The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	240554	285199	5559705	integrase,protease,holin,transposase	Brevibacillus_phage(52.63%)	51	251867:251926	260313:260400
WP_113758805.1|240554_241064_-|protease	serine protease	protease	NA	NA	NA	NA
WP_113758806.1|241290_242064_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_113758807.1|242539_242893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327945.1|243765_244860_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_158327946.1|245084_245609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327947.1|245976_246420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327948.1|246374_246869_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_158327949.1|247190_247421_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	76.5	9.7e-26
WP_113759902.1|248177_248732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327950.1|248824_249721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330113.1|250983_251292_-|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	70.1	2.1e-23
WP_158327951.1|251401_251866_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	89.1	5.1e-66
251867:251926	attL	ATTTCCGGACAAATTTCGGACAAACCGCAATTCCGAAGCCGAAAACCCTTGATACGAAAG	NA	NA	NA	NA
WP_158327952.1|252157_252379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327953.1|252421_252676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158327954.1|253136_253814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327955.1|253917_254115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327956.1|254453_254792_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	92.8	5.0e-55
WP_158327957.1|254984_256158_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.8e-35
WP_158327958.1|256335_257307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758988.1|258106_258193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758987.1|258306_258948_-	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	83.5	2.3e-96
WP_113758986.1|258946_259135_+	helix-turn-helix transcriptional regulator	NA	S5MNP8	Brevibacillus_phage	64.4	1.2e-13
WP_158330114.1|259127_260312_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	84.3	4.2e-181
WP_158325743.1|260374_261772_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
260313:260400	attR	ATTTCCGGACAAATTTCGGACAAACCGCAATTCCGAAGCCGAAAACCCTTGATACGAAAGGGTTATCCGATACTTCCTTCCATCTCGA	NA	NA	NA	NA
WP_113758984.1|261815_262253_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_113758983.1|262239_263466_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.9	5.8e-109
WP_158327959.1|263462_264764_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_113758981.1|264788_265574_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.0	6.1e-11
WP_158327960.1|265934_266531_-	DUF1802 family protein	NA	NA	NA	NA	NA
WP_158327961.1|266777_268355_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	57.6	2.9e-177
WP_113758978.1|268622_268985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758977.1|269412_269814_-	VOC family protein	NA	NA	NA	NA	NA
WP_113758976.1|269871_270303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758975.1|270511_271921_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	1.4e-34
WP_158325749.1|271924_272620_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.6	1.2e-34
WP_158327962.1|272668_274024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325751.1|274174_274555_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_113758971.1|274731_275184_-	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	32.4	2.0e-22
WP_113758970.1|275274_275820_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_113758969.1|276025_276415_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.3	8.8e-19
WP_113758991.1|276487_276706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327963.1|276863_277214_-	DUF1878 domain-containing protein	NA	NA	NA	NA	NA
WP_158327964.1|277238_277664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327965.1|277834_278314_-	hypothetical protein	NA	A0A0K2FM88	Brevibacillus_phage	86.2	1.2e-70
WP_113758965.1|278523_278760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327966.1|279302_279950_-	hypothetical protein	NA	S5MUJ6	Brevibacillus_phage	29.1	1.8e-21
WP_158327967.1|280221_281655_-	DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	53.2	4.4e-140
WP_113758962.1|281925_282507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758961.1|282510_283071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330115.1|283181_283349_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	A0A0K2CPM5	Brevibacillus_phage	72.7	1.5e-07
WP_158327968.1|283747_285199_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	352141	359404	5559705	integrase	Brevibacillus_phage(33.33%)	10	348411:348424	368309:368322
348411:348424	attL	TAAAAAAGCCCCCT	NA	NA	NA	NA
WP_158327992.1|352141_352861_-	hypothetical protein	NA	S5MP04	Brevibacillus_phage	53.4	2.5e-67
WP_158327993.1|352857_353790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327994.1|354621_355611_-	hypothetical protein	NA	S5MUL0	Brevibacillus_phage	75.6	1.9e-78
WP_158327995.1|355683_355914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327996.1|355910_356189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325123.1|356550_356850_-	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	37.1	2.0e-10
WP_158325122.1|356993_357194_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158327997.1|357304_357742_+	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	43.4	4.1e-25
WP_158327998.1|357759_358176_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	47.3	2.7e-26
WP_158327999.1|358252_359404_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	38.4	7.5e-66
368309:368322	attR	TAAAAAAGCCCCCT	NA	NA	NA	NA
>prophage 3
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	881096	997432	5559705	protease,integrase,tRNA,transposase	Bacillus_phage(18.75%)	107	891740:891756	917941:917957
WP_158328201.1|881096_882440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328201.1|882840_884184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328202.1|884713_885424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113759186.1|885511_885697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328203.1|885757_886057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330124.1|886028_886160_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	A0A0K2FM00	Brevibacillus_phage	67.5	3.0e-08
WP_158328204.1|886629_887919_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNR6	Brevibacillus_phage	58.0	1.1e-137
WP_158328205.1|888406_888856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113759196.1|889691_890171_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_113759197.1|890176_890410_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_158328206.1|890759_891179_-	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_158328207.1|891269_891752_-	hypothetical protein	NA	NA	NA	NA	NA
891740:891756	attL	TTTTGTTTATCATAAAT	NA	NA	NA	NA
WP_113759208.1|893649_893775_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_158328208.1|894093_894276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113759947.1|895474_895858_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_158330125.1|895947_897630_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_113758191.1|897845_897998_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_113758190.1|898028_898235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758189.1|898344_899619_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.5	7.6e-11
WP_158326699.1|899866_900181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328209.1|900207_900996_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.3	5.0e-45
WP_113758186.1|901014_901794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328210.1|901780_903169_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_158328211.1|903165_904998_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.0	8.6e-32
WP_113758183.1|904990_905701_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	1.1e-43
WP_158328212.1|905871_907365_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	50.5	8.9e-19
WP_158328213.1|907733_908105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758180.1|908308_908521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758179.1|908700_909987_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	38.1	1.9e-70
WP_113758178.1|910283_911630_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	51.5	1.1e-121
WP_113758177.1|911658_912102_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_113758176.1|912117_914055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328214.1|914070_915051_-	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_113758174.1|915127_915358_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_113758173.1|915408_915879_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	69.2	6.6e-53
WP_113758172.1|915904_916192_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_158328215.1|916332_917433_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_158328216.1|918219_918906_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	3.4e-34
917941:917957	attR	TTTTGTTTATCATAAAT	NA	NA	NA	NA
WP_158328217.1|919091_919259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328218.1|919745_920408_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	1.6e-36
WP_158330126.1|920421_921933_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.9	2.4e-16
WP_158328219.1|922277_922757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158326729.1|922788_923496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158326707.1|923618_923837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328220.1|924048_924183_+	recombinase family protein	NA	NA	NA	NA	NA
WP_158328221.1|924524_926456_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_158328222.1|926883_928335_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_113758167.1|928503_928716_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_113758166.1|928720_929635_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_113758165.1|929655_929907_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_113758164.1|930117_930744_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	36.5	1.2e-17
WP_158328223.1|930799_931960_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_113758162.1|931973_932819_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	37.2	1.7e-14
WP_158326712.1|932815_933574_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.6	1.8e-23
WP_158328224.1|933752_934607_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	33.8	1.9e-18
WP_113758194.1|934917_935487_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.4	7.8e-16
WP_113758159.1|935723_936440_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_158328225.1|936451_938353_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_158330127.1|938364_939735_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_113758156.1|939892_940534_-	protein jag	NA	NA	NA	NA	NA
WP_113758155.1|940530_941298_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_113758193.1|941332_941554_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	60.6	2.9e-19
