.1|3797718_3799677_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.1	3.4e-42
WP_025713742.1|3799881_3800358_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_060613549.1|3800419_3800950_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	94.9	6.4e-89
WP_023304864.1|3801130_3801574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060613551.1|3801573_3803055_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	3.9e-59
WP_050008823.1|3803058_3803610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060613554.1|3803591_3803960_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.6e-06
WP_012542595.1|3803956_3804520_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	3.7e-18
WP_041937856.1|3804522_3804966_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_040218278.1|3804965_3805292_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	4.8e-10
WP_145852199.1|3805293_3806331_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	5.5e-84
WP_145852201.1|3806330_3806813_-	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	57.7	1.7e-32
WP_001518134.1|3806814_3807984_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	2.6e-58
WP_060613556.1|3807987_3808686_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	53.1	3.2e-64
WP_117272996.1|3808738_3810259_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	8.2e-105
WP_023304875.1|3810259_3811936_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_117033032.1|3811937_3812423_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	78.3	2.0e-65
WP_145852204.1|3812454_3813090_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	5.5e-103
WP_046659660.1|3813413_3813842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071789770.1|3813980_3814235_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	67.9	1.5e-22
WP_117272997.1|3814122_3814512_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.8	6.3e-25
WP_145852300.1|3814508_3815006_-	glycoside hydrolase family protein	NA	K7P7Q3	Enterobacteria_phage	82.4	6.9e-77
WP_012542609.1|3814983_3815253_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_117272998.1|3816093_3816783_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	6.0e-63
WP_023339697.1|3816779_3816920_-	YlcG family protein	NA	NA	NA	NA	NA
WP_094336776.1|3816916_3817498_-	protein NinG	NA	E7C9S3	Salmonella_phage	49.8	1.3e-39
WP_023342724.1|3817490_3817661_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_087847249.1|3817660_3818116_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_064161320.1|3818367_3818673_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	5.1e-14
WP_077266649.1|3818665_3819304_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.5	3.3e-39
WP_023283338.1|3819564_3819777_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
WP_048983288.1|3820401_3820662_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.8e-29
WP_048983289.1|3820658_3821144_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.4	1.8e-13
WP_145852206.1|3821140_3821365_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	50.0	4.6e-12
WP_065523343.1|3821361_3821655_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_145852208.1|3821654_3823085_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.5	2.0e-185
WP_145852210.1|3823074_3823974_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.5	3.5e-87
WP_101978744.1|3824147_3824432_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	57.4	1.4e-21
WP_004151299.1|3824472_3824706_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_042632509.1|3824833_3825523_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	6.7e-62
WP_008807814.1|3825977_3826184_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_145852212.1|3826263_3827235_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.8	8.2e-66
WP_145852214.1|3827242_3827440_+	thioredoxin reductase	NA	NA	NA	NA	NA
WP_145852217.1|3827591_3828245_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	3.0e-64
WP_095463625.1|3828228_3828519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023341886.1|3828515_3828821_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145852219.1|3828817_3829474_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	2.3e-112
WP_145852221.1|3829470_3830241_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.0	3.2e-65
WP_060415520.1|3830237_3830459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077269028.1|3830344_3830962_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	46.3	1.3e-37
WP_025269983.1|3830958_3831150_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_145852224.1|3831146_3831983_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.7	1.8e-69
WP_085858690.1|3831979_3832201_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	1.4e-13
WP_077251091.1|3832238_3832862_+	AP2/ERF family transcription factor	NA	A0A2I7R856	Vibrio_phage	48.6	3.9e-37
WP_023301637.1|3832902_3833103_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_004174945.1|3833439_3833922_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_004180785.1|3834290_3835172_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004180788.1|3835181_3836090_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180790.1|3836222_3836681_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
>prophage 6
NZ_CP030072	Klebsiella pneumoniae strain DA12090 chromosome, complete genome	5311952	4593294	4638389	5311952	plate,holin,head,capsid,integrase,lysis,tRNA,tail,terminase,portal	Escherichia_phage(31.71%)	49	4586298:4586312	4635292:4635306
4586298:4586312	attL	GGCTGGCGGCGCAGC	NA	NA	NA	NA
WP_004181358.1|4593294_4594308_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.1e-108
WP_001144069.1|4594545_4594761_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004149864.1|4594872_4596618_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|4596836_4598678_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|4598777_4599284_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032454093.1|4599652_4599871_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	1.0e-32
WP_071891073.1|4599963_4600371_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.4	5.9e-26
WP_062920444.1|4600419_4601580_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
WP_064168936.1|4601579_4602059_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	76.4	6.5e-64
WP_145852245.1|4602075_4604514_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.4	1.6e-291
WP_015959005.1|4604506_4604644_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_004195711.1|4604658_4604934_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_145852247.1|4604993_4605509_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	5.5e-69
WP_117057395.1|4605522_4606704_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	3.0e-195
WP_145852249.1|4606814_4607888_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	44.5	3.3e-31
WP_117057393.1|4610312_4610915_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.0	2.9e-53
WP_117057392.1|4610907_4611816_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.9	1.3e-113
WP_014343405.1|4611820_4612168_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_117057391.1|4612164_4612806_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	6.8e-93
WP_117057390.1|4613005_4614259_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_145852250.1|4614283_4614742_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	3.4e-46
WP_145852252.1|4614734_4615202_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	7.7e-62
WP_115722967.1|4615164_4615416_-|holin	holin	holin	S4TNY4	Salmonella_phage	72.5	2.6e-24
WP_145852254.1|4615297_4615729_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	9.0e-41
WP_145852256.1|4615725_4616223_-	glycoside hydrolase family protein	NA	A0A0F7LBS0	Escherichia_phage	87.9	2.1e-81
WP_009309693.1|4616209_4616500_-|holin	holin	holin	O80308	Escherichia_phage	84.7	9.1e-37
WP_004175163.1|4616504_4616708_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_145852258.1|4616707_4617214_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	1.0e-59
WP_145852261.1|4617310_4618054_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.3	5.1e-100
WP_145852263.1|4618057_4619116_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.5	7.1e-164
WP_032454108.1|4619189_4620044_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.6	4.8e-126
WP_145852265.1|4620209_4621979_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	8.2e-306
WP_145852267.1|4621978_4623022_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	2.6e-166
