The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	696649	746830	2590632	transposase,plate,terminase,integrase,tail,head	Mannheimia_phage(79.17%)	61	745649:745708	751733:752148
WP_147009073.1|696649_697690_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|697813_698374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698354_700286_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700428_700611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700760_701801_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701800_702274_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702263_703472_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703734_704967_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|705033_706020_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|706060_706471_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706536_707847_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708261_708981_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|709157_709436_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711362_712244_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712254_712503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712512_712833_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712835_713027_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|713039_713657_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713975_714188_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714193_714376_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714398_714974_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714986_715355_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715596_716151_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|716134_716557_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716912_717512_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717522_717729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717821_718712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718839_719271_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719356_719890_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719892_720135_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|720131_720491_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720653_720911_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720910_721165_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|721172_721673_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721822_723448_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723516_725190_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|725176_726466_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726613_727030_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|727026_727245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727288_728356_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|728355_729273_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|729318_729636_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729635_730061_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|730057_730699_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730699_730879_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730878_732288_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732298_732673_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732672_733041_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|733070_733259_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733311_735591_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735590_736883_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736885_738013_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|738014_738665_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738773_739124_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|739136_740198_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740197_740764_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740764_743491_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743491_744115_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|744107_744572_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744692_745481_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745649:745708	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|746065_746830_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|746065_746830_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751733:752148	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	999510	1006295	2590632		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999510_1000293_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000302_1001031_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1001166_1002186_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1002187_1002790_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002918_1003074_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1003151_1003733_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003747_1004395_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004498_1005128_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005242_1006295_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	1316044	1393532	2590632	transposase,plate,terminase,integrase,capsid,holin,tRNA,tail,portal,head	Mannheimia_phage(85.25%)	85	1318461:1318477	1361930:1361946
WP_006252789.1|1316044_1318432_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1318461:1318477	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1318479_1319466_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1319694_1320354_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1321838_1322591_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1322590_1323490_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1323498_1324062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1324061_1324838_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1324937_1325333_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1325349_1325778_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1326076_1326472_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1326632_1328204_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1328220_1328532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1328653_1329325_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1329445_1330909_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1331136_1334304_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1334317_1335523_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1335553_1336126_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1336364_1336586_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1336590_1338324_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1339035_1339416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1339457_1343918_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1344093_1344810_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1344858_1346202_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1346459_1347347_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1347482_1347668_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1347757_1350385_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1350579_1351005_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1351235_1352009_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1352152_1352944_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1352996_1353293_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1353317_1353596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1353755_1355732_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1355823_1356636_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006252804.1|1357000_1357999_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	100.0	3.1e-185
WP_006248154.1|1358276_1358459_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_134916677.1|1358587_1359628_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.1	6.1e-200
WP_075271718.1|1359725_1360217_-	methyltransferase	NA	A0A0M3LQB3	Mannheimia_phage	100.0	1.2e-97
WP_006252806.1|1360216_1360507_-	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	100.0	5.5e-50
WP_006252807.1|1360481_1360751_-	hypothetical protein	NA	A0A0M3LPF0	Mannheimia_phage	100.0	1.1e-44
WP_006252809.1|1361083_1361527_-	single-stranded DNA-binding protein	NA	A0A0M3LP18	Mannheimia_phage	100.0	1.5e-75
WP_006250958.1|1361526_1361853_-	hypothetical protein	NA	A0A0M3LSB5	Mannheimia_phage	100.0	3.4e-56
WP_075271719.1|1361837_1364198_-	replication endonuclease	NA	A0A0M3LSC6	Mannheimia_phage	100.0	0.0e+00
1361930:1361946	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1364194_1364527_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1364523_1364766_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1364916_1365210_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1365218_1365551_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1365633_1365906_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1366045_1366291_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1366389_1366602_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1366725_1367412_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1367415_1367934_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1367951_1368362_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1368473_1369514_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888665.1|1369573_1369948_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1369947_1371189_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1371188_1371626_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1371625_1372012_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1372072_1372213_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1372212_1372527_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1372607_1373114_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1373122_1374304_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1374405_1374669_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1374637_1375273_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_147010270.1|1375273_1378288_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	100.0	0.0e+00
WP_061888620.1|1378290_1378830_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1378816_1379734_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1379730_1380066_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1380065_1380671_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1380799_1381087_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006250778.1|1381079_1381259_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_075271747.1|1381320_1384233_-|tail	phage tail protein	tail	A0A0M3LS92	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1384271_1384550_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1384600_1385059_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1385051_1385537_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_075271746.1|1385533_1385755_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LQ09	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1385903_1386359_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1386355_1386922_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1386914_1387121_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1387126_1387339_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006252832.1|1387335_1387851_-|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1387962_1388652_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1388661_1389690_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006248198.1|1389703_1390531_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1390644_1392483_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_040081096.1|1392491_1393532_+|portal	phage portal protein	portal	A0A0M3LQ03	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	1425582	1481327	2590632	integrase,holin,terminase,head	Mannheimia_phage(46.55%)	74	1428157:1428176	1481479:1481498