WP_158326715.1|941560_941929_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003333985.1|942115_942250_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_113758153.1|942836_944198_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_158328226.1|944434_945574_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	27.1	1.8e-32
WP_158328227.1|945605_945824_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_158328228.1|945838_946957_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_158328229.1|946967_947261_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_113758148.1|947260_949183_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.2	7.9e-153
WP_113758144.1|949307_950150_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113758143.1|950296_951544_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_113758142.1|951683_952673_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_158326719.1|953280_954048_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	9.5e-33
WP_158328230.1|954034_955954_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_158328231.1|956051_956876_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_158328232.1|956865_957597_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158330128.1|957593_958784_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_158328233.1|958776_959802_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_158328234.1|959859_960570_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_158328235.1|960566_961928_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.3	3.8e-16
WP_113758133.1|962168_963119_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_113758132.1|963253_963976_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_158328236.1|964196_966752_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	5.4e-125
WP_158326725.1|966915_968022_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_158328237.1|973422_974448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113757685.1|974628_976089_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.0	4.6e-105
WP_113757952.1|976225_976327_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	78.8	2.0e-07
WP_158328238.1|976478_977822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328239.1|977910_978717_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	85.4	1.3e-93
WP_158328240.1|978677_979361_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	86.3	6.7e-107
WP_158328241.1|979760_981056_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.8	1.6e-24
WP_113757683.1|981211_982096_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_158328242.1|982097_982700_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_158328243.1|983102_984386_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.9	3.4e-91
WP_158328244.1|984841_986455_+	malate synthase A	NA	NA	NA	NA	NA
WP_158326540.1|986479_987763_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_158328245.1|987991_988348_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_158326538.1|988344_988845_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_113757691.1|988810_989587_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	30.3	3.7e-16
WP_158326537.1|989941_990442_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_158328246.1|990451_991180_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_158326535.1|991837_993271_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_158328247.1|993439_995221_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	35.0	8.9e-50
WP_113757672.1|995257_995569_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_104067374.1|995607_996204_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_158328248.1|996466_997432_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1076239	1110207	5559705	head,integrase,terminase	Brevibacillus_phage(50.0%)	50	1068679:1068695	1093182:1093198
1068679:1068695	attL	GAGGGCATTTTTCCAAA	NA	NA	NA	NA
WP_158328271.1|1076239_1077397_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.9	5.0e-70
WP_158328272.1|1078329_1078842_+	accessory regulator AgrB	NA	S5M6B1	Brevibacillus_phage	76.7	2.9e-62
WP_158328273.1|1079764_1080148_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	58.0	6.0e-12
WP_158328274.1|1080283_1080523_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158328275.1|1080576_1080801_-	hypothetical protein	NA	S5M5P4	Brevibacillus_phage	100.0	9.8e-31
WP_158328276.1|1080829_1081066_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	94.9	3.4e-34
WP_158328277.1|1081209_1081419_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNP2	Brevibacillus_phage	92.8	2.2e-29
WP_158328278.1|1081430_1081661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018673273.1|1081794_1082043_+	helix-turn-helix domain-containing protein	NA	S5MNZ7	Brevibacillus_phage	100.0	3.1e-38
WP_158330132.1|1082065_1082263_+	hypothetical protein	NA	A0A0K2CNE5	Brevibacillus_phage	75.9	3.9e-15
WP_158328279.1|1082259_1082529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328280.1|1082752_1083121_+	replication terminator protein	NA	A0A1L2JY32	Aeribacillus_phage	67.2	2.7e-38
WP_158328281.1|1083146_1083854_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	64.7	2.6e-85
WP_158328282.1|1083945_1084197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328283.1|1084180_1084438_+	hypothetical protein	NA	S5MU07	Brevibacillus_phage	88.2	8.6e-39
WP_158328284.1|1084434_1084920_+	siphovirus Gp157 family protein	NA	S5M9S4	Brevibacillus_phage	87.6	2.5e-71
WP_158328285.1|1084930_1085536_+	hypothetical protein	NA	S5M650	Brevibacillus_phage	88.1	1.2e-91
WP_158328286.1|1085537_1085942_+	single-stranded DNA-binding protein	NA	S5MP28	Brevibacillus_phage	96.3	1.1e-67
WP_158328287.1|1085955_1086303_+	HNH endonuclease	NA	S5M5S6	Brevibacillus_phage	93.9	5.3e-60
WP_158328288.1|1086322_1087384_+	hypothetical protein	NA	A0A0K2CNU3	Brevibacillus_phage	92.1	2.3e-138
WP_158328289.1|1087268_1088072_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	99.1	1.1e-129
WP_158328290.1|1088064_1088334_+	hypothetical protein	NA	A0A0K2CP43	Brevibacillus_phage	93.3	4.4e-38
WP_158328291.1|1089084_1089294_+	hypothetical protein	NA	A0A0K2CNJ4	Brevibacillus_phage	93.8	5.5e-28
WP_158328292.1|1089262_1089628_+	hypothetical protein	NA	S5MAA0	Brevibacillus_phage	63.1	2.0e-33
WP_158330133.1|1090003_1091539_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	50.3	6.6e-126
WP_158328293.1|1092611_1093025_+	hypothetical protein	NA	A0A2I7RY34	Vibrio_phage	40.0	4.9e-12
WP_158328294.1|1093047_1093308_+	hypothetical protein	NA	A0A0K2CP15	Brevibacillus_phage	92.7	2.3e-15
1093182:1093198	attR	TTTGGAAAAATGCCCTC	NA	NA	NA	NA
WP_158328295.1|1093586_1093841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328296.1|1093824_1094049_+	hypothetical protein	NA	S5M663	Brevibacillus_phage	94.6	1.3e-38
WP_158328297.1|1094168_1094558_+	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	55.6	5.5e-29
WP_158328298.1|1094849_1095035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328299.1|1095177_1095480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328300.1|1095619_1096417_+	hypothetical protein	NA	A0MN73	Thermus_phage	27.9	1.3e-08
WP_158328301.1|1096452_1097052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328302.1|1097254_1098628_+	chromosome partitioning protein ParB	NA	A8ATN5	Listeria_phage	50.5	4.3e-121
WP_158328303.1|1098711_1098909_+	hypothetical protein	NA	D2IZZ6	Enterococcus_phage	53.4	1.9e-09
WP_158328304.1|1099083_1099317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328305.1|1099353_1100175_+|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	35.6	1.3e-35
WP_158328306.1|1100174_1101404_+|terminase	PBSX family phage terminase large subunit	terminase	D9ZNC6	Clostridium_phage	38.4	5.7e-72
WP_158328307.1|1101620_1103183_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	36.3	2.2e-76
WP_158328308.1|1103052_1103889_+|head	phage head morphogenesis protein	head	A0A2H4J8F5	uncultured_Caudovirales_phage	35.1	5.1e-24
WP_158328309.1|1103932_1105225_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.5	2.6e-35
WP_158328310.1|1105252_1105768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328311.1|1105788_1106805_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	35.4	1.6e-43
WP_158328312.1|1106818_1107085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330134.1|1107106_1107598_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_158328313.1|1107612_1108191_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	29.5	9.4e-09
WP_158328314.1|1108197_1108548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328315.1|1108548_1109088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328316.1|1109106_1110207_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	38.4	2.5e-58
>prophage 5
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1113249	1122653	5559705	holin	Salmonella_phage(28.57%)	12	NA	NA
WP_158328321.1|1113249_1113822_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	36.3	1.3e-15
WP_158328322.1|1113826_1114168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328323.1|1114490_1115138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328324.1|1115203_1116700_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	30.7	4.4e-34
WP_158328325.1|1116704_1117304_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	41.6	1.3e-32
WP_158328326.1|1117300_1117648_+	hypothetical protein	NA	L0ASL0	Klebsiella_phage	33.7	6.9e-07
WP_158328327.1|1117666_1118842_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	38.7	2.1e-60
WP_158328328.1|1118857_1119520_+	DUF2612 domain-containing protein	NA	A0A2I7RAN8	Vibrio_phage	29.8	3.9e-11
WP_158328329.1|1120378_1120897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328330.1|1120911_1121661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158325730.1|1121940_1122411_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_158325729.1|1122407_1122653_+	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	85.0	2.6e-29
>prophage 6
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1204340	1211743	5559705	integrase,tRNA	Brevibacillus_phage(50.0%)	11	1206193:1206207	1216868:1216882
WP_158328348.1|1204340_1205219_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	3.9e-14
WP_113758308.1|1205215_1206019_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_158328349.1|1206015_1206756_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1206193:1206207	attL	CAAACGTTTCACTTT	NA	NA	NA	NA
WP_113758310.1|1206950_1207388_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003333754.1|1207408_1207801_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_158328350.1|1207977_1208958_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.0	1.8e-36
WP_158330136.1|1209032_1209302_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	52.8	9.0e-15
WP_158328351.1|1209321_1209612_+	hypothetical protein	NA	S5M633	Brevibacillus_phage	60.0	2.1e-09
WP_158328352.1|1209913_1210477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328353.1|1210755_1211244_-	hypothetical protein	NA	A0A0K2CNW5	Brevibacillus_phage	71.9	3.2e-58
WP_158330137.1|1211611_1211743_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	A0A0K2FM00	Brevibacillus_phage	70.0	1.0e-08
1216868:1216882	attR	AAAGTGAAACGTTTG	NA	NA	NA	NA
>prophage 7