WP_145852269.1|4623527_4626200_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_145852271.1|4626239_4626698_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	73.0	1.7e-50
WP_145852273.1|4626813_4629042_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.8	0.0e+00
WP_047718529.1|4629034_4629316_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_042943327.1|4629316_4629538_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	87.7	4.0e-29
WP_032454118.1|4629537_4629765_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
WP_032454119.1|4629833_4630172_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_032454120.1|4630135_4630336_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
WP_145852275.1|4630343_4630853_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	92.9	1.7e-83
WP_145852277.1|4630883_4631105_-	regulator	NA	NA	NA	NA	NA
WP_032454122.1|4631224_4631809_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
WP_145852279.1|4631815_4632853_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
WP_004181362.1|4633519_4633792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181363.1|4633860_4634175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174237.1|4634527_4635142_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004181365.1|4635146_4638389_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
4635292:4635306	attR	GGCTGGCGGCGCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	0	6549	185511	transposase	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_004152117.1|1235_1805_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|1839_2121_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|2364_2628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|2642_2906_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|4056_5064_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|5099_5789_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004181995.1|5799_6549_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
>prophage 2
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	10148	20976	185511	transposase	Hokovirus(20.0%)	6	NA	NA
WP_004181991.1|10148_13529_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181990.1|13491_14412_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
WP_072143344.1|15408_16377_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_080925134.1|17190_17436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118832.1|18287_20021_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|20028_20976_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
>prophage 3
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	34458	42318	185511		Bacillus_virus(25.0%)	6	NA	NA
WP_004152282.1|34458_35226_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|35324_35618_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|35948_36191_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_040251959.1|37601_37817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831235.1|38039_39122_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_004182121.1|39243_42318_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
>prophage 4
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	48553	49689	185511	transposase	Shigella_phage(100.0%)	2	NA	NA
WP_000537151.1|48553_48838_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
WP_077254108.1|48834_49689_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	5.2e-80
>prophage 5
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	53562	57680	185511		Wolbachia_phage(33.33%)	7	NA	NA
WP_029498342.1|53562_54114_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.4e-17
WP_016831065.1|54217_54526_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	30.8	4.7e-07
WP_016831064.1|54522_55173_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_016831063.1|55228_55450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831062.1|56045_56267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055330116.1|56328_56883_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_016831060.1|56954_57680_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.6	5.5e-06
>prophage 6
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	93409	97011	185511		Cronobacter_phage(25.0%)	8	NA	NA
WP_004182076.1|93409_94231_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_032428126.1|94327_94546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004182074.1|95063_95477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|95477_95756_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_145852006.1|95745_96066_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	5.2e-09
WP_020325128.1|96146_96371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182070.1|96381_96594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|96654_97011_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 7
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	101303	105668	185511		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
WP_108978840.1|101303_103361_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.5	1.8e-22
WP_004182058.1|103430_103679_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004182056.1|103727_104270_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
WP_032428126.1|104373_104592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145852009.1|104889_105210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004182054.1|105104_105668_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 8
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	108750	114260	185511		Pectobacterium_phage(25.0%)	7	NA	NA
WP_004152754.1|108750_109005_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|109241_109667_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004118481.1|110186_110417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065615.1|110650_112159_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
WP_072145371.1|112158_112410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182047.1|112563_112989_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_132369617.1|112988_114260_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	2.1e-154
>prophage 9
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	122664	130113	185511	integrase	Macacine_betaherpesvirus(60.0%)	5	122095:122108	131580:131593
122095:122108	attL	ATATTTCAGTTCTG	NA	NA	NA	NA
WP_004182039.1|122664_123636_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182032.1|123635_124802_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182030.1|125553_126564_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|127281_128022_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_023328266.1|129165_130113_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	5.1e-12
131580:131593	attR	ATATTTCAGTTCTG	NA	NA	NA	NA
>prophage 10
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	142155	145480	185511		Bacillus_phage(66.67%)	4	NA	NA
WP_023328274.1|142155_142506_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.4e-20
WP_000790483.1|142649_143081_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|143331_144807_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|144799_145480_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
>prophage 11
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	148853	156110	185511		Leptospira_phage(33.33%)	5	NA	NA
WP_004098958.1|148853_152000_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|152086_152527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132369585.1|152653_155101_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|155141_155339_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|155372_156110_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 12
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	161203	163281	185511		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|161203_161884_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|161880_163281_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
>prophage 13
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	167799	168510	185511		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_085921126.1|167799_168510_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 14
NZ_CP030071	Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence	185511	171967	176274	185511		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152097.1|171967_172393_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|172405_173695_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|173742_175494_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|175511_175874_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|175923_176274_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
