The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1132135	1229067	4905039	plate,portal,transposase,tail,capsid,integrase,head,lysis,terminase,tRNA	Salmonella_phage(84.0%)	88	1165975:1166021	1200009:1200055
WP_085983317.1|1132135_1133298_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1133576_1135559_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1135555_1136194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001738699.1|1137907_1138504_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	90.8	7.7e-99
WP_010989066.1|1139081_1140365_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1140624_1142499_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1142664_1143540_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1144656_1146336_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1146558_1148100_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1148229_1149072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1149071_1149635_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1149658_1150294_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1150367_1151570_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1151864_1152878_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1152888_1153869_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1153865_1154240_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1154236_1154758_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1154870_1155155_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1155249_1155606_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1155759_1156578_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1156622_1157906_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1158408_1160478_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1160513_1160729_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1161179_1162007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1162341_1163535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1163924_1164518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1164564_1164732_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1164745_1165810_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1165975:1166021	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000360326.1|1166140_1166803_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1167355_1168372_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1168374_1169007_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1169128_1169371_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1169404_1169914_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1169921_1170122_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1170085_1170427_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1170494_1170728_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1170727_1170955_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1170951_1171809_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1171805_1174220_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1174372_1174561_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1174571_1174805_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001673609.1|1174918_1175596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1175909_1177574_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1177677_1178718_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_058818871.1|1178717_1180484_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.9	0.0e+00
WP_000216276.1|1180626_1181460_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1181476_1182538_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1182541_1183192_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1183285_1183750_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1183749_1183953_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1183956_1184172_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1184152_1184668_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1184664_1185093_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1185188_1185620_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_146471615.1|1185612_1186059_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	98.6	1.1e-70
WP_000958562.1|1186060_1186912_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1186989_1187568_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1187564_1187924_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1187910_1188819_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1188811_1189417_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1189413_1191267_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1191266_1191842_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1192711_1192936_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1193038_1194211_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1194220_1194736_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1194790_1195093_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1195107_1195227_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001677191.1|1195219_1198027_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000980411.1|1198023_1198509_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001102269.1|1198505_1199606_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1199674_1199893_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_010989057.1|1200444_1201608_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1200009:1200055	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1201615_1203796_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1203792_1205202_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001518569.1|1217361_1217844_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1217993_1218470_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1218459_1218750_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1218915_1219254_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_070130124.1|1219402_1221064_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1221149_1222028_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1222150_1222741_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1222775_1223381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139137231.1|1223501_1224788_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001537507.1|1224807_1225599_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1225764_1227126_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1227439_1227688_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1227706_1228255_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1228299_1229067_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1267409	1312415	4905039	plate,tail,integrase,holin,lysis	Salmonella_phage(46.15%)	56	1259276:1259291	1290851:1290866
1259276:1259291	attL	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_001007940.1|1267409_1268639_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.6	5.4e-232
WP_016716136.1|1268616_1268901_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	88.3	1.7e-43
WP_001237033.1|1268941_1269181_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_077906754.1|1269223_1270381_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	97.9	1.2e-212
WP_053296508.1|1270343_1273544_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	70.6	0.0e+00
WP_000373340.1|1274254_1274461_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1274568_1275654_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000169863.1|1275805_1276273_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000145711.1|1276286_1276514_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1276479_1276854_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1276945_1277851_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1277847_1278540_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1278554_1279220_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1279221_1279692_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1279694_1280348_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1280340_1280622_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_001217669.1|1281183_1281417_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1281533_1281782_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_063325263.1|1281816_1282428_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	5.8e-110
WP_001096546.1|1282627_1283239_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_001617856.1|1283235_1283382_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_023893238.1|1283371_1284169_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.0e-151
WP_001533567.1|1284301_1284988_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.2	1.1e-130
WP_001574216.1|1285263_1285593_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984584.1|1285576_1286029_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_001533543.1|1286046_1286499_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_001113128.1|1286723_1286906_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_016716097.1|1287013_1287220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016716096.1|1287324_1287951_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	2.0e-105
WP_016716095.1|1287953_1289573_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