WP_006252023.1|1425582_1426047_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1426039_1426663_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009275.1|1426663_1429603_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.6	0.0e+00
1428157:1428176	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1429675_1430296_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1430292_1431489_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1431485_1431836_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1431839_1432502_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1432491_1433379_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1433378_1433675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1433677_1434385_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1434619_1435516_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1435800_1435980_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1436131_1436803_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1436825_1437488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1437487_1440157_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1440329_1440734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1440801_1441323_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1441457_1441901_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1441958_1443437_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1443452_1443959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1443943_1444324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1444331_1445036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1445038_1445644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1445640_1446072_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1446074_1446449_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1446518_1447649_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1447660_1448170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1448181_1449438_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1449434_1450625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1450677_1451508_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1451482_1452994_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1453061_1454441_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1454443_1454941_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1455141_1455321_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1455330_1455480_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1455508_1455859_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1455859_1456456_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1456470_1456914_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1456965_1457439_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_032844502.1|1457428_1457998_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	82.5	3.1e-81
WP_032844503.1|1458188_1458494_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	56.0	1.8e-19
WP_032844505.1|1458504_1458825_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	58.9	1.5e-24
WP_032844506.1|1459125_1459656_+	antirepressor	NA	D0UIM5	Aggregatibacter_phage	50.3	3.5e-42
WP_032844507.1|1459811_1460240_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	7.8e-37
WP_006252693.1|1460226_1460439_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	86.8	5.8e-33
WP_006250086.1|1460529_1461066_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_032844508.1|1461062_1461710_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	95.3	9.2e-114
WP_032844512.1|1461709_1461994_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	95.7	4.2e-47
WP_006252350.1|1462491_1463331_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1463393_1463837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1463885_1464080_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1464176_1464836_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1464835_1465675_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1465691_1466519_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252943.1|1466549_1467377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252944.1|1467535_1467832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252945.1|1468295_1468547_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	81.5	1.6e-29
WP_006248787.1|1468549_1468825_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1469502_1470018_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_147010271.1|1470337_1471033_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	59.3	1.6e-47
WP_020824128.1|1471139_1471646_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006250254.1|1471649_1472009_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|1472005_1472485_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1472618_1472831_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1472843_1473767_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1473759_1474422_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|1474462_1475308_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|1475335_1475788_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_147010273.1|1475832_1476336_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	99.4	1.1e-82
WP_061888593.1|1477030_1477867_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1478252_1479095_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1479610_1479994_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1480043_1480265_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1480286_1481327_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1481479:1481498	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	1634634	1684002	2590632	tRNA,transposase,protease	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1634634_1635675_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1636000_1636399_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1636485_1639212_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1639270_1639591_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1639711_1640014_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1640038_1640413_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1640769_1641081_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1641172_1641760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1642085_1642376_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1642435_1643167_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1643166_1643727_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1643726_1644152_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1644198_1645251_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1645635_1647003_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1647046_1647715_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1649802_1650720_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1650716_1651064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1651736_1652387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1652376_1652715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1653411_1653615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1653626_1653875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1654309_1654495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1655054_1655273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1655876_1657073_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1657179_1658154_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1658221_1658929_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1658973_1660425_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1660539_1661400_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1661906_1663205_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1663378_1664266_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1664268_1665492_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1665682_1666333_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1666389_1666719_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1667885_1670453_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1670393_1670576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251668.1|1670666_1671809_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_006251672.1|1673413_1674313_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1674326_1675229_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1675225_1675582_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1675651_1676257_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1676330_1678238_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1678541_1679720_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1679798_1680839_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1681054_1681477_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1682961_1684002_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	1925381	1968093	2590632	transposase,terminase,integrase,protease,holin,tail,portal	Mannheimia_phage(57.78%)	60	1926495:1926510	1966708:1966723
WP_020824044.1|1925381_1926422_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
1926495:1926510	attL	AAACGTTCCGAAAAAA	NA	NA	NA	NA
