The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	1380075	1419291	5247824	capsid,head,protease,tail,integrase,holin,portal,terminase	Klebsiella_phage(57.14%)	58	1383025:1383048	1424284:1424307
WP_004149227.1|1380075_1380984_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|1380993_1381875_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1382241_1382724_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1383025:1383048	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_009309602.1|1383242_1384415_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.0	4.7e-201
WP_061891355.1|1384465_1385779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071986589.1|1385819_1386077_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.8	1.2e-13
WP_109027969.1|1386012_1386672_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.1	7.3e-50
WP_004864289.1|1386668_1387184_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_145981949.1|1387183_1387693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027971.1|1387715_1387940_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	6.4e-14
WP_032426413.1|1387936_1388065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064188250.1|1388254_1389115_-	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.1	2.3e-72
WP_048267936.1|1389196_1390009_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_004104278.1|1390052_1390412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027972.1|1390769_1391294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027973.1|1391439_1391799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027974.1|1392100_1392727_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	47.3	1.3e-43
WP_109027975.1|1392827_1393043_+	cell division protein	NA	NA	NA	NA	NA
WP_029497186.1|1393065_1393581_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	1.5e-58
WP_025711394.1|1393619_1393898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070991649.1|1394059_1394335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070991647.1|1394327_1395857_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
WP_109027976.1|1395853_1396825_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	1.7e-108
WP_050484678.1|1396794_1397439_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_070991643.1|1397435_1398077_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.0	1.9e-82
WP_070991641.1|1398073_1398652_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	4.9e-50
WP_001018764.1|1398802_1399042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1399207_1399594_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1399580_1399862_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_070991639.1|1399861_1400491_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	8.7e-85
WP_070991637.1|1400493_1400769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049026356.1|1400719_1400917_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.6	1.1e-22
WP_031592522.1|1400987_1401476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031592520.1|1401560_1401950_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	8.7e-27
WP_065519868.1|1402016_1402262_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	8.7e-33
WP_023339166.1|1402380_1402866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077270817.1|1402937_1403228_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	3.8e-51
WP_017880219.1|1403240_1403450_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|1403571_1404006_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|1404015_1405548_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_070991634.1|1405550_1406828_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.8e-246
WP_077270815.1|1406833_1407514_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	3.5e-124
WP_070991633.1|1407525_1408689_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	1.3e-211
WP_044067369.1|1408725_1408968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|1408915_1409242_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|1409302_1409500_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_070991632.1|1409501_1409834_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	9.0e-57
WP_004216814.1|1409826_1410366_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_000561415.1|1410362_1410728_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|1410783_1411275_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_065806535.1|1411318_1411672_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	98.3	1.1e-60
WP_001333686.1|1411704_1411968_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_077270814.1|1411964_1412396_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	2.2e-63
WP_070991631.1|1412457_1414884_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	83.5	0.0e+00
WP_001018848.1|1414883_1415363_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	78.6	1.9e-76
WP_064159804.1|1415349_1415832_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	1.7e-56
WP_029497207.1|1415839_1416226_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_109027941.1|1416222_1419291_+	kinase	NA	A0A286S259	Klebsiella_phage	66.2	0.0e+00
1424284:1424307	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 2
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	1645937	1652842	5247824	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1645937_1646801_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1646811_1647585_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1647825_1648719_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1648964_1650326_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1650644_1651367_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1651363_1652842_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	1766482	1809124	5247824	capsid,head,protease,tail,integrase,holin,portal,terminase	Klebsiella_phage(46.15%)	60	1766308:1766367	1804122:1804186
1766308:1766367	attL	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCG	NA	NA	NA	NA
WP_101516282.1|1766482_1767475_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	8.4e-175
WP_032408630.1|1767476_1767704_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	2.4e-29
WP_101516283.1|1767736_1768015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142368272.1|1768011_1768215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101516285.1|1768756_1769233_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	50.0	3.8e-16
WP_101516286.1|1769229_1769436_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	2.1e-32
WP_101516287.1|1769432_1769894_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	4.0e-10
WP_101516288.1|1770021_1770807_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	3.8e-61
WP_065954001.1|1770806_1771106_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	5.5e-13
WP_101516289.1|1771195_1772113_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.2	2.6e-45
WP_023317570.1|1772906_1773602_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|1773699_1773942_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1773976_1774438_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_058842804.1|1774842_1775757_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_049026353.1|1775753_1776563_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.0e-109
WP_000779146.1|1776572_1776950_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_058842803.1|1776962_1777943_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	2.4e-134
