The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	696537	746718	2715677	terminase,transposase,head,plate,tail,integrase	Mannheimia_phage(79.17%)	61	745537:745596	751621:752036
WP_147009073.1|696537_697578_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|697701_698262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698242_700174_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700316_700499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700648_701689_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701688_702162_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702151_703360_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703622_704855_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|704921_705908_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|705948_706359_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706424_707735_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708149_708869_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|709045_709324_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711250_712132_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712142_712391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712400_712721_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712723_712915_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|712927_713545_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713863_714076_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714081_714264_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714286_714862_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714874_715243_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715484_716039_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|716022_716445_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716800_717400_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717410_717617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717709_718600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718727_719159_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719244_719778_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719780_720023_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|720019_720379_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720541_720799_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720798_721053_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|721060_721561_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721710_723336_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723404_725078_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|725064_726354_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726501_726918_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|726914_727133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727176_728244_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_147009266.1|728243_729161_+|head	head protein	head	B7SDP1	Haemophilus_phage	84.2	2.4e-147
WP_115262444.1|729206_729524_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729523_729949_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|729945_730587_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730587_730767_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730766_732176_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732186_732561_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732560_732929_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|732958_733147_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733199_735479_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735478_736771_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736773_737901_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|737902_738553_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738661_739012_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|739024_740086_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740085_740652_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740652_743379_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743379_744003_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|743995_744460_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744580_745369_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745537:745596	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|745953_746718_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|745953_746718_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751621:752036	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	999401	1006186	2715677		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999401_1000184_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000193_1000922_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1001057_1002077_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1002078_1002681_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002809_1002965_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1003042_1003624_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003638_1004286_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004389_1005019_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005133_1006186_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1089676	1149034	2715677	integrase,transposase	Mannheimia_phage(11.76%)	46	1090271:1090286	1141188:1141203
WP_014325826.1|1089676_1090441_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
1090271:1090286	attL	TTTACTTCATCACCAC	NA	NA	NA	NA
WP_001043260.1|1091051_1091867_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1092035_1092839_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1092838_1093675_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|1094010_1094826_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021112546.1|1095742_1096753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075266381.1|1096853_1097828_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_012340803.1|1098101_1099001_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
WP_012340802.1|1099150_1099588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012340801.1|1100319_1100898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252653.1|1101564_1102389_+	ParA family protein	NA	NA	NA	NA	NA
WP_020831366.1|1102400_1103762_+	replicative DNA helicase	NA	O80281	Escherichia_phage	46.0	3.0e-98
WP_006252651.1|1103770_1105420_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006252489.1|1105412_1105970_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_020824074.1|1107222_1108263_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252261.1|1108453_1108747_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_006252260.1|1108748_1109789_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006248321.1|1109872_1110511_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_006248320.1|1110574_1110844_-	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248319.1|1110930_1112025_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006252259.1|1112079_1116276_-	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006252258.1|1116424_1117198_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_020824044.1|1117351_1118392_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006250514.1|1118779_1120021_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_006250513.1|1120020_1120224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253491.1|1121023_1121539_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	63.0	1.3e-38
WP_020824046.1|1121693_1124522_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	1.9e-304
WP_006249416.1|1124613_1126347_-	C4-dicarboxylic acid transporter DauA	NA	NA	NA	NA	NA
WP_006253136.1|1126588_1127521_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006250509.1|1127522_1128320_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	2.4e-10
WP_006250508.1|1128406_1128628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250506.1|1128810_1130736_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	1.8e-96
WP_006250186.1|1130809_1131175_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_006253134.1|1131176_1131863_+	LrgB family protein	NA	NA	NA	NA	NA
WP_147009271.1|1131946_1133710_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.1	3.7e-56
