The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	29212	137929	1267436	tRNA,integrase,transposase	Staphylococcus_phage(12.5%)	103	46830:46889	127090:128011
WP_010962313.1|29212_30175_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_081420797.1|30200_30740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050707706.1|30691_31135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962316.1|31466_32744_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.0	1.5e-99
WP_010962317.1|32778_34050_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_077190061.1|34036_34279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006280296.1|37670_38537_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010962322.1|38840_39767_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	30.4	5.7e-32
WP_010962323.1|39756_40110_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_010962324.1|40151_41414_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010962325.1|41419_43054_-	ribonuclease J	NA	NA	NA	NA	NA
WP_010962326.1|43263_44382_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	32.9	4.2e-29
WP_099606213.1|44605_45208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962328.1|45766_46177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962329.1|46173_46860_-	reverse transcriptase, interruption-C	NA	A0A0U4J920	Pseudomonas_phage	34.1	6.5e-25
46830:46889	attL	TTAGAGGTTGTCCGGAAACTAGTAAATTCAAGCATATTCCCTCTTTAACATAACCCTACT	NA	NA	NA	NA
WP_099606204.1|46856_47689_-|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_099606205.1|47716_48118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962335.1|51845_52043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962336.1|52110_52752_+	dioxygenase	NA	NA	NA	NA	NA
WP_015588782.1|52812_54351_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.0	7.9e-55
WP_010962338.1|55044_56232_+	MFS transporter	NA	NA	NA	NA	NA
WP_006279881.1|56292_56598_+	integration host factor subunit alpha	NA	NA	NA	NA	NA
WP_006279880.1|56597_56924_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006279879.1|56969_57566_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	35.5	2.8e-08
WP_010962340.1|57578_60095_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.8	2.1e-158
WP_010962341.1|60223_60859_+	membrane protein	NA	NA	NA	NA	NA
WP_010082072.1|61331_61496_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.1	3.6e-06
WP_099606206.1|61653_62088_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.8e-09
WP_081420799.1|62072_62366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_006279877.1|62502_63210_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_010082594.1|63202_63514_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_006279875.1|63660_64116_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_010962343.1|64126_64585_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_010082597.1|64714_65938_+	TolC family protein	NA	NA	NA	NA	NA
WP_010082598.1|65957_66533_+	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_010962344.1|66609_67188_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_095742850.1|67189_67408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015588824.1|70946_71258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962350.1|72248_72659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962351.1|72633_73023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022626199.1|73088_73874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082072.1|74380_74545_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.1	3.6e-06
WP_099606206.1|74702_75137_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.8e-09
WP_081420799.1|75121_75415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_022626200.1|75577_76750_-	porin	NA	NA	NA	NA	NA
WP_010962355.1|76812_77628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006280349.1|77861_78647_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010962357.1|78663_80169_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_080717647.1|80416_80587_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	54.5	4.7e-09
WP_022626428.1|80842_80992_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_022626203.1|81377_82871_-	IMP dehydrogenase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	41.5	9.7e-42
WP_038228092.1|82987_83800_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010962359.1|83975_84704_+	triosephosphate isomerase	NA	NA	NA	NA	NA
WP_010962360.1|84778_85867_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.3	1.5e-28
WP_010082601.1|85928_86303_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_010082603.1|87359_88313_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_010962363.1|88293_89052_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_010082605.1|90713_91820_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.9	4.2e-42
WP_010962364.1|91919_92234_+	multidrug transporter	NA	NA	NA	NA	NA
WP_006279756.1|92250_92595_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_010962365.1|94146_97287_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_010962366.1|97421_100007_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_006279761.1|100021_100525_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_010962367.1|100689_101340_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_010082574.1|101357_102053_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.9	1.0e-38
WP_010962368.1|102097_102706_+	SCO family protein	NA	NA	NA	NA	NA
WP_010962369.1|102736_102997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962371.1|103514_105902_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	4.3e-108