WP_023893014.1|1289572_1291093_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	4.8e-105
1290851:1290866	attR	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_016716093.1|1291133_1291823_+	phage protein F	NA	H9C0V1	Aeromonas_phage	48.9	8.4e-57
WP_016716092.1|1291819_1293166_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_023260969.1|1293167_1293650_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	2.6e-20
WP_001031914.1|1293649_1294678_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	8.7e-82
WP_000829560.1|1294681_1295029_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_016716089.1|1295035_1295482_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
WP_000247613.1|1295475_1296060_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
WP_001048637.1|1296056_1296422_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|1296406_1296952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016716087.1|1296932_1298417_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
WP_000016414.1|1298417_1298864_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1298863_1299268_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1299309_1299492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1299475_1301647_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_001011706.1|1301643_1302354_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.3	4.7e-26
WP_000890115.1|1302353_1302656_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1302652_1303522_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_016716086.1|1303502_1304180_+|plate	phage baseplate assembly protein V	plate	A0A077KAY0	Edwardsiella_phage	36.4	1.9e-32
WP_001191865.1|1304192_1304549_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1304545_1305787_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181747.1|1305788_1306391_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_146471616.1|1306380_1307832_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	3.5e-44
WP_023893018.1|1307831_1308401_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.8	1.6e-93
WP_023893019.1|1308684_1309692_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	94.9	1.1e-187
WP_071925522.1|1310924_1312415_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.4	4.7e-254
>prophage 3
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1679922	1709515	4905039	tail,protease,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1679922_1680417_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1680830_1681322_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1681311_1681575_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1681571_1684058_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1684064_1684760_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1684746_1685616_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1685731_1686181_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1686190_1686793_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1686813_1687431_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1687427_1688087_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1688138_1688876_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1688872_1689085_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1689081_1689561_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1689557_1691489_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1691485_1692043_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_044815690.1|1692039_1693083_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1693126_1693774_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1694503_1695067_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1695258_1695462_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1695764_1696556_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1696852_1697056_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1697224_1699591_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1699919_1700909_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1700923_1701292_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1701320_1702652_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1702948_1703278_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1703870_1705112_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1705114_1705642_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1706019_1706463_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1706516_1708346_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1708693_1708984_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1709011_1709515_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1781567	1790738	4905039	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1781567_1782515_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1782498_1783230_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1783210_1783318_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1783377_1784109_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1784331_1786017_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1786013_1786733_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1786779_1787247_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1787303_1787834_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1788005_1788464_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1788704_1790738_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1859046	1869552	4905039		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1859046_1860450_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1860627_1861521_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1861897_1862983_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1862982_1863882_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1863929_1864808_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1864808_1865360_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1865365_1866358_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1866354_1867128_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1867132_1868212_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1868238_1869552_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	1955546	2006296	4905039	plate,portal,protease,tail,capsid,integrase,head,holin,lysis,terminase	Salmonella_phage(89.06%)	69	1950124:1950138	1966600:1966614
1950124:1950138	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1955546_1956020_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1956667_1956958_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1957329_1958127_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1958418_1959408_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1959409_1959652_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1959676_1960246_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1960249_1961083_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1961079_1961697_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1961693_1962209_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1962205_1962436_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1962506_1963046_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1963182_1964010_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1964067_1964439_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1965253_1965949_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1966046_1966271_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1966299_1966854_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1966600:1966614	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1966850_1968008_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1968004_1968229_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1968225_1969044_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1969045_1969528_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1969527_1970421_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1970417_1970807_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1970823_1971684_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202277.1|1971691_1972681_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_080076196.1|1972691_1973315_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	99.5	2.0e-118