WP_142778014.1|1133798_1134431_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_020824047.1|1134430_1135273_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_006250500.1|1135298_1136249_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	38.0	6.2e-42
WP_006250219.1|1136327_1137338_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006250217.1|1137701_1140359_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_006250499.1|1140562_1142467_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
1141188:1141203	attR	GTGGTGATGAAGTAAA	NA	NA	NA	NA
WP_006253130.1|1142666_1144091_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.7	2.4e-42
WP_006253128.1|1144476_1144995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061888634.1|1145497_1146565_+	porin	NA	NA	NA	NA	NA
WP_006250495.1|1146717_1148082_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	32.0	3.9e-29
WP_115262429.1|1148383_1149034_+|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1388854	1464900	2715677	terminase,tRNA,holin,portal,transposase,plate,head,tail,integrase,capsid	Mannheimia_phage(85.0%)	83	1391271:1391287	1433298:1433314
WP_006252789.1|1388854_1391242_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1391271:1391287	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1391289_1392276_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1392504_1393164_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1394648_1395401_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1395400_1396300_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1396308_1396872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1396871_1397648_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1397747_1398143_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1398159_1398588_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1398886_1399282_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1399442_1401014_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1401030_1401342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1401463_1402135_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1402255_1403719_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1403946_1407114_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1407127_1408333_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006248136.1|1409174_1409396_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1409400_1411134_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1411845_1412226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1412267_1416728_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1416903_1417620_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1417668_1419012_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1419269_1420157_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1420292_1420478_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1420567_1423195_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1423389_1423815_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1424045_1424819_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1424962_1425754_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1425806_1426103_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1426127_1426406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009274.1|1426565_1428542_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1428633_1429446_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1429813_1430812_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1431089_1431272_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1431541_1431832_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1431806_1432076_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1432065_1432398_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1432408_1432861_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1432860_1433193_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1433205_1435566_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1433298:1433314	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1435562_1435895_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1435891_1436134_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1436284_1436578_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1436586_1436919_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1437001_1437274_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1437413_1437659_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1437757_1437970_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1438093_1438780_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1438783_1439302_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1439319_1439730_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1439841_1440882_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888665.1|1440941_1441316_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1441315_1442557_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1442556_1442994_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1442993_1443380_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1443440_1443581_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1443580_1443895_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1443975_1444482_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1444490_1445672_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1445773_1446037_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1446005_1446641_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1446641_1449656_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1449658_1450198_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1450184_1451102_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1451098_1451434_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1451433_1452039_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1452167_1452455_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_006250778.1|1452447_1452627_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_061888618.1|1452688_1455601_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1455639_1455918_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1455968_1456427_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1456419_1456905_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1456901_1457123_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1457271_1457727_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1457723_1458290_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1458282_1458489_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1458494_1458707_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1458703_1459219_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1459330_1460020_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1460029_1461058_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006252839.1|1461071_1461899_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1462012_1463851_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1463859_1464900_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 5
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1496950	1549533	2715677	head,terminase,integrase,holin	Mannheimia_phage(45.28%)	70	1499525:1499544	1549685:1549704
WP_006252023.1|1496950_1497415_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1497407_1498031_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009275.1|1498031_1500971_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.6	0.0e+00