WP_004899672.1|1777956_1778535_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_031281242.1|1778847_1779105_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_032416155.1|1779010_1779457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|1780019_1780415_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1780401_1780683_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_058842802.1|1780682_1781312_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.7e-104
WP_020317342.1|1781319_1781595_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	1.4e-15
WP_032420712.1|1781545_1781737_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	3.2e-22
WP_032426434.1|1781768_1781969_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
WP_004216876.1|1782033_1782279_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_023301206.1|1782350_1782557_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	5.1e-34
WP_017880218.1|1782628_1782919_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	99.0	1.4e-53
WP_017880219.1|1782931_1783141_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|1783262_1783697_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|1783706_1785239_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|1785241_1786519_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077254200.1|1786524_1787205_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_058842800.1|1787216_1788380_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	3.1e-213
WP_044067369.1|1788416_1788659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143899.1|1788992_1789190_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_004184710.1|1789191_1789524_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|1789516_1790056_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_000561415.1|1790052_1790418_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|1790474_1790966_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|1791009_1791393_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004899621.1|1791395_1791659_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	90.8	7.9e-40
WP_058842799.1|1791722_1792100_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_058842798.1|1792161_1794708_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.6	0.0e+00
WP_004899614.1|1794707_1795187_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|1795173_1795656_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|1795665_1796046_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_058842797.1|1796042_1799102_+	kinase	NA	A0A286S259	Klebsiella_phage	91.0	0.0e+00
WP_040181868.1|1801147_1801948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074177881.1|1801959_1802142_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
WP_001333465.1|1802219_1802642_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_064172351.1|1803301_1803523_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	50.6	2.1e-17
WP_074376103.1|1803479_1803851_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	9.2e-26
WP_002911596.1|1804456_1805602_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
1804122:1804186	attR	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
WP_004148893.1|1805993_1806260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|1806140_1806422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009307518.1|1806464_1807172_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.3	3.7e-07
WP_009484430.1|1807215_1808649_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_040181715.1|1808629_1809124_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	2.8e-30
>prophage 4
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	1956639	2029661	5247824	head,tail,integrase,plate,coat,terminase	Escherichia_phage(19.3%)	91	1949535:1949552	1982907:1982924
1949535:1949552	attL	GACCATCACCTCCAACGT	NA	NA	NA	NA
WP_004148802.1|1956639_1958283_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|1958332_1958809_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009307580.1|1958907_1959834_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|1960137_1961433_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_032413763.1|1961447_1962254_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_113851627.1|1962228_1962510_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113851628.1|1962494_1963757_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.5	1.9e-232
WP_016244760.1|1963799_1964045_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_076996987.1|1964204_1964420_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	48.1	3.6e-06
WP_023304908.1|1964421_1964640_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_113851629.1|1964636_1965722_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.1	2.2e-136
WP_074182332.1|1965702_1966161_-	HNH endonuclease	NA	G9FH70	Rhodococcus_phage	42.1	2.1e-24
WP_076996990.1|1966157_1966814_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	9.7e-111
WP_038435005.1|1966810_1967239_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_146326602.1|1967235_1967916_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	3.7e-121
WP_064172644.1|1967912_1968758_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_016529276.1|1968773_1969058_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_004151303.1|1969146_1969341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178796.1|1969851_1970784_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
WP_004178798.1|1970780_1971254_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
WP_004178801.1|1971361_1971481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032429930.1|1971503_1972226_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004194000.1|1972294_1972522_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|1972561_1972783_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_064172294.1|1972868_1973729_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	1.2e-60
WP_040182092.1|1973725_1974574_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_040182091.1|1974570_1974864_+	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_052450983.1|1975100_1975553_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.6	4.4e-14
WP_015370353.1|1975549_1975813_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_146326628.1|1975916_1976501_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	51.2	3.3e-30
WP_004864289.1|1976500_1977016_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_136073236.1|1977564_1977789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114473460.1|1977915_1978098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114473459.1|1978169_1978427_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	4.6e-24
WP_074385044.1|1978436_1978925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146326604.1|1979014_1979611_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.6e-56
WP_032413853.1|1979616_1979787_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_004151286.1|1979779_1980415_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_023283343.1|1980411_1980552_+	YlcG family protein	NA	NA	NA	NA	NA
WP_063417047.1|1980551_1981241_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.2e-55
WP_074184069.1|1981643_1981859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146526.1|1981985_1982234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804048.1|1982236_1982767_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	4.2e-80
WP_146326606.1|1982763_1983153_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	46.8	1.3e-22
1982907:1982924	attR	GACCATCACCTCCAACGT	NA	NA	NA	NA