WP_081420800.1|106590_106944_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081420801.1|106897_107200_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	42.5	8.3e-09
WP_080717620.1|107477_107642_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010962373.1|107884_109213_+|transposase	IS4-like element ISWen1 family transposase	transposase	NA	NA	NA	NA
WP_010962374.1|109314_110595_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_022626207.1|110620_111241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962378.1|112138_114253_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.5	1.8e-73
WP_006279515.1|114253_114532_-	YggT family protein	NA	NA	NA	NA	NA
WP_007550684.1|114703_114979_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006279415.1|114969_115191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962380.1|115274_115586_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_022626208.1|115566_115788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962382.1|115886_116159_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006279413.1|116160_116379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006279412.1|116579_117017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962383.1|117502_118093_-	CvpA family protein	NA	NA	NA	NA	NA
WP_010962384.1|118150_118747_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	31.4	4.9e-21
WP_010962385.1|118928_120659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962386.1|120805_121849_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.4	6.4e-32
WP_010962387.1|121849_123142_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	33.9	3.9e-23
WP_081420802.1|123211_123421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082251.1|124162_124465_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_010962388.1|124475_124745_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_010962389.1|124888_126061_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	47.0	9.9e-90
WP_099606204.1|126289_127121_+|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_099606207.1|127112_127790_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010962391.1|127834_128494_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
127090:128011	attR	AGTAGGGTTATGTTAAAGAGGGAATATGCTTGAATTTACTAGTTTCCGGACAACCTCTAAAAGAGTTTTCTGATCTTATTGATAAAATAAAAGAACACCCTTTTAATGTTGAATTGATAAATAATACATTAGATTATGAAAAATTCAAATTCTACCTTCAGCAGGATTTTCTGTATTGTATAGATTGCGCTCGTGCTTTTTTAATTGTTGCAGCTAGAGTTGATGATATTGAAATGATGAGTAGTTTAATCAATTTGGCACAAGGAGCATTTTATGTTCGAGAACAGTGTAAAAAATATTTTGAAGATTGTGATCTATCTGATGATCACAAAAAGTCAAGAGCTTGTTCTGCCTTTACTGACTTTTTCATGAGTGCCGCATATCACAATTCTGTTAATGAAGCTTTAGTAGCATCTTATTCTTGCTTTAACATATACCAAATCGTTATACGCCATATGGTAAATGAGATAACAACTAAAGGGGTTAAAAATAACAAATACAAAGAGTGGATCAACATTTATAGTAGCGAAACAGTAAATGCTGTAATTGATGAGGTTACTGATATTACAAATAAGCTATATAAAAAAGCTAGTGACTGTGAAAAAAAGAGGATGTATGAGTTTTTTAAGAAAGGGCTGGAATTAGAAATAATGTTTTGGGATGAGGCATATTACTCTAATATATCTAGCAAAGAATATTAGCAGCGGATTATTTACGTTAACTTGATCTTTTATCGGTAACTACAGTGTTCAGTGGCATAATTAGGAGCTGTTACGGGTCAAATCTTTTAAAGGATATAATTGAGCATCCTTTTAATGTTGAGTTAGCGAATAACACCCTAAATATAGAGAACTTCAAATTCTATGCTCAACAAAAGACGTTGTTCTTAGGTGATTATATTCGTACCACCTTAATTACTGCA	NA	NA	NA	NA
WP_006279354.1|128541_129369_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_010962392.1|129369_129858_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010082183.1|129902_130370_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_138264918.1|130673_130859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962393.1|131553_132978_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_022626213.1|133194_136038_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010962395.1|136129_136549_-	DedA family protein	NA	NA	NA	NA	NA
WP_010082300.1|136555_137929_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.1	2.0e-49
>prophage 2
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	142687	193330	1267436	tRNA,integrase,transposase	Bacillus_phage(20.0%)	52	189964:190006	191069:191111
WP_010962399.1|142687_144805_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010082308.1|144808_145648_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_022626214.1|145692_146451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962401.1|146597_147593_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_010962402.1|147585_148611_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_010962403.1|148594_150643_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_006279675.1|150648_150861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007548280.1|150927_151134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717654.1|151544_151760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962404.1|151795_152617_-	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	30.8	1.5e-12
WP_010962405.1|152606_153146_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.8	4.0e-22
WP_147158423.1|153284_154523_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_010962407.1|154655_155438_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_010962408.1|155465_156713_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	1.6e-50
WP_010962409.1|156926_157871_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_010962410.1|157867_158179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962411.1|158479_158779_-	ETC complex I subunit	NA	NA	NA	NA	NA
WP_010962412.1|158924_159536_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010962413.1|159535_160084_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010962414.1|160086_161049_-|transposase	IS481-like element ISWpi4 family transposase	transposase	NA	NA	NA	NA