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1585366	1590151	5559705		Brevibacillus_phage(28.57%)	7	NA	NA
WP_158328495.1|1585366_1585645_+	hypothetical protein	NA	S5MUL0	Brevibacillus_phage	77.4	3.2e-15
WP_158328496.1|1586552_1587359_+	phage antirepressor protein	NA	A0A0A7RW33	Clostridium_phage	59.5	6.8e-82
WP_158325766.1|1587370_1587799_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	44.7	2.8e-10
WP_158328497.1|1587801_1588158_+	hypothetical protein	NA	A0A0K2CPB0	Brevibacillus_phage	59.1	6.3e-32
WP_158328498.1|1588618_1588966_+	site-specific DNA-methyltransferase	NA	A0A291LAN5	Bordetella_phage	52.8	1.2e-24
WP_158328499.1|1589061_1589475_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	55.1	6.6e-25
WP_158325768.1|1589968_1590151_+	hypothetical protein	NA	A0A218KCK2	Bacillus_phage	53.6	1.8e-11
>prophage 8
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1596502	1602664	5559705	portal,terminase	Brevibacillus_phage(71.43%)	9	NA	NA
WP_158328502.1|1596502_1596688_+	hypothetical protein	NA	S5MP19	Brevibacillus_phage	89.5	1.7e-20
WP_158328503.1|1597059_1597239_+	hypothetical protein	NA	A0A0K2CNW1	Brevibacillus_phage	56.0	2.5e-05
WP_158328504.1|1597271_1597523_+	hypothetical protein	NA	S5M665	Brevibacillus_phage	86.7	4.9e-31
WP_158328505.1|1597654_1598320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328506.1|1598508_1599114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328507.1|1599175_1599910_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	46.8	1.9e-43
WP_158328508.1|1599909_1601184_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.3	5.0e-156
WP_158328509.1|1601196_1601895_+|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	91.3	1.6e-116
WP_158328510.1|1602040_1602664_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	83.1	1.7e-96
>prophage 9
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1840810	1849683	5559705		Caulobacter_phage(42.86%)	10	NA	NA
WP_158328604.1|1840810_1841332_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	37.8	6.4e-17
WP_158328605.1|1841955_1842567_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.1	7.1e-23
WP_113756576.1|1842613_1843195_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.6	4.8e-29
WP_113756649.1|1843249_1843828_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.0	1.6e-29
WP_158328606.1|1843907_1845185_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_158330146.1|1845241_1846015_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	47.5	2.9e-45
WP_158328607.1|1846159_1846408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113756651.1|1846537_1846987_-	tellurite resistance TerB family protein	NA	A0A1Y0T181	Sinorhizobium_phage	30.1	3.6e-08
WP_158328608.1|1847117_1848266_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_158328609.1|1848210_1849683_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	26.5	3.6e-12
>prophage 10
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1965898	1973667	5559705		Brevibacillus_phage(50.0%)	9	NA	NA
WP_158328658.1|1965898_1968598_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	35.4	4.5e-53
WP_113758474.1|1968610_1969435_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.0	5.8e-20
WP_113758473.1|1969462_1970065_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_113758472.1|1970061_1970637_+	lytic transglycosylase domain-containing protein	NA	A0A0F7L447	uncultured_marine_virus	31.5	2.3e-07
WP_158328659.1|1970935_1971424_+	hypothetical protein	NA	S5M633	Brevibacillus_phage	49.1	1.3e-06
WP_158328660.1|1971510_1971699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328661.1|1971717_1972233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325895.1|1972403_1972535_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	A0A0K2FM00	Brevibacillus_phage	67.5	3.0e-08
WP_158328662.1|1972932_1973667_-	hypothetical protein	NA	A0A0K2FLD1	Brevibacillus_phage	79.8	5.2e-97
>prophage 11
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	1984894	1996111	5559705	tRNA,transposase	Apis_mellifera_filamentous_virus(33.33%)	8	NA	NA
WP_158328666.1|1984894_1986085_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	30.2	6.1e-47
WP_158328667.1|1986131_1987085_+	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_158330149.1|1987657_1988416_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	4.2e-25
WP_158328668.1|1988781_1990251_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.2	2.1e-20
WP_158328669.1|1990370_1991048_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	43.9	1.3e-41
WP_158328670.1|1991035_1991923_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.3	7.0e-64
WP_113757042.1|1992141_1992852_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_158328671.1|1993030_1996111_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	32.3	4.6e-155
>prophage 12
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	2221223	2288290	5559705	holin,protease,tRNA,transposase	Orpheovirus(28.57%)	48	NA	NA
WP_113757582.1|2221223_2222258_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.7	5.4e-31
WP_158328748.1|2222290_2224732_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_113757552.1|2224828_2225107_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_113757553.1|2225291_2225645_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_158328749.1|2225848_2228206_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	38.1	2.0e-12
WP_113757555.1|2228224_2228635_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_158328750.1|2228929_2230228_+	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	23.4	1.7e-13
WP_158327204.1|2230330_2231158_-	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_113757558.1|2231348_2232491_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158328751.1|2232699_2234208_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_158327207.1|2234344_2235178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113757561.1|2235164_2236811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113757583.1|2236831_2238085_-	ligase	NA	NA	NA	NA	NA
WP_113757562.1|2238243_2239770_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_158328752.1|2239888_2241265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327209.1|2241536_2241899_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_158327210.1|2241895_2242885_+	serine/threonine protein kinase	NA	A0A2I2L4T9	Orpheovirus	31.1	3.3e-14
WP_158328753.1|2242893_2244930_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_113757567.1|2245383_2247552_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_113757568.1|2247671_2248097_+|protease	membrane-associated protease 1	protease	NA	NA	NA	NA
WP_113757569.1|2248188_2248635_+	J domain-containing protein	NA	E3T4P7	Cafeteria_roenbergensis_virus	58.1	7.0e-12
WP_113757570.1|2248771_2249329_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_113757571.1|2249363_2249879_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_113757572.1|2249889_2250738_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_158328754.1|2252791_2254078_+	normocyte-binding protein	NA	NA	NA	NA	NA
WP_113757574.1|2254068_2254764_+	iron-dependent peroxidase	NA	NA	NA	NA	NA
WP_158328755.1|2254790_2257439_+	molecular chaperone	NA	NA	NA	NA	NA
WP_113757584.1|2257533_2258310_+	DNA and RNA helicase	NA	NA	NA	NA	NA
WP_113757576.1|2258379_2259033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113757577.1|2259029_2260454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113757578.1|2260489_2261764_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_158328756.1|2261735_2262293_+|protease	serine protease	protease	NA	NA	NA	NA
WP_158327217.1|2262280_2262709_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_158328757.1|2268737_2269562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328758.1|2269650_2270184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158325389.1|2270208_2270736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330152.1|2272016_2272913_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_158328759.1|2278251_2278812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328760.1|2279074_2279371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328761.1|2281243_2281819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328762.1|2281831_2282086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330153.1|2283179_2283488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328763.1|2283499_2283754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328764.1|2284052_2285396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328765.1|2285641_2286070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328766.1|2286075_2286516_+	rhs-associated protein	NA	NA	NA	NA	NA
WP_158328767.1|2286716_2287613_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.5	3.7e-113
WP_158328768.1|2287606_2288290_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	85.0	3.7e-105
>prophage 13
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	2549417	2602838	5559705	integrase,coat,tRNA,transposase	Bacillus_phage(18.75%)	50	2588141:2588156	2608560:2608575
WP_158328854.1|2549417_2551889_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	48.5	5.1e-213
WP_158328855.1|2552007_2552835_-	late competence protein ComER	NA	NA	NA	NA	NA
WP_158328856.1|2553064_2554606_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_158328857.1|2554802_2556335_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_113759112.1|2556334_2556667_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_158328858.1|2556921_2557710_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158328859.1|2557710_2559468_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.7	1.4e-52
WP_158328860.1|2559534_2560350_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_158328861.1|2560459_2562385_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	32.2	2.1e-36
WP_158328862.1|2562665_2563079_-	cell division protein DedD	NA	F8WPT6	Bacillus_phage	48.9	8.1e-31
WP_158328863.1|2563236_2565654_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	31.7	8.1e-30
WP_113759124.1|2565726_2566275_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158328864.1|2566271_2567537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158328865.1|2567960_2569004_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_158328866.1|2569195_2569291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113759131.1|2569351_2569627_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_158328867.1|2569871_2570975_+	GPR endopeptidase	NA	NA	NA	NA	NA
WP_158326052.1|2571114_2572305_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_113759136.1|2572313_2572619_+	DUF3679 domain-containing protein	NA	NA	NA	NA	NA
WP_113759138.1|2572876_2573848_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	9.8e-19
WP_113759140.1|2573869_2574835_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.2e-19
WP_158328868.1|2575024_2576665_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_113759143.1|2576781_2577786_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_113759145.1|2577801_2578701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_158326054.1|2578919_2580014_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_158326055.1|2580151_2580775_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_158328869.1|2580793_2581960_-	MFS transporter	NA	NA	NA	NA	NA