WP_124988009.1|1983037_1983289_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	70.7	1.7e-23
WP_040181338.1|1983377_1983581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181335.1|1984197_1984848_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	3.6e-102
WP_040181332.1|1984844_1986413_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
WP_040181330.1|1986424_1987873_+	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
WP_087749279.1|1987790_1988804_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
WP_020804668.1|1988800_1989004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181327.1|1989054_1990410_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_016529582.1|1990409_1990871_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040027496.1|1990867_1991923_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_029884066.1|1991955_1992195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439723.1|1992197_1992578_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_038434988.1|1992577_1992751_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_040181321.1|1992750_1993113_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
WP_040181318.1|1993115_1993484_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_023339086.1|1993480_1993864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181312.1|1994755_1995469_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
WP_040181310.1|1995686_1996244_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
WP_023339090.1|1996390_1996588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052450973.1|1996556_1997030_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_077255485.1|1997212_1997464_+	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
WP_071854270.1|1997519_1997990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146326608.1|1998081_2000655_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	35.7	2.6e-95
WP_029884074.1|2000654_2000897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075208395.1|2001000_2001420_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_032419293.1|2001419_2001890_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_117137172.1|2001886_2002282_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_146326610.1|2002268_2004746_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	44.9	3.3e-196
WP_146326612.1|2006831_2007632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181289.1|2007737_2007977_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_101516272.1|2007976_2008294_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	1.5e-21
WP_048289904.1|2009268_2009751_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2009942_2010641_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2010666_2011251_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2011320_2011650_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004156898.1|2011988_2012168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009307582.1|2012215_2013556_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004175498.1|2013552_2014206_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307583.1|2014209_2015907_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009307584.1|2016365_2018993_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_023342696.1|2018995_2021023_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_123618886.1|2021298_2021934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413757.1|2022426_2022834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|2022859_2023117_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181245.1|2023121_2024333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029498250.1|2024797_2027764_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181246.1|2027897_2029661_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	2701211	2712099	5247824		Escherichia_phage(87.5%)	10	NA	NA
WP_040182019.1|2701211_2704319_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2704373_2705639_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|2705669_2706758_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|2706844_2707105_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2707402_2708263_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2708283_2709045_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|2709035_2709269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027984.1|2709306_2710209_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	5.9e-159
WP_032423485.1|2710220_2711486_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2711478_2712099_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	3093314	3139452	5247824	capsid,head,tail,integrase,plate,portal,tRNA,terminase	Enterobacteria_phage(54.55%)	56	3098542:3098559	3135718:3135735
WP_004892876.1|3093314_3093815_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3093931_3094378_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3094361_3095153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3095254_3096439_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3096470_3097163_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|3097308_3097818_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3097804_3098161_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3098150_3098390_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3098542:3098559	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3098654_3098906_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|3098949_3100089_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|3100243_3101416_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|3101415_3101931_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3101976_3102294_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_075604421.1|3102293_3102452_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_040181412.1|3102438_3105414_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|3105429_3105903_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|3106366_3107029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|3107046_3108270_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|3108869_3109967_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|3109966_3110179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181424.1|3110175_3113202_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|3113191_3114115_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|3114116_3114467_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|3114463_3115051_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|3115047_3115683_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|3115679_3116147_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_124072220.1|3116147_3116423_-	peptidase	NA	NA	NA	NA	NA
WP_031593580.1|3116328_3116658_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_023339943.1|3116669_3117215_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|3117211_3117496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3117486_3117687_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|3117686_3118202_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|3118314_3119172_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|3119221_3120256_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|3120265_3121105_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|3121261_3122989_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|3122982_3124044_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|3124888_3125680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|3125679_3127950_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181444.1|3130839_3131796_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_046623557.1|3131792_3132020_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	2.5e-05