WP_010962415.1|161491_162640_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_010962416.1|163208_163733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962417.1|163807_164830_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_010962418.1|164837_165248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022626216.1|165244_165568_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_010082069.1|165722_166016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099606206.1|166000_166435_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.8e-09
WP_010082072.1|166592_166757_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.1	3.6e-06
WP_022626217.1|166848_168252_-	oxidoreductase 2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_146038202.1|168371_168449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006280338.1|168603_169191_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_010962422.1|169486_170665_-	ribonuclease D	NA	A0A0M5KJQ5	Mollivirus	29.9	1.4e-06
WP_081420803.1|170963_171212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041580618.1|171549_174045_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.7	2.9e-30
WP_010962425.1|174319_175126_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006279522.1|175311_175494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010082284.1|175891_176599_+	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	35.6	2.5e-27
WP_010962427.1|176631_178194_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006280151.1|179172_180957_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	59.9	1.3e-202
WP_010962429.1|181015_182092_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010962430.1|185451_185715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006279896.1|185800_185938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006279898.1|186143_186278_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_038228098.1|186385_187474_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_010962432.1|187575_189003_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_006279902.1|189015_189360_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010962434.1|189747_189966_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
189964:190006	attL	TGACCTTACCCAGAAAAAGTAGAGAGAAAGTTAAGACGTTTTT	NA	NA	NA	NA
WP_080717647.1|190142_190313_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	54.5	4.7e-09
WP_146038203.1|190568_190721_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010962435.1|191145_191856_-	hypothetical protein	NA	NA	NA	NA	NA
191069:191111	attR	AAAAACGTCTTAACTTTCTCTCTACTTTTTCTGGGTAAGGTCA	NA	NA	NA	NA
WP_010962436.1|192136_192760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962437.1|192754_193330_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	197425	268811	1267436	head,integrase,terminase,plate,transposase,tail,capsid,protease	Wolbachia_phage(60.0%)	57	189964:190023	236238:236416
189964:190023	attL	TGACCTTACCCAGAAAAAGTAGAGAGAAAGTTAAGACGTTTTTATCATGAGAATAAATTG	NA	NA	NA	NA
WP_099606204.1|197425_198258_-|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_010962438.1|198457_199489_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	92.4	7.9e-184
WP_022626226.1|199695_200418_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_010962441.1|200877_202260_-	PleD family two-component system response regulator	NA	G3MA91	Bacillus_virus	34.6	5.1e-21
WP_010082258.1|202231_202528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962443.1|202532_207257_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010962444.1|207284_209846_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.0	1.5e-122
WP_010962446.1|210617_211061_-	hypothetical protein	NA	A0A1B2LRR6	Wolbachia_phage	79.3	1.1e-28
WP_010962447.1|211123_212953_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	40.8	8.0e-22
WP_010962448.1|213058_213661_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010962449.1|213664_214849_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_022626228.1|215047_216373_-	dihydroorotase	NA	NA	NA	NA	NA
WP_010962451.1|216495_217737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962452.1|217905_220032_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_010082185.1|222589_223465_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.0	3.0e-43
WP_006279648.1|223471_223987_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_010962455.1|224121_225831_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_006279647.1|225808_226237_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	35.0	2.7e-13
WP_007549265.1|226236_226719_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_081420804.1|228146_228812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006279458.1|228863_229325_-	dUTP diphosphatase	NA	V5L6Y7	Insectomime_virus	55.1	7.2e-36
WP_121692649.1|229545_229593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962459.1|229739_230651_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010962460.1|230655_231249_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_007548640.1|231347_232427_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_010962461.1|232454_233618_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	4.8e-20
WP_006279391.1|234081_235011_+	permease	NA	NA	NA	NA	NA
WP_146038203.1|235539_235692_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080717647.1|235947_236118_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	54.5	4.7e-09