1499525:1499544	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1501043_1501664_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1501660_1502857_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1502853_1503204_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1503207_1503870_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1503859_1504747_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1504746_1505043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1505045_1505753_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1505987_1506884_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1507168_1507348_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1507499_1508171_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1508193_1508856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1508855_1511525_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1511697_1512102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1512169_1512691_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1512825_1513269_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1513326_1514805_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_147009276.1|1514820_1515327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1515311_1515692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1515699_1516404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1516406_1517012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1517008_1517440_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1517442_1517817_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1517886_1519017_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1519028_1519538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009277.1|1519549_1520806_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	39.6	3.4e-40
WP_006252039.1|1520802_1521993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1522045_1522876_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1522850_1524362_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1524429_1525809_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1525811_1526309_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1526509_1526689_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1526698_1526848_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1526876_1527227_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1527227_1527824_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1527838_1528282_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1528333_1528807_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1528796_1529366_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1529438_1529900_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1529920_1530493_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1530503_1531550_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1531546_1532386_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1532448_1532892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1532940_1533135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1533231_1533891_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1533890_1534730_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1534746_1535574_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_142778103.1|1535589_1535967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1535972_1536431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1536587_1536884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1537349_1537601_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1537603_1537879_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1538556_1539072_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1539338_1540049_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_006252958.1|1540155_1540662_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|1540665_1541025_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_020824129.1|1541021_1541501_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	95.0	3.1e-74
WP_020824130.1|1541634_1541847_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1541859_1542783_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1542775_1543438_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1543478_1543745_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1543772_1544225_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1544323_1544542_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1545236_1546073_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1546458_1547301_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1547816_1548200_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1548249_1548471_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1548492_1549533_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1549685:1549704	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 6
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1638544	1691234	2715677	terminase,holin,portal,transposase,tail,integrase	Mannheimia_phage(66.67%)	63	1626330:1626346	1698023:1698039
1626330:1626346	attL	TTTTTATCTAAACTTAA	NA	NA	NA	NA
WP_006251368.1|1638544_1639600_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824229.1|1639559_1639835_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_061888666.1|1639924_1640431_-	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_081107633.1|1640408_1641005_-	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_142777847.1|1640925_1642245_-	hypothetical protein	NA	A0A0M3LNT4	Mannheimia_phage	100.0	2.7e-261
WP_061888667.1|1642241_1643147_-	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_062627972.1|1643380_1644058_-	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_006248800.1|1644305_1645145_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248797.1|1645374_1645752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484162.1|1645883_1646072_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248795.1|1646075_1646573_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_006248794.1|1646556_1646757_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248793.1|1646753_1647272_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248792.1|1647381_1648185_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248791.1|1648254_1648614_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248790.1|1648649_1649108_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248789.1|1649110_1649308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248788.1|1649291_1649477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248787.1|1649690_1649966_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248786.1|1649968_1650220_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_015484163.1|1650672_1650903_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_015484164.1|1651166_1652279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249427.1|1652275_1652779_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_006249426.1|1652783_1653515_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249425.1|1653641_1653866_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249424.1|1653914_1654676_+	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249423.1|1654672_1655464_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249422.1|1655451_1656087_+	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_147009278.1|1656083_1656656_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.9	1.6e-106
WP_147009279.1|1656725_1657754_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	35.8	3.2e-44
WP_020824218.1|1657746_1658106_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_006252752.1|1658095_1658536_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_006251708.1|1658503_1658698_-	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006251707.1|1659206_1659392_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_041447996.1|1659739_1660084_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	99.1	5.9e-59
WP_020824215.1|1660073_1660667_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_020824214.1|1660667_1660997_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_015484698.1|1661046_1661196_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824213.1|1661465_1661945_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_020824212.1|1661944_1664056_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_015484701.1|1664052_1664277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1664276_1665788_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_147009280.1|1665791_1666145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147009281.1|1666290_1666620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824208.1|1669600_1669924_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824207.1|1669916_1670219_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1670222_1670747_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824205.1|1670743_1671136_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824204.1|1671163_1671805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824203.1|1671887_1672289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1672333_1672564_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824201.1|1672626_1672854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824200.1|1672907_1676459_+|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824199.1|1676458_1676788_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824198.1|1676787_1677504_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_147009282.1|1677507_1678239_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	97.9	5.1e-145