WP_001527054.1|1973447_1973705_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1973634_1974069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1974230_1974575_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1974577_1975192_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1975188_1975674_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1975886_1976306_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1976525_1976828_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1976888_1977239_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1977364_1977859_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1977855_1979589_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1979600_1979783_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1979782_1981024_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1981001_1981652_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1981666_1982872_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1982922_1983123_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1983125_1983449_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1983445_1983850_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1983821_1984334_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1984330_1984891_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1984894_1985059_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1985048_1986545_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1986544_1986901_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1986897_1987224_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1987308_1989237_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1989270_1990611_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_070130154.1|1990607_1991666_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_001273649.1|1991665_1992199_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1992203_1992617_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1992588_1993134_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1993168_1993690_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1993692_1994280_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1994266_1995829_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_015701331.1|1995798_1996398_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_105907579.1|1996682_1997690_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	99.7	1.8e-196
WP_001526483.1|1997902_1998124_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|1998754_1998916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1999042_1999462_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1999464_2000733_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2001187_2001400_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2001410_2001599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2001859_2003056_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2003705_2004005_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2004096_2004792_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2004865_2006296_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	2110340	2117149	4905039	integrase,tail	Salmonella_phage(33.33%)	11	2112550:2112572	2122265:2122287
WP_000856224.1|2110340_2110571_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2110708_2111083_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2111083_2111959_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2111975_2112329_+	YebY family protein	NA	NA	NA	NA	NA
2112550:2112572	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2112702_2113557_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2113616_2114111_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2114300_2114531_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2114584_2115118_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2115374_2115542_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2115606_2115795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2116267_2117149_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2122265:2122287	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	2905635	2990375	4905039	portal,protease,tail,integrase,holin,lysis,terminase,tRNA	Salmonella_phage(44.44%)	92	2929729:2929748	3001521:3001540
WP_000938191.1|2905635_2906316_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2906936_2907596_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2907682_2908012_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2908008_2908290_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2908338_2909118_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2909143_2909692_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2909906_2911118_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2911175_2911493_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2911537_2911951_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2912124_2912787_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2912881_2913340_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2913375_2915430_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2915553_2916000_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2916018_2918172_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2918158_2918764_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2918980_2919490_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2919846_2920899_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2920970_2921423_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2921608_2923369_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2923437_2923956_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2924055_2924223_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2924478_2925042_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2925038_2926679_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2926683_2927937_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2927951_2929859_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2929729:2929748	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2929871_2931980_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2932078_2933188_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2933184_2933727_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2933892_2934903_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2935110_2937723_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2938149_2938341_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2938611_2939298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2939282_2939582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2939650_2940277_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2940924_2941893_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2942368_2942950_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2942949_2945388_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2945441_2945684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2945722_2949073_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2949144_2949849_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2949746_2950484_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2950493_2951189_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_070130156.1|2951278_2951812_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	53.4	5.2e-46
WP_000725267.1|2951928_2952426_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2952524_2952857_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2952853_2955841_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2955920_2956250_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2956246_2956645_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2956690_2957440_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2957451_2957853_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2957849_2958416_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2958396_2958696_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2958688_2959012_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2959102_2961184_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2961107_2962655_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2962651_2962858_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2962854_2964993_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2964949_2965483_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_080076194.1|2965690_2966170_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	76.4	4.2e-55
WP_000984586.1|2966187_2966640_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2966623_2966953_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2967228_2967915_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2968275_2968725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2968860_2968986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2969159_2969477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2969543_2970341_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2970330_2970477_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2970473_2971085_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2971293_2971896_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2971978_2972200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2972311_2972545_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2972836_2973127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2973204_2973516_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2973512_2973860_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2973870_2974620_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2974622_2975606_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2975690_2976065_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2976030_2976270_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2976389_2976800_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2976849_2977110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2977102_2977261_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2977282_2977582_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2977708_2980594_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2980556_2981714_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2981756_2981996_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2982036_2982285_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2982329_2983622_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2983816_2985019_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2985100_2986537_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2986781_2987996_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2988312_2988774_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_070130139.1|2988974_2990375_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3001521:3001540	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	3054541	3063273	4905039	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3054541_3055796_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3056259_3056718_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3056909_3059186_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3059216_3059537_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3059860_3060082_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3060211_3062158_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3062154_3063273_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	4440717	4486032	4905039	plate,portal,protease,tail,capsid,integrase,head,holin,tRNA	Salmonella_phage(72.55%)	60	4438961:4438976	4454061:4454076