WP_113759152.1|2582114_2582873_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_158330159.1|2582838_2582892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113759733.1|2582956_2583841_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_158326057.1|2583837_2585184_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_158328870.1|2585180_2585969_-	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.1	2.3e-10
WP_113759738.1|2585986_2586949_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_158328871.1|2587327_2587996_-	VOC family protein	NA	NA	NA	NA	NA
2588141:2588156	attL	TTCTTGCTCAAATACT	NA	NA	NA	NA
WP_158328872.1|2588240_2590055_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	1.2e-20
WP_158330160.1|2590161_2590356_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	59.7	1.7e-15
WP_158328873.1|2590331_2590781_-	hypothetical protein	NA	A0A2I7SCV1	Paenibacillus_phage	45.8	2.9e-26
WP_113759748.1|2590840_2591053_-	helix-turn-helix transcriptional regulator	NA	S5MNP8	Brevibacillus_phage	95.7	2.9e-32
WP_158328874.1|2591230_2591485_+	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	90.5	1.0e-31
WP_158328875.1|2591810_2592128_+	YxeA family protein	NA	NA	NA	NA	NA
WP_113759754.1|2592593_2592866_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158328876.1|2592950_2593904_+	toxin ETX	NA	NA	NA	NA	NA
WP_158328877.1|2594593_2595283_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	3.8e-41
WP_158328878.1|2595418_2595715_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158328879.1|2595669_2596902_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_158324756.1|2597300_2597510_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7S8	Bacillus_phage	48.4	1.1e-07
WP_113759062.1|2599422_2600007_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	41.7	5.9e-19
WP_113759064.1|2600018_2600192_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158328880.1|2600954_2601476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113759066.1|2601728_2602838_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
2608560:2608575	attR	AGTATTTGAGCAAGAA	NA	NA	NA	NA
>prophage 14
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	2969047	2982937	5559705		uncultured_Caudovirales_phage(25.0%)	25	NA	NA
WP_113755785.1|2969047_2969830_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	29.8	1.7e-05
WP_158328999.1|2970126_2970561_+	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	38.5	2.0e-16
WP_158329000.1|2971042_2971441_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	60.2	9.5e-37
WP_158329001.1|2971675_2972491_+	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	31.0	1.6e-30
WP_158329002.1|2972507_2973152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329003.1|2973258_2973663_+	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	31.3	2.1e-07
WP_158329004.1|2973886_2974192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329005.1|2974257_2974737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329006.1|2974979_2975234_+	hypothetical protein	NA	S5MCC7	Brevibacillus_phage	95.2	2.7e-37
WP_158329007.1|2975367_2975673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329008.1|2975692_2976034_+	hypothetical protein	NA	A0A0K2CNQ9	Brevibacillus_phage	35.8	3.3e-06
WP_158329009.1|2976057_2976252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329010.1|2976604_2976862_+	hypothetical protein	NA	S5MNS7	Brevibacillus_phage	69.1	2.9e-26
WP_158329011.1|2976858_2977101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329012.1|2977097_2977409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329013.1|2977405_2977774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329014.1|2977932_2978145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329015.1|2978159_2978405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329016.1|2978405_2978792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329017.1|2978778_2979165_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.1	9.3e-13
WP_158329018.1|2979185_2979506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329019.1|2979522_2980287_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.4	5.4e-81
WP_158329020.1|2980283_2980469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329021.1|2980576_2981923_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	48.7	4.4e-118
WP_158329022.1|2981935_2982937_+	DNA primase	NA	A0A0N9S7Y2	Paenibacillus_phage	44.3	1.7e-66
>prophage 15
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	2986285	3008112	5559705		Paenibacillus_phage(61.11%)	24	NA	NA
WP_158329027.1|2986285_2986840_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	38.0	9.2e-22
WP_158329028.1|2987273_2987648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329029.1|2987667_2988432_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	57.7	1.1e-62
WP_158329030.1|2988450_2988846_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	43.9	4.9e-25
WP_158329031.1|2988794_2990231_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	36.9	1.2e-15
WP_158329032.1|2990249_2992427_+	DNA-directed DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	53.3	5.9e-205
WP_158329033.1|2992386_2992941_+	hypothetical protein	NA	A0A0E3M1E6	Bacillus_phage	46.6	1.8e-25
WP_158329034.1|2993003_2993927_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	50.4	3.2e-75
WP_158329035.1|2993926_2994526_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	51.3	3.2e-44
WP_158329036.1|2994723_2995248_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0N9ST03	Paenibacillus_phage	57.9	5.5e-16
WP_158330167.1|2995555_2995771_+	hypothetical protein	NA	A0A219YCH8	Aeromonas_phage	53.7	4.5e-09
WP_158329037.1|2995771_2996404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330168.1|2998397_2999003_+	HNH endonuclease	NA	A0A0X8WP43	Ralstonia_phage	46.3	9.4e-20
WP_158329038.1|3000318_3000618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158325797.1|3000614_3000851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329039.1|3000850_3001399_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A172PZW2	Pseudomonas_phage	40.7	1.3e-28
WP_158329040.1|3001398_3002199_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	63.4	4.7e-83
WP_158329041.1|3002391_3003384_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	35.4	2.4e-28
WP_158329042.1|3003376_3003934_+	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	47.7	1.1e-35
WP_158329043.1|3004207_3004582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329044.1|3004638_3006078_+	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	45.3	8.6e-112
WP_158329045.1|3006077_3007295_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	64.3	1.5e-141
WP_158329046.1|3007294_3007663_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_158329047.1|3007662_3008112_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	41.8	2.4e-20
>prophage 16
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3013579	3032955	5559705	portal,tail,holin,plate,terminase,capsid	uncultured_Caudovirales_phage(38.89%)	25	NA	NA
WP_158329054.1|3013579_3015283_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	51.4	9.1e-169
WP_158330170.1|3015356_3016856_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	53.5	1.6e-145
WP_158329055.1|3016848_3017784_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	46.1	1.4e-62
WP_158329056.1|3017843_3018536_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	36.9	8.9e-14
WP_158329057.1|3018597_3019716_+	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	26.9	1.4e-32
WP_158329058.1|3019727_3019946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329059.1|3019964_3020348_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	47.6	9.5e-26
WP_158329060.1|3020348_3020714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329061.1|3020726_3021206_+	HK97 gp10 family phage protein	NA	A0A0N9SJT1	Paenibacillus_phage	30.7	3.3e-07
WP_158329062.1|3021218_3021665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329063.1|3021679_3022717_+|tail	phage tail sheath protein	tail	A0A2H4J187	uncultured_Caudovirales_phage	50.4	6.4e-93
WP_158329064.1|3022731_3023178_+|portal	phage portal protein	portal	A0A2H4IZM9	uncultured_Caudovirales_phage	49.3	1.3e-34
WP_158329065.1|3023236_3023620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329066.1|3023773_3025696_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	44.9	5.8e-63
WP_158329067.1|3025948_3026611_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	46.4	2.5e-50
WP_158329068.1|3026607_3027672_+	hypothetical protein	NA	A0A2H4IZP4	uncultured_Caudovirales_phage	45.3	5.1e-69
WP_158329069.1|3027637_3028078_+	DUF2577 domain-containing protein	NA	A0A2H4IZR8	uncultured_Caudovirales_phage	36.2	9.3e-09
WP_158329070.1|3028067_3028481_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	41.4	4.2e-19
WP_158329071.1|3028483_3029539_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	41.4	6.4e-64
WP_158330171.1|3029538_3030195_+	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	31.5	1.1e-21
WP_158329072.1|3030187_3030568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329073.1|3030568_3031468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329074.1|3031477_3032389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329075.1|3032400_3032679_+	hypothetical protein	NA	S6C455	Thermus_phage	51.6	3.1e-18
WP_158329076.1|3032691_3032955_+|holin	holin	holin	D2J075	Enterococcus_phage	41.8	5.2e-07
>prophage 17
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3092776	3100813	5559705	transposase	Paenibacillus_phage(33.33%)	8	NA	NA
WP_113755927.1|3092776_3093736_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	33.0	8.2e-10
WP_113755832.1|3094065_3096117_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	3.8e-12
WP_113755833.1|3096327_3097497_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	26.6	3.3e-05
WP_113755928.1|3097633_3097984_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_113755834.1|3097986_3098427_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_158325278.1|3098437_3099193_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	58.5	3.6e-69
WP_113759943.1|3099260_3099938_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	43.9	1.7e-41
WP_158328922.1|3099925_3100813_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.3	4.1e-64
>prophage 18
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3157973	3207224	5559705	protease,portal,holin,capsid,transposase	Bacillus_phage(20.0%)	47	NA	NA
WP_113755872.1|3157973_3158564_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_113755873.1|3158586_3159369_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158329116.1|3159437_3160343_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_113755875.1|3160926_3161520_+	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_113755876.1|3161591_3162341_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_113755877.1|3162624_3163914_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_158329117.1|3163998_3164970_-	asparaginase	NA	NA	NA	NA	NA
WP_113755879.1|3165058_3165733_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_113755880.1|3166028_3166577_+	spore cortex-lytic protein	NA	A0A172JHR8	Bacillus_phage	39.7	1.7e-20