WP_010962462.1|236374_237706_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
236238:236416	attR	CAATTTATTCTCATGATAAAAACGTCTTAACTTTCTCTCTACTTTTTCTGGGTAAGGTCACCTCTTTAGGTGCTCCTTTTTTCTTTCTTATACACACAAAAATCATATAGAATTGTAAATACAGCTTTTTTATTCTGATGCTTTTCAATTCTATAGCTCTGGTTGTCTCTCTATTACTA	NA	NA	NA	NA
WP_010962373.1|237747_239076_-|transposase	IS4-like element ISWen1 family transposase	transposase	NA	NA	NA	NA
WP_010962463.1|239194_240427_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	58.3	2.8e-58
WP_010962465.1|241134_242061_-	helix-turn-helix domain-containing protein	NA	E9P5Z7	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	59.4	5.6e-88
WP_010962466.1|242139_243333_-	hypothetical protein	NA	A0A1B2LRQ6	Wolbachia_phage	95.2	4.2e-197
WP_010962468.1|245828_246833_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	94.6	1.8e-180
WP_010962471.1|248607_249837_+	DNA modification methylase	NA	E9P620	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	89.4	3.9e-214
WP_010962472.1|249853_250345_+	MarR family transcriptional regulator	NA	A0A1B2LRT3	Wolbachia_phage	83.0	1.5e-63
WP_010962473.1|250514_252341_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	85.2	0.0e+00
WP_010082193.1|252340_252562_+	hypothetical protein	NA	A0A1B2LRU7	Wolbachia_phage	83.6	1.0e-24
WP_010082194.1|252607_253021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082195.1|253221_253443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082196.1|253423_253732_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_022626237.1|256858_257920_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_010962475.1|257894_258266_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	86.9	2.2e-51
WP_010962476.1|258343_259345_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	95.2	3.3e-187
WP_010082171.1|259435_259696_+	hypothetical protein	NA	Q9JMM1	Wolbachia_phage	71.8	9.6e-22
WP_010962477.1|259881_260904_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_010962479.1|261228_261726_+|tail	phage tail protein	tail	Q75QM4	Wolbachia_phage	45.1	8.9e-24
WP_010962480.1|261732_262206_+	hypothetical protein	NA	Q75QM3	Wolbachia_phage	70.7	8.6e-61
WP_010082109.1|262658_262913_+	hypothetical protein	NA	A0A1B2LRW2	Wolbachia_phage	77.8	1.5e-14
WP_015588922.1|262909_263245_+|plate	baseplate assembly protein	plate	E9P610	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	73.9	9.1e-41
WP_010962482.1|263247_264057_+|plate	baseplate assembly protein J	plate	Q9JML6	Wolbachia_phage	82.5	7.2e-116
WP_015588924.1|264056_265217_+|tail	phage tail protein	tail	Q9JML5	Wolbachia_phage	81.0	1.7e-190
WP_010962484.1|265390_265993_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010962485.1|266254_266845_+	ankyrin repeat domain-containing protein	NA	F8QZT9	Wolbachia_phage	46.5	1.5e-06
WP_010962486.1|266877_267306_+	DUF2924 domain-containing protein	NA	Q9JML2	Wolbachia_phage	83.7	1.5e-59
WP_010962487.1|267308_268811_+	recombinase family protein	NA	Q9JML1	Wolbachia_phage	85.7	1.9e-247
>prophage 4
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	276457	335496	1267436	tRNA,protease,transposase	Wolbachia_phage(15.79%)	53	NA	NA
WP_010962495.1|276457_277369_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	80.7	5.1e-126
WP_038198869.1|277948_278233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147155094.1|278363_278681_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080717614.1|278834_278999_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010962498.1|279695_280460_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_010962499.1|280475_282026_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	7.1e-11
WP_010962500.1|282027_282915_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_010082655.1|283090_283528_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	44.1	5.9e-32
WP_010962501.1|283520_286643_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_010962503.1|287205_288855_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	47.5	6.4e-127
WP_006279496.1|288955_289246_-	co-chaperone GroES	NA	A0A221S331	uncultured_virus	35.6	8.0e-09
WP_010962504.1|289404_290211_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_010962506.1|291028_292768_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	1.6e-64
WP_010962507.1|292828_293062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962508.1|293058_293262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717600.1|293636_293837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038228111.1|293833_295135_-	membrane protein	NA	NA	NA	NA	NA
WP_010962510.1|295127_296423_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_010962511.1|296712_299166_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	47.4	1.1e-199
WP_010962512.1|299181_300459_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.4	1.0e-108
WP_010962513.1|300458_301085_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.9	4.3e-60
WP_010962514.1|301096_302431_-	trigger factor	NA	NA	NA	NA	NA
WP_010962515.1|302811_303408_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_010962516.1|303468_304398_+	glutathione synthase	NA	NA	NA	NA	NA
WP_007549072.1|304382_305414_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_006279962.1|305483_305876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962518.1|305881_307255_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	4.3e-44
WP_081420806.1|307330_308050_-|transposase	transposase	transposase	Q75QL1	Wolbachia_phage	33.6	1.9e-22