4438961:4438976	attL	GCGTCGTCATACCAGG	NA	NA	NA	NA
WP_000918353.1|4440717_4442133_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4442197_4443181_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|4443355_4443598_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_146471642.1|4443765_4444803_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001749452.1|4444890_4445988_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	88.7	2.1e-190
WP_086016711.1|4446066_4446165_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	87.1	8.6e-08
WP_024139121.1|4446194_4446752_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.4	1.7e-87
WP_146471643.1|4446780_4448061_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	96.7	3.8e-236
WP_146471644.1|4448030_4448648_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	87.7	2.7e-99
WP_001749548.1|4448651_4449185_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	84.3	3.8e-81
WP_146471645.1|4449187_4450318_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	84.0	1.9e-146
WP_001207833.1|4450304_4450892_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.5	8.3e-114
WP_000785582.1|4450894_4451974_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	3.2e-204
WP_000605051.1|4451966_4452380_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273647.1|4452384_4452918_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	1.9e-96
WP_001749176.1|4452917_4453976_-|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001749175.1|4453972_4455313_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	98.2	2.9e-247
4454061:4454076	attR	GCGTCGTCATACCAGG	NA	NA	NA	NA
WP_001033736.1|4455372_4455822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000588852.1|4457847_4458174_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|4458170_4458527_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|4458526_4460023_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497756.1|4460012_4460177_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	2.2e-24
WP_001241332.1|4460198_4460744_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_001180259.1|4460740_4461253_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	1.4e-80
WP_001255649.1|4461224_4461638_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.0	1.3e-49
WP_000886224.1|4461649_4461973_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_000691030.1|4461972_4462251_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	3.1e-10
WP_000005720.1|4462294_4463512_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.4	3.9e-198
WP_000039024.1|4463521_4464370_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000002706.1|4464383_4465688_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
WP_001252724.1|4468416_4468920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050814.1|4469022_4469565_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001075994.1|4469561_4470176_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_000226307.1|4470175_4470457_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294874.1|4470443_4470833_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000658039.1|4470922_4471111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508331.1|4471391_4471610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749167.1|4471789_4472542_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	95.2	1.4e-137
WP_024139087.1|4472555_4473545_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	2.1e-189
WP_001539751.1|4473552_4474413_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	99.0	4.6e-161
WP_001749165.1|4474429_4474819_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	98.4	9.2e-69
WP_001749164.1|4474815_4475469_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.4	1.1e-114
WP_001749163.1|4475468_4475951_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	4.6e-86
WP_001749162.1|4475952_4476771_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	98.2	6.6e-133
WP_000620702.1|4476767_4476992_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031607040.1|4476988_4478131_-	peptidase	NA	Q8HA97	Salmonella_phage	85.7	5.9e-180
WP_000509731.1|4478127_4478682_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001749160.1|4478725_4478926_-	transcriptional regulator	NA	U5P445	Shigella_phage	81.5	2.5e-22
WP_001749159.1|4479014_4479689_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.9	1.7e-115
WP_001067434.1|4479860_4480052_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000078504.1|4480127_4480379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|4480950_4481322_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080411.1|4481379_4482207_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	97.8	1.6e-150
WP_000008354.1|4482343_4482883_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_001017878.1|4482953_4483655_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	97.9	8.9e-46
WP_000850456.1|4483658_4483961_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	70.5	4.5e-31
WP_000267994.1|4484002_4484296_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	97.9	9.4e-50
WP_000156435.1|4484292_4484661_+	hypothetical protein	NA	G9L6B4	Escherichia_phage	80.2	3.6e-46
WP_001093920.1|4484796_4485069_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	94.3	2.2e-40
WP_000956555.1|4485498_4486032_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	88.7	1.3e-89
>prophage 11
NZ_CP035301	Salmonella enterica subsp. enterica strain ST1539 chromosome, complete genome	4905039	4511877	4532297	4905039	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4511877_4512225_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4512800_4513088_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4513090_4513696_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4513708_4514023_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4514182_4514638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4514634_4514832_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4514821_4516249_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4516248_4516773_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4516824_4517142_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4517101_4517230_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4517326_4519681_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4519680_4520634_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4520633_4520843_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4520830_4521874_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4521883_4522606_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4522933_4523296_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4523292_4524222_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4524221_4525769_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4525932_4526292_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4526282_4527398_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4527390_4528023_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4528025_4529771_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4529775_4530381_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4530377_4530833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4531081_4531372_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4531568_4532297_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP035302	Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence	93876	71819	81115	93876	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|71819_72500_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_070130127.1|72881_73238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|73230_73701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|74211_74634_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|74633_75908_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000064274.1|75989_76964_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000427676.1|76963_78169_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|78583_79525_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|79556_80123_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|80179_80515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|80698_81115_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