WP_147009283.1|1678507_1679098_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.4	1.4e-100
WP_020824195.1|1679100_1686234_+	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.4	0.0e+00
WP_020824044.1|1686505_1687546_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824074.1|1687774_1688815_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006247811.1|1689097_1689487_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1689630_1689924_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_020910232.1|1690193_1691234_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
1698023:1698039	attR	TTTTTATCTAAACTTAA	NA	NA	NA	NA
>prophage 7
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1890491	1953619	2715677	protease,tRNA,transposase	Mannheimia_phage(22.22%)	55	NA	NA
WP_020824044.1|1890491_1891532_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006251838.1|1891795_1892914_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006251839.1|1892974_1894237_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_006252727.1|1894422_1895370_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	50.9	1.9e-67
WP_006251841.1|1895543_1897040_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.5	1.9e-53
WP_006251842.1|1897277_1898075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247853.1|1898248_1899358_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_006251843.1|1899357_1900455_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_006251844.1|1900680_1904157_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	35.1	1.3e-190
WP_020824165.1|1904195_1904567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247849.1|1904694_1906074_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	80.3	3.6e-168
WP_006251846.1|1906353_1907634_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_006247847.1|1907635_1908115_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.3	1.1e-26
WP_006247846.1|1908124_1908679_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	2.1e-29
WP_006251847.1|1908678_1909170_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_006247844.1|1909189_1910386_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	28.4	5.3e-14
WP_115262485.1|1910526_1911567_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	93.9	5.1e-191
WP_006251728.1|1911874_1913284_-	amino acid permease	NA	NA	NA	NA	NA
WP_006251729.1|1913293_1914190_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_006251730.1|1914336_1916946_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_006247839.1|1917241_1918177_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_006251731.1|1918176_1918941_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_006251732.1|1918952_1920263_+	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_006247836.1|1920281_1921547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247835.1|1921636_1922506_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_005597777.1|1922577_1922847_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_006251950.1|1923028_1924900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247833.1|1925021_1925672_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_006251948.1|1925697_1927251_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006251947.1|1927247_1928345_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_006251946.1|1928399_1929107_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_006251945.1|1929207_1929897_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	50.0	1.8e-51
WP_031200754.1|1929969_1930755_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_006251943.1|1930807_1932952_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.7	3.9e-108
WP_006251942.1|1932951_1933152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251941.1|1933225_1933615_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020824074.1|1933895_1934936_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1936420_1936843_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1937058_1938099_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_142778025.1|1938177_1939356_-	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_006251675.1|1939649_1941557_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_006249773.1|1941630_1942236_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006249772.1|1942305_1942662_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006251674.1|1942658_1943561_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006251672.1|1943574_1944474_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251670.1|1944633_1944957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251669.1|1944966_1946022_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006251668.1|1946078_1947221_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_100067206.1|1947311_1947494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778024.1|1947434_1950002_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_006251664.1|1950250_1950511_+	membrane protein	NA	NA	NA	NA	NA
WP_100067394.1|1950511_1950922_+	OmpW family protein	NA	NA	NA	NA	NA
WP_006250045.1|1951168_1951498_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_020824049.1|1951554_1952205_+|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006251657.1|1952395_1953619_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 8
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	1997533	2108465	2715677	terminase,tRNA,portal,holin,protease,tail,integrase	Mannheimia_phage(53.06%)	111	1991407:1991423	2106452:2106468
1991407:1991423	attL	AAAAAAGACCGCTTGTA	NA	NA	NA	NA
WP_006252380.1|1997533_1998487_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_006248036.1|1998486_1999533_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_006248037.1|1999569_2000229_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_006248038.1|2000277_2000931_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_006248039.1|2000932_2001553_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006248040.1|2001599_2001857_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006248041.1|2002135_2004067_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	5.8e-71
WP_006252383.1|2004263_2005475_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_006248043.1|2005542_2006160_+	MarC family protein	NA	NA	NA	NA	NA
WP_006252384.1|2006181_2007411_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_006253460.1|2007509_2008259_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_006248046.1|2008569_2009007_-	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_006252386.1|2009077_2009887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248048.1|2009895_2010453_+	septation protein A	NA	NA	NA	NA	NA
WP_006248049.1|2010442_2010907_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_006252387.1|2010908_2011190_+	YciI family protein	NA	NA	NA	NA	NA
WP_032849179.1|2011361_2014253_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_006252389.1|2014286_2017445_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.5	5.2e-77
WP_006252392.1|2018665_2020030_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	26.0	2.1e-11
WP_020824151.1|2020031_2021690_-	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_006252394.1|2021850_2022228_+	YacL family protein	NA	NA	NA	NA	NA
WP_006252395.1|2022320_2022908_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_006252396.1|2022939_2023389_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_006252397.1|2023388_2024756_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_020824150.1|2024829_2027163_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_020824149.1|2027304_2029944_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_006252400.1|2030080_2030518_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006252401.1|2030676_2031540_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_006252402.1|2031664_2033071_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_006252403.1|2033166_2034495_+	transporter	NA	NA	NA	NA	NA