WP_158329118.1|3166607_3167984_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_113755882.1|3168097_3168781_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_113755883.1|3168814_3169000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158325251.1|3169120_3169771_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_113755885.1|3169785_3170379_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_113755886.1|3170557_3171739_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_158325250.1|3171915_3172572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755888.1|3172578_3173493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755889.1|3173489_3173672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755890.1|3173727_3175041_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_158325332.1|3175059_3175665_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_113755892.1|3175677_3176712_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_113755893.1|3176796_3177060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755894.1|3177193_3177766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113755895.1|3177891_3178080_+	DUF2768 family protein	NA	NA	NA	NA	NA
WP_113755896.1|3178091_3178391_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_158325249.1|3178405_3178750_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_158325248.1|3178760_3179477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755930.1|3179653_3181132_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_113755899.1|3181481_3181754_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	4.0e-26
WP_113755900.1|3182085_3182649_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.4	4.6e-45
WP_158325247.1|3182810_3183218_-	lectin	NA	NA	NA	NA	NA
WP_158329119.1|3184142_3185009_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_113755903.1|3186662_3187217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113755904.1|3188726_3189182_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	43.1	6.6e-18
WP_113755905.1|3189220_3189421_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113755908.1|3191530_3192622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325241.1|3194532_3195288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327910.1|3195648_3197100_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158325239.1|3198518_3198974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113757356.1|3200782_3201193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113757472.1|3201320_3202820_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	53.2	1.4e-144
WP_158329120.1|3202812_3203574_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	43.8	3.0e-47
WP_113757473.1|3205053_3205599_+	hypothetical protein	NA	H7BV10	unidentified_phage	42.8	4.8e-31
WP_113757359.1|3205595_3205796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113757360.1|3205795_3205933_+	XkdX family protein	NA	G3MAH0	Bacillus_virus	64.4	2.3e-11
WP_113757361.1|3205943_3206207_+|holin	holin	holin	D2J075	Enterococcus_phage	40.5	3.0e-07
WP_113757363.1|3206978_3207224_+	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	72.2	2.8e-23
>prophage 19
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3422598	3444423	5559705		Brevibacillus_phage(100.0%)	21	NA	NA
WP_158329188.1|3422598_3423600_-	replication initiation protein	NA	A0A0K2CNV5	Brevibacillus_phage	32.7	1.2e-16
WP_158329189.1|3423811_3424048_+	hypothetical protein	NA	A0A0K2CPH0	Brevibacillus_phage	53.8	1.4e-16
WP_158329190.1|3424272_3424533_+	hypothetical protein	NA	A0A0K2CNW3	Brevibacillus_phage	62.4	6.4e-26
WP_158329191.1|3424761_3425820_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	75.3	1.5e-145
WP_158326621.1|3425981_3426467_+	DNA polymerase III subunit gamma/tau	NA	A0A0K2CPC8	Brevibacillus_phage	69.6	3.7e-51
WP_158329192.1|3426777_3431388_+	hypothetical protein	NA	A0A0K2CPN3	Brevibacillus_phage	34.7	2.8e-220
WP_158326623.1|3431514_3432132_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	71.8	2.3e-85
WP_158329193.1|3432134_3433184_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	60.5	2.1e-131
WP_158329194.1|3433193_3436649_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0K2CNY2	Brevibacillus_phage	64.7	0.0e+00
WP_158326626.1|3436778_3437195_+	hypothetical protein	NA	A0A0K2CP80	Brevibacillus_phage	65.5	1.8e-46
WP_158326627.1|3437631_3437955_+	hypothetical protein	NA	A0A0K2CNZ6	Brevibacillus_phage	61.7	4.3e-11
WP_158329195.1|3437974_3438802_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CPP8	Brevibacillus_phage	53.0	6.5e-72
WP_158329196.1|3438798_3439098_+	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	53.2	3.7e-17
WP_158326630.1|3439603_3440137_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	56.8	2.9e-49
WP_158329197.1|3440602_3441025_+	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	55.4	3.6e-42
WP_158329199.1|3441203_3441551_+	hypothetical protein	NA	A0A0K2CPQ6	Brevibacillus_phage	52.9	7.5e-30
WP_158326632.1|3441614_3441947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158326633.1|3441993_3442281_+	hypothetical protein	NA	A0A0K2CP23	Brevibacillus_phage	47.3	6.0e-17
WP_158329200.1|3442277_3442523_+	hypothetical protein	NA	A0A0K2CNT1	Brevibacillus_phage	57.3	8.8e-17
WP_158329202.1|3442665_3443241_+	lytic transglycosylase domain-containing protein	NA	A0A0K2CNS6	Brevibacillus_phage	53.9	3.1e-36
WP_158326636.1|3443370_3444423_+	RNA polymerase subunit sigma	NA	A0A0K2CPD8	Brevibacillus_phage	63.7	2.6e-110
>prophage 20
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3511283	3528630	5559705		Brevibacillus_phage(80.0%)	11	NA	NA
WP_158329231.1|3511283_3512753_+	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	72.0	5.2e-205
WP_158329232.1|3512811_3514638_+	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	69.6	5.2e-263
WP_158329233.1|3514661_3518120_+	hypothetical protein	NA	A0A0K2CP84	Brevibacillus_phage	24.5	4.9e-36
WP_158329234.1|3518120_3519212_+	cell adhesion protein	NA	A0A0K2CPP1	Brevibacillus_phage	59.7	2.4e-130
WP_158329235.1|3519226_3520063_+	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	54.7	2.5e-79
WP_158327018.1|3520264_3520765_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	63.9	1.9e-50
WP_158327017.1|3520800_3521409_+	hypothetical protein	NA	A0A0K2CP89	Brevibacillus_phage	48.0	3.5e-46
WP_158329236.1|3521423_3523592_+	hypothetical protein	NA	A0A127AW50	Bacillus_phage	25.8	3.8e-55
WP_158329237.1|3523652_3525281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329238.1|3525433_3526288_+	hypothetical protein	NA	A0A127AW61	Bacillus_phage	39.4	1.8e-53
WP_158329239.1|3526302_3528630_+	hypothetical protein	NA	A0A0K2CPK6	Brevibacillus_phage	40.1	1.3e-106
>prophage 21
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	3532229	3585712	5559705	bacteriocin,protease,transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_158327968.1|3532229_3533681_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158329241.1|3534127_3537409_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_158329242.1|3537708_3538035_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158329243.1|3538038_3538773_+	VanZ family protein	NA	NA	NA	NA	NA
WP_113758218.1|3538801_3541111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758256.1|3541236_3541722_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_113758217.1|3541919_3542339_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113758255.1|3542619_3542910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329244.1|3543640_3544525_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.7	1.4e-11
WP_158329245.1|3544642_3545629_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_158329246.1|3545612_3546800_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_158327006.1|3547452_3548112_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158329247.1|3548361_3548529_+|bacteriocin	laterosporulin family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_158329248.1|3548620_3549106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329249.1|3549108_3550959_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.6	1.5e-15
WP_158329250.1|3550963_3551398_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_158329251.1|3551472_3551931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758209.1|3551924_3552341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329252.1|3552367_3552754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329253.1|3553147_3554050_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_113758206.1|3554628_3555267_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_113758205.1|3555988_3556594_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158330185.1|3557239_3558574_+	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_158329254.1|3558624_3559410_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_158326999.1|3559616_3560000_+	VOC family protein	NA	NA	NA	NA	NA
WP_158329255.1|3560523_3561762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113758199.1|3562290_3563445_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	40.1	7.0e-56
WP_158329256.1|3563460_3564144_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.7	1.9e-37
WP_158329257.1|3564171_3565368_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.6	2.1e-103
WP_113758196.1|3565387_3565861_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.6	3.2e-39
WP_158329258.1|3566710_3567568_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_158329259.1|3568945_3569737_-	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_158329260.1|3569778_3570207_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	60.6	7.6e-40
WP_158329261.1|3571657_3572140_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017153334.1|3572151_3572367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158329262.1|3572415_3573663_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_158329263.1|3574213_3574537_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	48.4	3.3e-11
WP_158329264.1|3574669_3575656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329265.1|3577090_3579055_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_158329266.1|3579044_3579710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329267.1|3579935_3581420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158328669.1|3581662_3582340_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	43.9	1.3e-41
WP_158329268.1|3582344_3583208_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.8	3.6e-65
WP_158329269.1|3583608_3584112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329270.1|3584381_3585149_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158329271.1|3585331_3585712_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4129346	4147482	5559705	integrase,transposase	Clostridium_phage(25.0%)	19	4122826:4122840	4159824:4159838
4122826:4122840	attL	TACCATTTGCAAAAA	NA	NA	NA	NA
WP_158328238.1|4129346_4130690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158329462.1|4131133_4132273_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	27.9	2.0e-10