WP_023329528.1|3132028_3132595_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|3132591_3132816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|3132884_3133157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|3133172_3133550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3133565_3133784_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3133804_3134083_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3134203_3134503_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|3134618_3135602_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|3135866_3136880_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3135718:3135735	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3136937_3137039_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|3137038_3137113_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3137230_3137356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3137415_3137679_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3137809_3138448_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|3138537_3139452_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 7
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	3401948	3411422	5247824	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|3401948_3403670_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_023302126.1|3403714_3404416_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3404769_3404988_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3405118_3407398_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3407428_3407746_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3408071_3408293_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3408369_3410310_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3410306_3411422_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP041639	Klebsiella pneumoniae strain PIMB15ND2KP27 chromosome, complete genome	5247824	3892860	3944241	5247824	head,integrase,lysis,tRNA,terminase	Cronobacter_phage(27.08%)	75	3892343:3892389	3941312:3941358
3892343:3892389	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040181289.1|3892860_3893100_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|3893205_3894006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027958.1|3896088_3898566_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	3.0e-197
WP_040181295.1|3898552_3898948_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|3898944_3899415_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_016531189.1|3899414_3899834_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
WP_071854269.1|3900004_3900418_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|3900437_3900617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|3900657_3904098_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|3904192_3904696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|3904798_3905026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|3905120_3905438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|3905489_3905810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071599308.1|3905817_3906156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|3906292_3906766_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|3906802_3907234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|3907244_3907610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|3907606_3907912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|3908216_3908900_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|3908952_3909705_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|3909773_3910166_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|3910162_3910588_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|3910590_3910953_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|3910952_3911126_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|3911125_3911506_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|3911508_3911784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|3911794_3912889_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|3912900_3913329_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|3913332_3914718_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|3914790_3915141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|3915240_3916254_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|3916186_3917650_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|3917662_3918961_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_048294303.1|3918944_3919412_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_058842816.1|3919442_3920069_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|3920918_3921377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|3921950_3922418_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|3922414_3922945_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|3922947_3923196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322094.1|3923623_3924148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|3924492_3925182_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|3925178_3925319_-	YlcG family protein	NA	NA	NA	NA	NA
WP_058842819.1|3925315_3925951_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_032431555.1|3925943_3926114_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|3926094_3926562_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|3926752_3927010_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|3927338_3927536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|3927528_3927795_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|3928806_3929325_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|3929827_3930025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|3930017_3930281_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|3930277_3930700_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|3930696_3930999_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|3930995_3931733_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_040181719.1|3931729_3932695_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181694.1|3932754_3933552_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|3933637_3933859_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|3933898_3934132_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|3934236_3934926_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178801.1|3934948_3935068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434121.1|3935266_3935983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|3935973_3936519_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|3936567_3936771_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_019704100.1|3937198_3937393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|3937482_3937767_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|3937783_3938530_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|3938526_3939150_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|3939178_3939706_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|3939702_3939921_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|3939922_3940258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021441323.1|3940134_3941298_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_071579666.1|3941367_3941691_-	hypothetical protein	NA	NA	NA	NA	NA