WP_006252404.1|2034599_2035454_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006252405.1|2035527_2036313_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_006252406.1|2036334_2037387_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_006252407.1|2037468_2040468_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_006252408.1|2040602_2041535_+	carbamate kinase	NA	NA	NA	NA	NA
WP_006252409.1|2041595_2043200_+	L-lactate permease	NA	NA	NA	NA	NA
WP_006252410.1|2043209_2043425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252411.1|2043465_2044701_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_142777968.1|2044800_2046180_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_006252414.1|2046322_2047540_+	transporter	NA	NA	NA	NA	NA
WP_006250518.1|2047804_2048098_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2048213_2048813_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2048813_2049257_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_147009283.1|2055123_2055714_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.4	1.4e-100
WP_147009282.1|2055982_2056714_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	97.9	5.1e-145
WP_020824198.1|2056717_2057434_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|2057433_2057763_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|2057762_2061314_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|2061367_2061595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|2061657_2061888_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|2061932_2062334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|2062416_2063058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|2063085_2063478_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|2063474_2063999_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|2064002_2064305_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|2064297_2064621_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|2064873_2066835_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|2067238_2068435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|2068438_2069950_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|2069949_2070174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824212.1|2070170_2072282_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|2072281_2072761_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|2073030_2073180_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|2073229_2073559_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|2073559_2074153_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_041447996.1|2074142_2074487_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	99.1	5.9e-59
WP_006251707.1|2074834_2075020_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|2075528_2075723_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|2075690_2076131_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|2076120_2076480_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|2076472_2077501_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|2077627_2078221_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|2078231_2079278_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|2079274_2080114_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|2080289_2080550_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|2080570_2080771_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|2080901_2081585_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|2081659_2082040_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|2082032_2082530_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|2082660_2082843_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|2082881_2083301_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|2083367_2083673_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|2083681_2083957_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|2084246_2084477_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|2084955_2085279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|2085471_2085657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|2085810_2086269_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|2086304_2086664_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|2086735_2087539_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|2087632_2088067_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|2088076_2088565_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|2088585_2088795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|2088941_2089067_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|2089113_2089956_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|2090018_2090402_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|2090451_2090727_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2090686_2091742_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|2091889_2093152_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
WP_006249906.1|2093427_2093649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252134.1|2093736_2094768_-	methionine synthase	NA	NA	NA	NA	NA
WP_006252133.1|2094855_2095833_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_006252132.1|2095971_2096856_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_006252131.1|2096865_2097900_-	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_006249901.1|2098080_2098893_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_006252130.1|2098937_2100791_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006252129.1|2100976_2102563_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_006252128.1|2102623_2103418_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_006252127.1|2103408_2104167_-	biotin ligase	NA	NA	NA	NA	NA
WP_006252126.1|2104247_2104814_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_020824230.1|2105017_2106367_+	MFS transporter	NA	NA	NA	NA	NA
WP_006252121.1|2106533_2108465_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.8e-128
2106452:2106468	attR	AAAAAAGACCGCTTGTA	NA	NA	NA	NA
>prophage 9
NZ_CP017547	Mannheimia haemolytica strain 1329 chromosome, complete genome	2715677	2353432	2460475	2715677	terminase,tRNA,holin,transposase,tail,integrase	Mannheimia_phage(86.75%)	125	2353331:2353390	2459333:2460533
2353331:2353390	attL	TGTAGAAGATCAGACTTGATCTGACAATTCACTCTAAAAAGTGAGAGTTTCCCGTTTAGA	NA	NA	NA	NA
WP_020824044.1|2353432_2354473_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006251963.1|2355259_2355466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252627.1|2356660_2356984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251957.1|2357107_2357395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824044.1|2358625_2359666_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2359785_2360016_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2360202_2360880_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2361073_2361346_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2361354_2361480_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2361659_2362433_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2362515_2363232_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2363241_2363994_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2364209_2364743_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2364651_2364873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2364848_2365190_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2365213_2365963_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2365972_2366923_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2367068_2368088_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2368168_2368924_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2368910_2369555_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2369558_2369780_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2369890_2371528_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2371601_2372567_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2372739_2373387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2373577_2374366_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2374662_2375616_