WP_158330192.1|4132298_4134383_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158329463.1|4134375_4134756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158329464.1|4135441_4135837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329465.1|4136104_4136884_+	alpha/beta hydrolase	NA	A0A076YKN0	Mycobacterium_phage	23.9	9.7e-09
WP_158329466.1|4137111_4137624_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	52.6	1.0e-35
WP_158329467.1|4137732_4138017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329468.1|4138013_4138301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329469.1|4138383_4138881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329470.1|4138971_4142808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329471.1|4142820_4143375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329472.1|4143586_4144090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329473.1|4144166_4144514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329474.1|4144759_4145803_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158329475.1|4145956_4146535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329476.1|4146538_4147102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330193.1|4147213_4147339_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	A0A0K2FM00	Brevibacillus_phage	69.4	7.1e-07
WP_158329477.1|4147320_4147482_-|transposase	transposase	transposase	NA	NA	NA	NA
4159824:4159838	attR	TTTTTGCAAATGGTA	NA	NA	NA	NA
>prophage 23
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4399875	4407998	5559705		Bacillus_phage(71.43%)	10	NA	NA
WP_158329576.1|4399875_4400658_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	47.5	8.3e-69
WP_158329577.1|4400740_4401247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329578.1|4401268_4401565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329579.1|4401600_4401999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329580.1|4402017_4403343_-	hypothetical protein	NA	A0A219UQN1	Bacillus_phage	34.0	3.7e-69
WP_158329581.1|4403385_4403688_-	hypothetical protein	NA	A0A219YCD6	Aeromonas_phage	39.5	5.6e-05
WP_158329582.1|4403940_4404555_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	46.4	2.3e-50
WP_158329583.1|4404567_4405539_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	75.9	3.9e-140
WP_158329584.1|4405552_4407652_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	75.1	0.0e+00
WP_158330201.1|4407611_4407998_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	54.9	9.0e-32
>prophage 24
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4424020	4432369	5559705		Clostridium_botulinum_C_phage(50.0%)	7	NA	NA
WP_158329614.1|4424020_4424269_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	34.7	8.1e-10
WP_158329615.1|4424619_4425015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329616.1|4425080_4425293_+	hypothetical protein	NA	S5MCE7	Brevibacillus_phage	91.4	4.9e-32
WP_158329617.1|4425631_4428751_-	DNA polymerase III subunit alpha	NA	A0A218KC91	Bacillus_phage	53.3	0.0e+00
WP_158329618.1|4428755_4429859_-	PD-(D/E)XK nuclease family protein	NA	Q332G6	Clostridium_botulinum_C_phage	38.0	5.9e-60
WP_158329619.1|4429872_4430883_-	DNA primase	NA	Q332G7	Clostridium_botulinum_C_phage	39.9	5.6e-57
WP_158329620.1|4430902_4432369_-	helicase	NA	Q332G8	Clostridium_botulinum_C_phage	40.5	6.5e-91
>prophage 25
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4441560	4452798	5559705	tRNA	Bacillus_phage(55.56%)	17	NA	NA
WP_158329635.1|4441560_4442235_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	56.3	2.7e-68
WP_158329636.1|4442259_4443198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329637.1|4443235_4443589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329638.1|4443588_4444017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329639.1|4444035_4444944_-	hypothetical protein	NA	U5J9W3	Bacillus_phage	63.0	6.7e-102
WP_158329640.1|4445038_4445662_-	hypothetical protein	NA	A0A2H4JAD2	uncultured_Caudovirales_phage	54.1	8.1e-59
WP_158329641.1|4445721_4445937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329642.1|4445973_4446651_-	hypothetical protein	NA	A0A0Y0AEU3	Bacillus_phage	49.6	9.9e-34
WP_158329643.1|4447031_4447598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119732745.1|4447625_4448015_-	hypothetical protein	NA	A0A219UQN9	Bacillus_phage	42.3	4.2e-05
WP_158329644.1|4448019_4449204_-	hypothetical protein	NA	A0A223LHF0	Pseudoalteromonas_phage	33.6	8.8e-46
WP_158329645.1|4449221_4450544_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	9.1e-92
WP_158329646.1|4450540_4451266_-	hypothetical protein	NA	G3M9V9	Bacillus_virus	47.0	1.1e-54
WP_158329647.1|4451300_4451501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329648.1|4451513_4451855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329649.1|4451930_4452146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329650.1|4452171_4452798_-	hypothetical protein	NA	A0A1D6X8E4	Bacillus_phage	53.0	1.2e-54
>prophage 26
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4464952	4475382	5559705		Brevibacillus_phage(37.5%)	14	NA	NA
WP_158329667.1|4464952_4465618_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	56.5	2.0e-39
WP_158329668.1|4465966_4466167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329669.1|4466328_4466763_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	34.4	8.6e-07
WP_158329670.1|4466918_4468058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329671.1|4468054_4468342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329672.1|4468421_4469564_-	hypothetical protein	NA	A0A0H3UZ18	Geobacillus_virus	30.9	1.2e-28
WP_158329673.1|4469662_4469968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329674.1|4470145_4470466_+	helix-turn-helix transcriptional regulator	NA	M4QZA2	Sulfitobacter_phage	34.3	3.1e-06
WP_158329675.1|4470583_4470853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329676.1|4471061_4471439_-	LytTR family transcriptional regulator	NA	S5MA89	Brevibacillus_phage	39.3	1.0e-11
WP_158329677.1|4471567_4472095_-	accessory regulator AgrB	NA	S5MBZ7	Brevibacillus_phage	38.8	8.2e-20
WP_158329678.1|4472088_4472763_-	hypothetical protein	NA	S5MP56	Brevibacillus_phage	39.6	8.3e-33
WP_158329679.1|4473056_4474490_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_158329680.1|4474587_4475382_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	27.1	5.4e-15
>prophage 27
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4488741	4541605	5559705	transposase,integrase,tail	Bacillus_phage(48.57%)	51	4488130:4488148	4536462:4536480
4488130:4488148	attL	GCTCCTCTTCAGTTAAAAA	NA	NA	NA	NA
WP_158329699.1|4488741_4489980_-	hypothetical protein	NA	O64082	Bacillus_phage	53.7	2.8e-127
WP_158329700.1|4490185_4490647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329701.1|4491465_4492521_-|integrase	site-specific integrase	integrase	V9VFB5	Lactococcus_phage	33.9	8.4e-40
WP_158329702.1|4492649_4494206_+	hypothetical protein	NA	A0A0H3UZ39	Geobacillus_virus	27.3	6.0e-26
WP_158329703.1|4494299_4494620_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	51.9	6.7e-17
WP_158329704.1|4494876_4495092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329705.1|4495103_4496315_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	47.9	3.5e-106
WP_158329706.1|4496420_4497032_+	hypothetical protein	NA	G3MAX5	Bacillus_virus	50.5	1.4e-18
WP_158329707.1|4497291_4498215_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	45.4	8.6e-65
WP_158329708.1|4498214_4499999_+	hypothetical protein	NA	O64069	Bacillus_phage	68.8	1.4e-241
WP_158329709.1|4500010_4501534_+	DUF1073 domain-containing protein	NA	O64068	Bacillus_phage	51.6	1.1e-144
WP_158329710.1|4501552_4503004_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	45.0	9.3e-106
WP_158329711.1|4503035_4503569_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	57.6	4.5e-50
WP_158329712.1|4503598_4504597_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	59.3	1.2e-109
WP_158329713.1|4504649_4505129_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	45.9	5.3e-26
WP_158329714.1|4505141_4505543_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	48.5	1.6e-31
WP_158329715.1|4505539_4505770_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	48.5	1.7e-09
WP_158329716.1|4505747_4506917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329717.1|4506925_4507423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119732678.1|4507419_4508157_+	hypothetical protein	NA	A0A218KCC3	Bacillus_phage	23.5	2.4e-09
WP_119732677.1|4508177_4508942_+	hypothetical protein	NA	A0A0K2FL50	Brevibacillus_phage	31.6	3.3e-30
WP_104030232.1|4508960_4509233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329718.1|4509236_4509617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329719.1|4509656_4510100_+	DUF1617 family protein	NA	A0A0K2FLF1	Brevibacillus_phage	39.9	1.2e-19
WP_158329720.1|4510127_4510619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329721.1|4510593_4511010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329722.1|4511024_4512038_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1G5SC03	Enterococcus_phage	41.1	1.1e-60
WP_158329723.1|4512213_4518399_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	26.6	6.6e-84
WP_158329724.1|4518395_4519013_+|tail	phage tail protein	tail	A0A0K2FMB9	Brevibacillus_phage	49.5	4.4e-49
WP_158329725.1|4518987_4520310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329726.1|4520322_4520964_+	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	37.3	2.2e-11
WP_158329727.1|4520991_4524828_+	hypothetical protein	NA	A0A0K2FLF6	Brevibacillus_phage	32.6	1.6e-189
WP_158329728.1|4524907_4525759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329729.1|4525795_4526242_+	hypothetical protein	NA	A0A0K2FL59	Brevibacillus_phage	51.0	2.8e-37
WP_158329730.1|4526259_4527462_+	hypothetical protein	NA	Q332A8	Clostridium_botulinum_C_phage	38.7	9.6e-32
WP_158329731.1|4527486_4527960_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	46.2	2.3e-29
WP_158329732.1|4528047_4528647_+	hypothetical protein	NA	G3MAA3	Bacillus_virus	36.4	2.5e-28
WP_158329733.1|4528647_4529310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329734.1|4529321_4531478_+	hypothetical protein	NA	A0A127AW61	Bacillus_phage	26.0	2.5e-38
WP_158329735.1|4531509_4532964_+	DNRLRE domain-containing protein	NA	A0A127AWB0	Bacillus_phage	27.2	1.1e-18
WP_158329736.1|4533224_4533857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329737.1|4534013_4534811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329738.1|4534903_4535128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329739.1|4535144_4535321_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	A0A0K2FM00	Brevibacillus_phage	77.2	2.6e-15
WP_158329740.1|4535757_4537041_-	helix-turn-helix transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	46.4	1.1e-99
4536462:4536480	attR	GCTCCTCTTCAGTTAAAAA	NA	NA	NA	NA
WP_158329741.1|4537298_4537685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329742.1|4537701_4538478_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	29.1	1.8e-15
WP_158329743.1|4538509_4538824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329744.1|4539205_4539919_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	40.2	5.2e-17
WP_158328767.1|4540031_4540928_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	84.5	3.7e-113