3941312:3941358	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|3941729_3942596_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|3942597_3942810_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3942855_3944241_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP041640	Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence	222330	4020	63044	222330	integrase,transposase,protease	uncultured_Caudovirales_phage(31.25%)	54	33004:33018	69539:69553
WP_004152113.1|4020_4983_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|6825_8172_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032422684.1|8367_8766_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077255522.1|8814_10161_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|10368_10851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|10838_11105_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|11280_11535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|11610_11868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|11916_12120_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_146326642.1|12153_12522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073578691.1|12565_13060_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|13090_13666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|13653_13923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|14280_14631_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|14680_15043_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|15060_16812_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|16859_18149_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|18161_18587_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|18619_19156_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|21052_21415_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|21490_22036_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_085903505.1|22044_22755_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|22754_23081_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|23412_23910_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|23959_24469_-	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152086.1|26211_26391_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|26622_27057_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|27273_28674_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|28670_29351_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|29405_30335_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|30339_30720_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|30759_31656_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|31655_33473_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
33004:33018	attL	ATGGCACCGTATACC	NA	NA	NA	NA
WP_001023257.1|33706_34156_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|34444_35182_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|35215_35413_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|35453_37901_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|38027_38468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|38554_41701_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|41711_43004_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|43117_43471_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|43499_44885_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|45074_45755_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|45747_47223_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|47473_47905_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|49333_50540_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|51580_53578_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|53640_54918_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|55900_57337_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|57956_58214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152067.1|58886_59810_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|59874_60186_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|60212_61160_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|62303_63044_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
69539:69553	attR	ATGGCACCGTATACC	NA	NA	NA	NA
>prophage 2
NZ_CP041640	Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence	222330	171768	185097	222330	transposase,protease	Escherichia_phage(80.0%)	14	NA	NA
WP_000616807.1|171768_172422_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|172514_172772_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|172773_173106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|173242_176140_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001067855.1|176409_177114_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|177235_178141_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|178137_179376_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|179375_179960_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|179905_180262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|180452_181217_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|181397_182102_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|182733_183564_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|183694_184249_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|184392_185097_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP041642	Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence	121851	48747	70025	121851	transposase	Escherichia_phage(50.0%)	20	NA	NA
WP_001553819.1|48747_51645_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|51739_52345_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001067858.1|53865_54570_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_017480460.1|54880_55075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056392.1|55035_56565_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201176.1|56753_58394_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|58449_58740_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|58933_59263_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|59267_60299_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|60309_60948_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|60952_61318_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_063860861.1|61321_62134_-	subclass B1 metallo-beta-lactamase NDM-4	NA	NA	NA	NA	NA
WP_001067858.1|62412_63117_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|64420_65125_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|65161_66289_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|66339_66585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|66590_66782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|67263_67806_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|67818_68679_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001118619.1|69101_70025_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 2
NZ_CP041642	Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence	121851	98192	105226	121851	integrase	Escherichia_phage(50.0%)	7	94567:94579	101835:101847
94567:94579	attL	AAACTCACCGTCA	NA	NA	NA	NA
WP_004197635.1|98192_98987_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|99466_99646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|99765_100392_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004197644.1|101031_101907_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
101835:101847	attR	TGACGGTGAGTTT	NA	NA	NA	NA
WP_004197646.1|102318_103590_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|103589_104021_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|104254_105226_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