WP_022626245.1|308062_308245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099606204.1|308728_309561_-|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_050707711.1|309625_310033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010962519.1|310941_312285_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_010962521.1|312631_315310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082554.1|315301_315898_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_007550159.1|315875_316139_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_010962522.1|316251_318729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962523.1|319812_321090_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	32.3	5.9e-56
WP_010962524.1|321270_322866_+	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	57.8	4.2e-99
WP_010962525.1|323342_324053_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_006280267.1|324188_325019_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_006279631.1|325068_325197_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_010962526.1|325246_325561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081420807.1|325640_325943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099606206.1|325927_326362_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.8e-09
WP_041580622.1|326365_326581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010082072.1|326573_326738_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.1	3.6e-06
WP_010962527.1|326838_327921_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010082532.1|328122_329205_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	26.5	4.6e-09
WP_010082533.1|329442_331191_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.1	4.6e-59
WP_080717604.1|331800_331857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962529.1|332091_333267_+	multifunctional ribose 5-phosphate isomerase B/3-demethylubiquinone-9 3-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	A0A1B1IVA4	uncultured_Mediterranean_phage	28.3	4.0e-06
WP_010082521.1|333278_333719_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_010962530.1|333858_335496_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	1.6e-93
>prophage 5
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	431427	641015	1267436	head,terminase,plate,transposase,tail,tRNA,capsid,protease	Wolbachia_phage(58.54%)	171	NA	NA
WP_010962602.1|431427_431961_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	43.2	2.3e-30
WP_080717608.1|432550_432625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099606214.1|432918_433101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962604.1|433213_434311_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010962605.1|434307_435069_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	44.6	9.3e-49
WP_010081874.1|435122_435578_-	arginine repressor ArgR	NA	NA	NA	NA	NA
WP_022626280.1|435703_436438_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022626279.1|436437_437085_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010962606.1|437068_437710_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	2.5e-26
WP_099606204.1|437812_438644_+|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_010962607.1|439019_440219_-|capsid	phage major capsid protein	capsid	S5FUW7	Shigella_phage	33.7	7.5e-53
WP_010962608.1|440267_440561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962609.1|440753_441551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010082622.1|441600_442275_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_010962610.1|442305_443628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022626278.1|443804_444047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962611.1|444088_445303_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010962612.1|445369_447964_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	51.2	1.5e-247
WP_022626277.1|448213_449323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962614.1|449373_449889_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_010962615.1|450033_450354_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_010962616.1|450353_451943_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	2.2e-153
WP_010962617.1|451968_452376_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_099606210.1|452416_453688_-	MFS transporter	NA	NA	NA	NA	NA
WP_022626274.1|453797_454064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962620.1|454778_455879_+	AAA family ATPase	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.7	3.2e-42
WP_010962621.1|456426_457425_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	29.5	2.0e-11
WP_006279664.1|457400_457775_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_010082651.1|458474_460271_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.5	1.3e-19
WP_010962622.1|460346_461741_-	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_081420810.1|461985_462198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962623.1|462763_463456_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_006280002.1|463436_463712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962624.1|463879_464725_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_010962625.1|464732_465671_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	47.8	3.7e-23