WP_158328768.1|4540921_4541605_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	85.0	3.7e-105
>prophage 28
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	4589775	4621514	5559705	holin,integrase,transposase	Brevibacillus_phage(50.0%)	33	4579221:4579235	4591452:4591466
4579221:4579235	attL	TAAAGGTTTTTTATC	NA	NA	NA	NA
WP_158329761.1|4589775_4590135_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158329762.1|4590095_4590506_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	56.6	9.8e-29
WP_113755933.1|4590599_4592576_-	hypothetical protein	NA	NA	NA	NA	NA
4591452:4591466	attR	TAAAGGTTTTTTATC	NA	NA	NA	NA
WP_158329763.1|4593526_4594945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113755935.1|4595280_4595457_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_113755936.1|4595519_4596131_+	serine hydrolase	NA	NA	NA	NA	NA
WP_113755938.1|4596391_4596715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329764.1|4597281_4597788_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_158329765.1|4599143_4599527_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158325536.1|4599523_4600390_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.6e-20
WP_158329766.1|4600379_4601036_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_158329767.1|4601306_4601492_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	88.2	1.7e-17
WP_158329768.1|4601675_4601909_-	hypothetical protein	NA	S5MNL1	Brevibacillus_phage	59.3	5.2e-11
WP_113755944.1|4602407_4603220_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_158329769.1|4603552_4604005_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_158329770.1|4604534_4607294_+	NTTRR-F1 domain	NA	NA	NA	NA	NA
WP_158329771.1|4607587_4608826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329772.1|4610099_4610375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330210.1|4610699_4611077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330211.1|4611613_4612945_-	magnesium transporter	NA	NA	NA	NA	NA
WP_158327273.1|4613689_4613845_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_158329773.1|4613847_4614102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329774.1|4614308_4615433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329775.1|4615699_4615921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329776.1|4615998_4616196_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158329777.1|4616462_4617149_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	4.5e-34
WP_158329778.1|4617150_4617384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329779.1|4617349_4617634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158329780.1|4618256_4618583_+	hypothetical protein	NA	A0A0K2CNX3	Brevibacillus_phage	84.2	2.6e-40
WP_158329781.1|4618539_4618749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158329782.1|4620192_4620366_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_158329783.1|4620734_4620824_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_158329784.1|4621424_4621514_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 29
NZ_CP033464	Brevibacillus laterosporus strain 1821L chromosome, complete genome	5559705	5332148	5426261	5559705	bacteriocin,holin,integrase,terminase,transposase	Brevibacillus_phage(30.3%)	79	5327231:5327247	5424813:5425156
5327231:5327247	attL	CCCCTGTCAAGTAGACA	NA	NA	NA	NA
WP_158330031.1|5332148_5332694_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.1	5.7e-24
5327231:5327247	attL	CCCCTGTCAAGTAGACA	NA	NA	NA	NA
WP_158330032.1|5332716_5332908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758845.1|5335898_5336141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330033.1|5337077_5337884_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	40.9	2.9e-48
WP_158330034.1|5338285_5339059_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158330035.1|5339377_5339590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330036.1|5340962_5341301_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	93.7	2.0e-56
WP_158330037.1|5342205_5342733_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	67.8	3.5e-55
WP_113758848.1|5342943_5343108_+	tryptophan RNA-binding attenuation protein	NA	NA	NA	NA	NA
WP_158330038.1|5344014_5344374_-	HNH endonuclease	NA	A0A1X9I6D0	Streptococcus_phage	44.0	2.1e-22
WP_113758840.1|5344434_5345325_-	cation transporter	NA	NA	NA	NA	NA
WP_158330039.1|5345891_5346335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330040.1|5346785_5346911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330041.1|5346914_5347325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158330226.1|5347363_5347663_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	41.6	3.3e-10
WP_158330227.1|5347634_5347832_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	63.9	1.0e-15
WP_158327608.1|5348220_5348385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158330042.1|5348500_5349280_+	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.6	1.5e-09
WP_158330043.1|5351312_5351843_-	hypothetical protein	NA	S5MBW0	Brevibacillus_phage	90.3	8.7e-86
5349609:5349625	attR	TGTCTACTTGACAGGGG	NA	NA	NA	NA
WP_158330044.1|5352313_5352598_-	hypothetical protein	NA	S5MU57	Brevibacillus_phage	65.0	5.0e-24
5349609:5349625	attR	TGTCTACTTGACAGGGG	NA	NA	NA	NA
WP_104033704.1|5352967_5353210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325736.1|5353975_5355556_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_158330045.1|5355578_5357522_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_158330046.1|5357518_5359456_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_094702427.1|5359635_5359887_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_158330047.1|5361197_5361935_-|integrase	tyrosine-type recombinase/integrase	integrase	O34032	Streptococcus_phage	23.9	1.4e-09
WP_158325739.1|5361941_5362184_-	hypothetical protein	NA	S5MU57	Brevibacillus_phage	78.6	5.4e-11
WP_113758831.1|5362155_5362515_-	hypothetical protein	NA	S5MNV6	Brevibacillus_phage	69.7	7.8e-38
WP_158330048.1|5366524_5366926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330049.1|5367186_5367375_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	72.4	3.0e-17
WP_158330050.1|5367397_5367712_-	hypothetical protein	NA	S5MA26	Brevibacillus_phage	51.0	4.3e-24
WP_113758825.1|5368089_5368239_-|holin	putative holin-like toxin	holin	A0A0K2CP53	Brevibacillus_phage	96.3	2.7e-05
WP_158330051.1|5368290_5368728_-	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	78.5	1.1e-59
WP_158330052.1|5370231_5371158_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158330053.1|5371272_5372046_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	43.5	1.4e-44
WP_158330054.1|5372374_5372575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330055.1|5372611_5372866_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_113758815.1|5373200_5373542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758814.1|5373809_5374151_-	YolD-like family protein	NA	A0A0K2CNE7	Brevibacillus_phage	91.8	5.1e-55
WP_158330056.1|5374287_5374992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113757952.1|5375095_5375197_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	78.8	2.0e-07
WP_158327969.1|5375348_5376707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158330057.1|5376781_5377126_-|transposase	transposase family protein	transposase	A0A0C5AEA5	Paenibacillus_phage	86.8	2.4e-52
WP_158330058.1|5377232_5377916_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	85.9	3.3e-106
WP_113758588.1|5378124_5378319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758589.1|5378415_5379078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758591.1|5380171_5381041_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	49.1	3.5e-68
WP_158330059.1|5382307_5384308_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	4.0e-14
WP_158327594.1|5384933_5386043_-	YdcF family protein	NA	NA	NA	NA	NA
WP_158330060.1|5386371_5388039_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158330061.1|5388316_5388562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758596.1|5388800_5389403_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	48.6	8.5e-37
WP_158327596.1|5389656_5390385_+	esterase family protein	NA	NA	NA	NA	NA
WP_113758598.1|5390730_5391237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758599.1|5391366_5391810_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113758600.1|5391894_5392743_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_113758601.1|5392955_5393321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113758602.1|5394573_5395950_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_158330062.1|5396010_5398407_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.1	2.3e-85
WP_113758604.1|5398571_5399345_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_113758605.1|5399438_5400161_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_158327599.1|5400482_5401118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327600.1|5401257_5401833_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_113758608.1|5401898_5402624_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	37.1	3.3e-27
WP_158330063.1|5402960_5403464_+	ADP-heptose synthase	NA	NA	NA	NA	NA
WP_158330064.1|5403747_5411382_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.7	5.3e-75
WP_113758611.1|5412154_5412643_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_113758612.1|5412894_5413575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758613.1|5413704_5414292_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_158330065.1|5414369_5414858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158330066.1|5415326_5416331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113758616.1|5416334_5417132_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	32.1	2.3e-26
WP_113758617.1|5417910_5419044_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	42.5	4.9e-46
WP_113758618.1|5419105_5420446_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_113758619.1|5420594_5422286_+	DEAD/DEAH box helicase family protein	NA	B2CRJ8	Acidianus_filamentous_virus	23.5	2.0e-14
WP_113758620.1|5422524_5423094_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158330067.1|5423074_5424556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327989.1|5424687_5425617_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	83.7	3.3e-112
WP_158330068.1|5425577_5426261_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	86.3	5.2e-107
>prophage 1
NZ_CP033461	Brevibacillus laterosporus strain 1821L plasmid p1821L01, complete sequence	130971	30904	84905	130971	integrase,protease,transposase	Bacillus_phage(41.67%)	53	56903:56921	92770:92788
WP_158327697.1|30904_31474_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_158327698.1|31881_32637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327699.1|33254_33473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327700.1|34377_34746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327782.1|34908_35295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327783.1|35579_35855_+	hypothetical protein	NA	A0A222YWP5	Escherichia_phage	47.7	1.4e-07