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2376391_2379949_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2379983_2381024_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2381262_2383005_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2383220_2383478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2383984_2384215_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2385135_2385474_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2385731_2387630_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2387771_2388074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2388239_2389379_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2389666_2391175_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2391237_2391459_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2391480_2391927_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2391911_2392508_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2392616_2393951_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2394061_2395210_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2395339_2395687_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2395686_2396544_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2396652_2397615_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_006252237.1|2398724_2399222_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2399269_2400631_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_006252239.1|2400822_2401374_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2402282_2403347_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2403531_2404191_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2404326_2405244_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2405457_2406336_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2406401_2406992_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2407122_2407965_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2408249_2408543_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2408658_2409258_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2409258_2409702_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2415568_2416159_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_147009286.1|2416427_2417159_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	97.9	1.3e-145
WP_061888645.1|2417162_2417879_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2417886_2418333_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2418354_2418684_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2418687_2421183_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2421269_2421665_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2421732_2422191_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251219.1|2422323_2422593_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	5.2e-47
WP_006251220.1|2422607_2423279_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2423375_2423552_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2423607_2424024_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2424063_2424546_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2424549_2424930_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2424926_2425295_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2425296_2425641_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2425640_2426018_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_021265457.1|2426020_2426245_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.1e-21
WP_062627922.1|2426256_2427243_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2427257_2427692_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2427684_2429055_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2429041_2429980_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2429933_2431310_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2431306_2432527_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2432510_2433035_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2433401_2433659_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2433659_2433800_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2433828_2434179_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2434179_2434773_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2434762_2435107_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2435225_2435804_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2436320_2436515_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2436482_2436848_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2436837_2437206_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2437202_2437487_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2437863_2438076_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2438125_2438578_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2438696_2439269_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2439265_2439913_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2439912_2440197_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2440682_2440925_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2441081_2441315_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2441443_2442130_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2442143_2442524_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2442516_2443014_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2443595_2443865_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2443842_2444115_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2444782_2445289_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2445292_2445652_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_020824129.1|2445648_2446128_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	95.0	3.1e-74
WP_020824130.1|2446261_2446474_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2446486_2447410_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2447402_2448065_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2448105_2448951_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2448978_2449431_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2449475_2449967_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2449963_2450167_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2450150_2450615_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2450618_2450807_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2450938_2451316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2451545_2452385_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2452632_2453310_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2453543_2454449_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2455685_2456282_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2456259_2456766_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2456855_2457131_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2457090_2458146_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_147009287.1|2458397_2459351_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_020824044.1|2459434_2460475_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
2459333:2460533	attR	TGTAGAAGATCAGACTTGATCTGACAATTCACTCTAAAAAGTGAGAGTTTCCCGTTTAGAATATGAGTGTCAAAAATCAATCTAAACAAAAAGGAAACTCTCATGTTTTATTCTAACAACCCTCTCATTAAACACAAGACCGGTTTATTAAATTTAGCAGAAGAACTGGGTAATATTTCTCAAGCCTGCAAAGTAATGGGAATGAGCCGAGATACATTCTATCGTTATCAACAAGCGGTTGAGCAAGGTGGTGTTGAAGCATTGCTGAATCAAAATAGACGCGTTCCCAACTTAAAAAATCGTGTTGATGAGGCAATAGAGCAAGCTGTTGTGAAGTTTGCTCTTGATAACCCGGCATTTGGACAGGTAAGAGTGAGTAACGAACTCCGTAAACAAGGCATCTTTGTTTCAGCAGGAGGTGTACGTTCGATTTGGTTACGTCATCATCTTGCCAATTTTAAGCAAAGATTAATCGCCCTGGAAAAACTGGTTGCAGAACAAGGTATTATACTCAGTGAAACACAGGTACAAGCCTTAGAGCGTAAGAAAGAAGATGAGATTGCCTGTGGTGAAATTGAAACGACACACCCTGGCTATCTTGGCTCACAAGATACTTTCTATGTGGGCAACCTCAAAGGAGTGGGTCGTATTTATCAACAAACGTTTATTGATACTTACAGTAAAGTGGCGTTTGCAAAACTTTATACAATGAAGACCGCTATCAGTGCTGCGGATATGCTGAATGATAAAGTGTTACCATACTTTGAAAGCCAAGGTTTACCGATGTTACGCATATTAACTGACCGAGGAAGTGAATATTGTGGCAAGGTAGAAAATCACGATTATGAGCTTTATTTAGCAATAAATGATATTGAACACAGTAAAACCAAGGTAAAACATCCGCAGACTAACGGCATCTGCGAACGGTTCCATAAAACAATCTTACAAGAATTTTACCAAGTGGCATTTAGGAAGAAAATTTATACGGATTTAACGACATTACAAGCGGATTTAGATGAGTGGTTAATGTATTATAATCACCATCGAACACATCAAGGAAAAATGTGCTGTGGCAGAACACCGATGGCAACCTTACTTGATGGAAAACGGATTTGGGTGGAAAAGAATTTAAGCTCAAATTAATCTGACAGACACGGTAATTTAAAACGGGGGACTGTCAGATTAGGTTTGATCTTCTACA	NA	NA	NA	NA