WP_010962626.1|465674_466415_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010962627.1|466474_467182_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010962628.1|467242_468184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962629.1|468304_468838_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010962630.1|468972_470295_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_080717615.1|470309_471182_-	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_006280012.1|471347_471566_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006280013.1|471581_471905_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_010962632.1|472099_473494_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010962633.1|473886_474909_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_010962634.1|474896_476171_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	1.7e-135
WP_010962635.1|476175_477672_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_010082236.1|477698_478373_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	51.7	3.4e-18
WP_022626270.1|480721_482209_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_038228260.1|482216_483128_-	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_010962641.1|483194_484421_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_010962643.1|484810_486280_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010962645.1|488973_489912_-	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR8	Wolbachia_phage	96.2	7.5e-157
WP_010962646.1|489980_491777_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	98.5	0.0e+00
WP_010962647.1|492697_493627_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	76.6	1.7e-105
WP_146038207.1|493946_495314_-	latrotoxin-related protein	NA	NA	NA	NA	NA
WP_010962649.1|497223_505755_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_010962650.1|505790_507200_-	ankyrin repeat-containing protein	NA	NA	NA	NA	NA
WP_099606204.1|507952_508785_-|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_041580719.1|510912_511197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095866567.1|511218_511560_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	42.5	7.2e-09
WP_080717614.1|511798_511963_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_022626263.1|512652_513516_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_006279325.1|513886_514393_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	47.1	1.3e-30
WP_010962656.1|514461_514653_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010082212.1|514669_515296_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006279327.1|515285_515981_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	47.9	2.2e-20
WP_010962658.1|516256_516814_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010962659.1|516821_517565_-	UMP kinase	NA	NA	NA	NA	NA
WP_010962660.1|517575_518436_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_010962661.1|518416_519265_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010081840.1|519670_520042_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-13
WP_010962662.1|520122_521943_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.2	2.4e-95
WP_010962663.1|522250_522694_+	hypothetical protein	NA	A0A1B2LRR6	Wolbachia_phage	79.3	1.8e-28
WP_147158426.1|524667_525489_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	60.4	3.7e-59
WP_010962665.1|525603_525795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010082163.1|525891_526779_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_010962666.1|526769_527648_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_010962667.1|528603_529776_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_022626293.1|529814_531773_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_050707712.1|531769_532222_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_099606204.1|532302_533134_+|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_041580627.1|533114_534083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022626296.1|534332_536993_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_010962671.1|538408_539050_-	fructose-6-phosphate aldolase	NA	M1PR54	Cyanophage	45.8	5.8e-44
WP_010082297.1|539089_539431_-	hypothetical protein	NA	A0A1B2LRQ3	Wolbachia_phage	52.2	3.8e-10
WP_081420812.1|539701_540055_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095866567.1|540008_540350_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	42.5	7.2e-09
WP_080717620.1|540588_540753_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010082295.1|541276_542155_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.0	1.6e-39
WP_010962673.1|542138_542714_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_010082293.1|542706_542973_-	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	40.7	1.7e-10
WP_010962674.1|542986_544270_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010962675.1|544358_545537_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010962676.1|545812_546985_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_010962373.1|548094_549423_+|transposase	IS4-like element ISWen1 family transposase	transposase	NA	NA	NA	NA
WP_010962679.1|549869_550778_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	84.8	1.7e-145
WP_022626301.1|550793_551009_-	hypothetical protein	NA	A0A1B2LRU2	Wolbachia_phage	66.2	3.2e-15
WP_010962680.1|551063_551585_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010962681.1|551641_552586_-|tail	tail protein	tail	A0A1B2LRT8	Wolbachia_phage	76.0	7.3e-136
WP_010081876.1|552586_552796_-|tail	tail protein	tail	A0A1B2LRT9	Wolbachia_phage	73.9	8.2e-24
WP_022626303.1|552792_553140_-|tail	phage tail protein	tail	A0A1B2LRV9	Wolbachia_phage	71.9	4.5e-43
WP_010962685.1|555513_555771_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	98.8	1.6e-37
WP_007303020.1|556111_556312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010082216.1|556373_556871_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	92.3	4.0e-85