WP_158327701.1|35937_36576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327702.1|37231_37654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327703.1|37878_38277_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	64.4	6.2e-44
WP_158327704.1|38281_39337_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	28.7	3.9e-13
WP_158327705.1|39600_39978_-	Replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	40.2	3.1e-13
WP_158327706.1|40484_41777_+	helix-turn-helix domain-containing protein	NA	A0A0K2FLD1	Brevibacillus_phage	46.2	7.3e-102
WP_158327707.1|42270_42924_+	M23 family metallopeptidase	NA	A7KUS1	Bacillus_phage	32.9	2.4e-08
WP_158327708.1|42983_43919_+	DUF5050 domain-containing protein	NA	NA	NA	NA	NA
WP_158327784.1|44182_44449_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_158327709.1|44522_44741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327710.1|46449_46674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327711.1|46777_47587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327712.1|47737_48808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327713.1|49368_49665_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158327714.1|49646_50528_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	7.0e-48
WP_158327715.1|50881_51160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327716.1|51855_52719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327717.1|52921_53251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327718.1|53262_53751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327719.1|53713_54511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327720.1|54580_55648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327721.1|55648_56476_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
56903:56921	attL	CAAGATAATAAATATCATT	NA	NA	NA	NA
WP_158327722.1|57019_57430_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_158327723.1|58081_58990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327724.1|59031_59334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327725.1|59371_60484_+	AAA domain-containing protein	NA	A7KV75	Bacillus_phage	34.7	7.7e-52
WP_158327726.1|60496_61963_+	VWA domain-containing protein	NA	A7KV72	Bacillus_phage	23.6	1.2e-31
WP_158327727.1|62036_62456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327728.1|62610_63774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327729.1|63978_64164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327730.1|64707_65022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327731.1|66151_66667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327732.1|66967_67165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327733.1|67430_67664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327734.1|68317_69145_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	6.2e-46
WP_113758843.1|69180_69477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158327735.1|69768_70011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327785.1|71952_72027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327736.1|72633_73416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327737.1|73440_73722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327738.1|74213_74747_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_158327786.1|75099_76800_+	pesticidal protein	NA	NA	NA	NA	NA
WP_158327787.1|77897_79592_+	pesticidal protein	NA	NA	NA	NA	NA
WP_158327739.1|80738_82085_-	MmcB family DNA repair protein	NA	A0A1C3NFG6	Phage_NCTB	34.5	1.8e-07
WP_158327740.1|82179_82440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327741.1|82439_82697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327742.1|83762_84905_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.4	2.0e-10
92770:92788	attR	CAAGATAATAAATATCATT	NA	NA	NA	NA
>prophage 1
NZ_CP033462	Brevibacillus laterosporus strain 1821L plasmid p1821L02, complete sequence	60496	0	60319	60496	tail,integrase,holin,terminase,head,plate	Brevibacillus_phage(66.0%)	82	22100:22114	54650:54664
WP_119734518.1|267_621_+	helix-turn-helix transcriptional regulator	NA	S5MAC0	Brevibacillus_phage	39.5	1.1e-09
WP_158327789.1|1087_2557_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158327790.1|2958_3324_-	LytTR family transcriptional regulator	NA	S5MA89	Brevibacillus_phage	63.1	7.1e-39
WP_158327791.1|3461_3977_-	accessory regulator AgrB	NA	S5MUJ9	Brevibacillus_phage	59.1	1.2e-42
WP_158327792.1|3976_4420_-	hypothetical protein	NA	S5M638	Brevibacillus_phage	54.1	2.8e-37
WP_158327793.1|4828_5407_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	37.3	2.2e-13
WP_158327794.1|5708_5816_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_158327851.1|5954_6698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327795.1|6785_7001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327796.1|7556_8660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327797.1|8978_9254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327798.1|9429_10050_-	hypothetical protein	NA	B3RH37	Bacillus_virus	38.1	5.1e-29
WP_158327799.1|10624_11494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158324600.1|11893_12280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327800.1|12276_13632_+	cell division GTPase	NA	Q331T7	Clostridium_botulinum_C_phage	25.5	1.3e-05
WP_158327801.1|13649_14516_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_158327802.1|14550_14817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327803.1|14907_15123_-	YolD-like family protein	NA	A0A0K2CNE7	Brevibacillus_phage	89.7	3.8e-32
WP_158327804.1|15138_15732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327805.1|15855_16221_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_158327806.1|16293_16977_-	site-specific DNA-methyltransferase	NA	S5MBX9	Brevibacillus_phage	94.7	3.4e-127
WP_158327807.1|17060_17684_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	92.8	1.0e-109
WP_158325729.1|17680_17926_-	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	85.0	2.6e-29
WP_158325730.1|17922_18393_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_158327808.1|18642_18861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158325732.1|18860_20321_-	hypothetical protein	NA	G3MAG7	Bacillus_virus	33.4	4.6e-36
WP_158327809.1|20334_20955_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_158325733.1|20947_21247_-	hypothetical protein	NA	S5M5T9	Brevibacillus_phage	36.0	7.0e-08
WP_158327810.1|21240_21819_-	DUF2313 domain-containing protein	NA	S5MNM6	Brevibacillus_phage	69.7	9.5e-70
WP_158327811.1|21828_22950_-|plate	baseplate J family protein	plate	S5MBX0	Brevibacillus_phage	83.6	1.4e-181
22100:22114	attL	AGAGTAACGTTGATT	NA	NA	NA	NA
WP_158327812.1|22965_23364_-	DUF2634 domain-containing protein	NA	S5M9X2	Brevibacillus_phage	77.3	3.1e-51
WP_158327813.1|23360_23714_-	hypothetical protein	NA	S5MU69	Brevibacillus_phage	86.1	4.5e-54
WP_158327814.1|23710_24853_-	hypothetical protein	NA	S5M5T7	Brevibacillus_phage	92.4	4.9e-211
WP_158324614.1|24845_25442_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MNM1	Brevibacillus_phage	91.4	1.3e-101
WP_158324662.1|25441_28336_-|tail	phage tail tape measure protein	tail	S5MBW5	Brevibacillus_phage	46.2	6.4e-223
WP_158324615.1|28651_28999_-	hypothetical protein	NA	S5MU64	Brevibacillus_phage	74.8	3.3e-41
WP_158324616.1|29011_29446_-	hypothetical protein	NA	S5M5T1	Brevibacillus_phage	77.1	1.3e-58
WP_158327815.1|29445_30975_-|tail	phage tail protein	tail	S5MNL6	Brevibacillus_phage	88.0	6.5e-267
WP_158327816.1|30986_31517_-	hypothetical protein	NA	S5MBW0	Brevibacillus_phage	91.4	1.1e-88
WP_158327817.1|31513_32077_-	hypothetical protein	NA	S5MC52	Brevibacillus_phage	82.2	4.3e-83
WP_158327818.1|32076_32481_-	hypothetical protein	NA	S5M9W2	Brevibacillus_phage	87.2	1.7e-57
WP_158327819.1|32480_33008_-	hypothetical protein	NA	S5MU57	Brevibacillus_phage	94.3	7.3e-93
WP_158327820.1|32991_33339_-	hypothetical protein	NA	S5MNV6	Brevibacillus_phage	78.9	1.2e-43
WP_158327852.1|33351_36258_-	hypothetical protein	NA	S5M5S9	Brevibacillus_phage	80.1	0.0e+00
WP_158327821.1|36370_38542_-|head	phage head morphogenesis protein	head	S5MNL1	Brevibacillus_phage	74.4	1.8e-294
WP_158324624.1|38559_40251_-	DNA packaging protein	NA	A0A1B1IT91	uncultured_Mediterranean_phage	30.2	1.0e-50
WP_158324625.1|40243_40801_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_158324626.1|40859_41432_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	43.9	6.4e-34
WP_158324627.1|42083_42293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327853.1|42831_43176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327822.1|43391_44042_-	hypothetical protein	NA	A0A1B0WKV8	Flavobacterium_phage	40.3	2.0e-15
WP_158327823.1|44358_44553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327854.1|45385_45826_-	transcriptional regulator	NA	S6AVV9	Thermus_phage	41.1	3.3e-22
WP_158327824.1|46599_46959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327825.1|46971_47301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327826.1|47312_47576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327827.1|47544_47931_-	hypothetical protein	NA	S5M5Z8	Brevibacillus_phage	76.3	1.2e-41
WP_158327828.1|47971_48220_-	hypothetical protein	NA	A0A1I9S5V1	Bacillus_phage	37.8	8.6e-12
WP_158327829.1|48254_48590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327830.1|48576_48966_-	hypothetical protein	NA	A0A0K2CNQ9	Brevibacillus_phage	32.0	1.9e-05
WP_158327831.1|48962_49421_-	hypothetical protein	NA	A0A0A7RUP7	Clostridium_phage	36.2	2.5e-12
WP_158327832.1|49474_49960_-	adenine methyltransferase	NA	S5MUL8	Brevibacillus_phage	64.1	3.6e-62
WP_158327833.1|50119_50647_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.7	7.2e-40
WP_158327834.1|50649_50838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327835.1|50834_51068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327836.1|51100_51766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158324637.1|51786_52314_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4J564	uncultured_Caudovirales_phage	45.1	3.3e-29
WP_158327837.1|52276_52516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327838.1|52861_54196_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.8	1.9e-105
WP_158327839.1|54188_55040_-	AAA family ATPase	NA	NA	NA	NA	NA
54650:54664	attR	AGAGTAACGTTGATT	NA	NA	NA	NA
WP_158327840.1|54981_55806_-	replication protein	NA	V9QKF6	Oenococcus_phage	38.2	1.0e-40
WP_158327841.1|56578_56995_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	77.5	2.6e-53
WP_158327842.1|56987_57659_-	recombinase	NA	A0A0M3ULL1	Bacillus_phage	68.5	1.2e-47
WP_158327843.1|57660_57873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327844.1|57869_58235_-	hypothetical protein	NA	A0A0H3U480	Staphylococcus_phage	41.2	1.2e-14
WP_158327845.1|58463_58679_-	hypothetical protein	NA	S5MNR1	Brevibacillus_phage	63.3	5.5e-07
WP_158327855.1|58666_58894_-	DNA-entry nuclease	NA	A0A0A7RTP9	Clostridium_phage	42.2	1.0e-06
WP_158327846.1|58935_59190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158327847.1|59176_59404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158324648.1|59547_59940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158327848.1|59925_60147_-	hypothetical protein	NA	S5MUE9	Brevibacillus_phage	81.1	4.2e-10
WP_158327849.1|60139_60319_-	hypothetical protein	NA	S5MUE4	Brevibacillus_phage	72.9	2.4e-16