WP_006247812.1|1926691_1926985_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|1927128_1927518_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1927489_1927789_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|1927861_1928902_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824196.1|1930106_1930697_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_020824197.1|1930965_1931697_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1931700_1932417_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1932416_1932746_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1932745_1936297_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1936350_1936578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1936640_1936871_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1936915_1937317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1937399_1938041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1938068_1938461_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1938457_1938982_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1938985_1939288_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1939280_1939604_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1939856_1941818_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1942221_1943418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1943421_1944933_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1944932_1945157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1945153_1947265_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1947264_1947744_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1948013_1948163_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1948212_1948542_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1948542_1949136_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1949125_1949470_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1949817_1950003_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1950511_1950706_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1950673_1951114_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1951103_1951463_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1951455_1952484_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1952610_1953204_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1953214_1954261_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1954257_1955097_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1955272_1955533_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1955553_1955754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1955884_1956568_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1956642_1957023_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1957015_1957513_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1957643_1957826_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1957864_1958284_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1958350_1958656_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1958664_1958940_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1959229_1959460_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1959938_1960262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1960454_1960640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1960793_1961252_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1961287_1961647_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1961718_1962522_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1962573_1963008_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1963017_1963506_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|1963526_1963736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1963882_1964008_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|1964054_1964897_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|1964959_1965343_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|1965392_1965668_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|1965627_1966683_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|1966830_1968093_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
1966708:1966723	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017485	Mannheimia haemolytica strain 39409 chromosome, complete genome	2590632	2233566	2335497	2590632	transposase,terminase,integrase,holin,tRNA,tail	Mannheimia_phage(86.42%)	120	2273600:2273616	2333282:2333298
WP_020824044.1|2233566_2234607_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2234726_2234957_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2235143_2235821_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2236014_2236287_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2236295_2236421_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2236600_2237374_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2237456_2238173_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2238182_2238935_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2239150_2239684_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2239592_2239814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2239789_2240131_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2240154_2240904_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2240913_2241864_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2242009_2243029_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2243109_2243865_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2243851_2244496_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2244499_2244721_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2244831_2246469_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2246542_2247508_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2247680_2248328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2248518_2249307_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2249603_2250557_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2251332_2254890_+	collagen-like protein	NA	NA	NA	NA	NA
WP_147010288.1|2254924_2255965_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	1.5e-198
WP_006252223.1|2256203_2257946_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2258161_2258419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2258925_2259156_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2260076_2260415_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2260672_2262571_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2262712_2263015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2263180_2264320_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2264607_2266116_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2266178_2266400_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2266421_2266868_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2266852_2267449_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2267557_2268892_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2269002_2270151_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2270280_2270628_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2270627_2271485_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2271593_2272556_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2273600:2273616	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2273665_2274163_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2274210_2275572_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2275763_2276315_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2277223_2278288_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2278472_2279132_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2279267_2280185_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2280398_2281277_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2281342_2281933_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2282063_2282906_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2283190_2283484_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2283599_2284199_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2284199_2284643_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2290509_2291100_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2291368_2292100_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2292103_2292820_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2292827_2293274_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2293295_2293625_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2293628_2296124_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2296210_2296606_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2296673_2297132_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2297300_2297534_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2297548_2298220_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2298316_2298493_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2298548_2298965_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2299004_2299487_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2299490_2299871_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2299867_2300236_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2300237_2300582_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2300581_2300959_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_062627922.1|2301278_2302265_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2302279_2302714_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2302706_2304077_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2304063_2305002_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2304955_2306332_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2306328_2307549_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2307532_2308057_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2308423_2308681_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2308681_2308822_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2308850_2309201_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2309201_2309795_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2309784_2310129_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2310247_2310826_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2311342_2311537_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2311504_2311870_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2311859_2312228_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2312224_2312509_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2312885_2313098_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2313147_2313600_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2313718_2314291_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2314287_2314935_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2314934_2315219_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2315704_2315947_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2316103_2316337_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2316465_2317152_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2317165_2317546_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2317538_2318036_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2318617_2318887_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2318864_2319137_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2319804_2320311_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2320314_2320674_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2320670_2321150_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2321283_2321496_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2321508_2322432_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2322424_2323087_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2323127_2323973_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2324000_2324453_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2324497_2324989_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2324985_2325189_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2325172_2325637_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2325640_2325829_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2325960_2326338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2326567_2327407_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2327654_2328332_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2328565_2329471_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2330707_2331304_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2331281_2331788_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2331877_2332153_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2332112_2333168_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2333419_2334373_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2333282:2333298	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824074.1|2334456_2335497_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