WP_010962686.1|558061_558613_-	hypothetical protein	NA	Q75QL3	Wolbachia_phage	70.8	3.3e-56
WP_022626305.1|558619_560050_-	hypothetical protein	NA	Q75QL4	Wolbachia_phage	91.5	2.1e-203
WP_010962688.1|560046_560241_-	hypothetical protein	NA	A0A1B2LRW5	Wolbachia_phage	81.2	2.6e-24
WP_010962689.1|560245_561424_-	hypothetical protein	NA	A0A1B2LRR4	Wolbachia_phage	90.8	5.1e-203
WP_010962690.1|561433_563362_-	DUF4815 domain-containing protein	NA	A0A1B2LRP5	Wolbachia_phage	95.6	0.0e+00
WP_010962691.1|563378_564080_-	hypothetical protein	NA	A0A1B2LRU4	Wolbachia_phage	79.8	5.7e-101
WP_010962692.1|564162_566211_-	AAA family ATPase	NA	Q9JMN6	Wolbachia_phage	73.6	1.4e-237
WP_010962695.1|567440_567941_-	hypothetical protein	NA	A0A1B2LRU0	Wolbachia_phage	79.6	1.6e-68
WP_099606204.1|568229_569062_-|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_010962698.1|569691_570513_-	ATP-binding protein	NA	E9P631	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	85.0	8.1e-131
WP_010962699.1|570606_571101_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1B2LRS7	Wolbachia_phage	54.0	3.3e-39
WP_038228276.1|571683_572133_+	Holliday junction DNA helicase	NA	Q9JMN0	Wolbachia_phage	96.6	7.9e-80
WP_010962700.1|572246_573473_+	DNA modification methylase	NA	E9P620	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	92.6	2.8e-220
WP_010962701.1|573486_573966_+	hypothetical protein	NA	Q9JMM9	Wolbachia_phage	95.0	9.6e-76
WP_010962702.1|573969_575451_+	hypothetical protein	NA	F8QZT7	Wolbachia_phage	84.5	7.0e-218
WP_010962703.1|575447_577271_+|terminase	phage terminase large subunit family protein	terminase	Q9JMM7	Wolbachia_phage	96.0	0.0e+00
WP_010962704.1|577274_577508_+	hypothetical protein	NA	A0A1B2LRU7	Wolbachia_phage	80.8	2.0e-26
WP_012673197.1|577548_577809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962706.1|577799_578081_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1C9M026	Mycobacterium_phage	51.4	3.0e-05
WP_006280203.1|579597_580659_+	S49 family peptidase	NA	Q75QM8	Wolbachia_phage	87.1	1.6e-163
WP_010082142.1|580733_581105_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	89.4	1.0e-53
WP_010962707.1|581141_582146_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	94.6	9.7e-187
WP_007550857.1|582243_582549_+	hypothetical protein	NA	Q9JMM1	Wolbachia_phage	78.2	3.4e-42
WP_010962709.1|585056_585410_+	hypothetical protein	NA	Q9JMN4	Wolbachia_phage	99.1	2.9e-45
WP_006280189.1|585524_587720_-	AAA family ATPase	NA	Q9JMN6	Wolbachia_phage	99.8	0.0e+00
WP_010962710.1|588427_591955_-	DEAD/DEAH box helicase	NA	H8ZJC9	Ostreococcus_tauri_virus	28.6	1.0e-36
WP_010082157.1|592648_593410_+	NTP transferase domain-containing protein	NA	A0A2K9L4K9	Tupanvirus	28.8	4.0e-15
WP_006280064.1|593541_594501_+	NAD(P)-dependent oxidoreductase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.5	3.7e-18
WP_010962711.1|594457_596794_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010962712.1|596754_598449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962713.1|598452_599442_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_010962714.1|599442_601218_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	35.0	5.4e-31
WP_006280069.1|601219_602269_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_006280070.1|602265_603318_+	threonine aldolase family protein	NA	NA	NA	NA	NA
WP_006280071.1|603445_604591_+	MFS transporter	NA	NA	NA	NA	NA
WP_006280072.1|604608_605916_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.5	4.3e-70
WP_006280073.1|605980_606895_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010962716.1|607378_608290_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRR7	Wolbachia_phage	58.7	4.2e-88
WP_010962717.1|608315_609224_-	helix-turn-helix transcriptional regulator	NA	E9P5Z7	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	57.2	2.6e-82
WP_006280787.1|610532_611189_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	60.5	2.0e-68
WP_010962718.1|611358_612270_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRR8	Wolbachia_phage	61.3	4.5e-82
WP_010962719.1|612399_613296_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	79.8	2.0e-130
WP_010082266.1|613296_613836_+	hypothetical protein	NA	D9I601	Acinetobacter_virus	36.5	2.4e-22
WP_022626315.1|614538_616968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962721.1|617210_618635_+	cytoplasmic incompatibility factor CifA	NA	NA	NA	NA	NA
WP_010962722.1|618710_622211_+	cytoplasmic incompatibility factor CifB	NA	NA	NA	NA	NA
WP_010962723.1|623330_626231_+	hypothetical protein	NA	Q9JML0	Wolbachia_phage	39.3	1.1e-94
WP_010962724.1|626637_628107_-	recombinase family protein	NA	Q9JML1	Wolbachia_phage	85.4	1.4e-242
WP_010962725.1|628100_628541_-	DUF2924 domain-containing protein	NA	Q9JML2	Wolbachia_phage	89.9	2.9e-63
WP_010962726.1|628553_629012_-	ankyrin repeat domain-containing protein	NA	Q9JML3	Wolbachia_phage	80.4	1.7e-37
WP_041580639.1|629037_629772_-	ankyrin repeat domain-containing protein	NA	A0A1B2LRT4	Wolbachia_phage	83.3	4.4e-80
WP_010962728.1|629939_631100_-	hypothetical protein	NA	A0A1B2LRQ8	Wolbachia_phage	80.8	9.2e-189
WP_010962729.1|631099_631891_-|plate	baseplate assembly protein J	plate	Q9JML6	Wolbachia_phage	78.2	1.9e-113
WP_007552425.1|631893_632229_-|plate	baseplate assembly protein W	plate	E9P610	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.2	8.3e-42
WP_010082105.1|632231_632486_-	hypothetical protein	NA	Q75QM1	Wolbachia_phage	69.6	1.4e-12
WP_010962731.1|632493_632958_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	86.4	2.0e-70
WP_010962732.1|632944_633421_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	79.1	3.2e-63
WP_038228285.1|633417_633933_-|tail	tail protein	tail	A0A1B2LRS9	Wolbachia_phage	67.1	1.7e-57
WP_099606204.1|634712_635544_+|transposase	IS5-like element ISWpi1 family transposase	transposase	NA	NA	NA	NA
WP_080717620.1|635568_635733_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_095866567.1|635971_636313_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	42.5	7.2e-09
WP_038198869.1|636334_636619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038198955.1|636761_638279_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010962736.1|638547_639282_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	25.7	6.3e-10
WP_022626321.1|639377_639713_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_010962738.1|639734_641015_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP042445	Wolbachia pipientis strain wMel_ZH26 chromosome, complete genome	1267436	921223	980545	1267436	portal,terminase,transposase,tRNA,protease	Bacillus_phage(13.33%)	54	NA	NA
WP_007549940.1|921223_921427_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081420825.1|921531_921843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010962951.1|922364_924281_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.9	7.2e-114
WP_010082321.1|924408_924837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962952.1|925029_925617_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_010962953.1|925607_925916_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_022626390.1|925912_927760_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_010962955.1|927763_929206_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_010962956.1|929202_930567_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_010082374.1|930584_931628_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010082373.1|931745_932138_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_010082371.1|932682_933168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022626392.1|933209_934685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962959.1|935406_936660_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_006279610.1|936688_937207_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	1.4e-08
WP_010962960.1|937219_939121_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	39.7	5.8e-132
WP_010962961.1|939113_939401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022626393.1|939516_939999_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_010082336.1|940130_941657_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_010962962.1|941960_942977_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	28.6	2.7e-19
WP_080717640.1|942931_943156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962965.1|943819_944776_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010962966.1|944768_945806_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_010962967.1|945816_945999_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_010962968.1|946909_947692_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006279859.1|947684_948386_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.7	3.0e-25
WP_010962969.1|948706_949204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962970.1|949276_950440_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010962971.1|950719_951163_+	hypothetical protein	NA	A0A1B2LRR6	Wolbachia_phage	76.8	1.4e-28
WP_010962767.1|951592_953140_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.6	8.9e-131
WP_010962972.1|953136_953937_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	59.4	3.6e-51
WP_010962973.1|953971_955219_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.7	6.7e-36
WP_010962974.1|955505_956924_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_010962975.1|957141_957639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962976.1|957892_958600_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_010962977.1|958599_959379_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_010962978.1|959405_960425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962979.1|960475_963052_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	31.7	3.0e-46
WP_010082072.1|963266_963431_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.1	3.6e-06
WP_099606206.1|963588_964023_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.8e-09
WP_081420826.1|964007_964310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010082068.1|964542_965349_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010962980.1|965354_965999_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_010962981.1|966396_966747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010962982.1|966867_968535_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	36.2	2.6e-88
WP_010962983.1|968543_970478_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_010962984.1|970891_972379_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010962985.1|972382_974926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010962986.1|974980_976174_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	44.4	5.7e-85
WP_080717643.1|976409_976673_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010081986.1|976648_976882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010081985.1|977133_977751_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_010081984.1|977750_978728_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010962987.1|979081_980545_-|terminase	phage terminase large subunit	terminase	A0A0N9RQZ8	Pseudomonas_phage	32.0	2.0e-55
