The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	732867	831394	2591845	transposase,plate,integrase,tRNA,protease,head,tail,terminase	Mannheimia_phage(61.67%)	105	775640:775655	795459:795474
WP_147009073.1|732867_733908_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|734031_734592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|734572_736504_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|736646_736829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|736978_738019_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|738018_738492_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|738481_739690_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|739952_741185_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|741251_742238_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|742278_742689_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|742754_744065_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|744479_745199_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|745375_745654_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|747580_748462_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|748472_748721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|748730_749051_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|749053_749245_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|749257_749875_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|750193_750406_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|750411_750594_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|750616_751192_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|751204_751573_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|751814_752369_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|752352_752775_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|753130_753730_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|753740_753947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|754039_754930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|755057_755489_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|755574_756108_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|756110_756353_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|756349_756709_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|756871_757129_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|757128_757383_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|757390_757891_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|758040_759666_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|759734_761408_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|761394_762684_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|762831_763248_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|763244_763463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|763506_764574_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|764573_765491_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|765536_765854_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|765853_766279_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|766275_766917_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|766917_767097_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|767096_768506_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|768516_768891_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|768890_769259_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|769288_769477_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|769529_771809_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|771808_773101_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006251299.1|774982_775633_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
775640:775655	attL	CAAGCGGTTATTTTTT	NA	NA	NA	NA
WP_020831216.1|775741_776092_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|776104_777166_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|777165_777732_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|777732_780459_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|780459_781083_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|781075_781540_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|781660_782449_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
WP_006248925.1|783033_783798_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006253291.1|783840_784557_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015484309.1|786157_787849_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_021280009.1|789117_789882_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_006250605.1|789924_790452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250609.1|792021_792603_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006250610.1|792727_793765_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_020831228.1|793890_794622_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.6	4.0e-41
WP_020831229.1|794710_795391_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_006250537.1|795482_796118_-	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	47.1	7.1e-10
795459:795474	attR	AAAAAATAACCGCTTG	NA	NA	NA	NA
WP_006250538.1|796284_798720_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_006250539.1|798824_799388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831234.1|799585_800485_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249954.1|800620_800962_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_006249955.1|800972_801326_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_005719747.1|801385_802024_+	YkgB family protein	NA	NA	NA	NA	NA
WP_020831235.1|802158_803340_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_142777999.1|803431_804925_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_132303665.1|804913_805108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253708.1|805125_806973_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_095578366.1|807106_807442_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	55.9	2.0e-27
WP_147009452.1|807485_808151_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.8	6.7e-51
WP_061888598.1|808356_808905_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006253077.1|808982_810821_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_006249239.1|810825_811101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249240.1|811225_811579_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006249241.1|811687_811885_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075270716.1|812148_812691_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.4	1.5e-16
WP_006249243.1|812849_814649_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.3e-82
WP_006249244.1|814757_815063_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_006249245.1|815073_815865_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_006249246.1|815946_816978_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.8	3.4e-110
WP_006253082.1|817050_817830_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006250557.1|817970_818948_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	28.5	3.7e-05
WP_006250558.1|819027_819150_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_020831243.1|819325_819610_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_006250560.1|819789_820731_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.8	2.0e-53
WP_006249250.1|820826_821714_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006253083.1|821983_823210_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_006250564.1|823266_824643_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006250565.1|824697_826287_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	4.5e-77
WP_006249255.1|826458_826728_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006250566.1|826814_828260_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_020831247.1|828356_828833_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_020831248.1|828889_829306_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	36.6	1.4e-11
WP_006250569.1|829315_831394_-|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	29.3	2.8e-55
>prophage 2
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	1036462	1043247	2591845		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|1036462_1037245_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1037254_1037983_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1038118_1039138_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1039139_1039742_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1039870_1040026_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1040103_1040685_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1040699_1041347_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1041450_1042080_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1042194_1043247_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	1352658	1428077	2591845	transposase,plate,integrase,tRNA,capsid,portal,holin,head,tail,terminase	Mannheimia_phage(84.21%)	81	1355075:1355091	1397102:1397118
WP_006252789.1|1352658_1355046_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1355075:1355091	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1355093_1356080_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1356308_1356968_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1358452_1359205_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1359204_1360104_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1360112_1360676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1360675_1361452_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1361551_1361947_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1361963_1362392_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1362690_1363086_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1363246_1364818_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1364834_1365146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1365267_1365939_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1366059_1367523_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1367750_1370918_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1370931_1372137_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1372167_1372740_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1372978_1373200_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1373204_1374938_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1375649_1376030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1376071_1380532_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1380707_1381424_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1381472_1382816_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1383073_1383961_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1384096_1384282_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1384371_1386999_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1387193_1387619_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1387849_1388623_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1388766_1389558_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1389610_1389907_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1389931_1390210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1390369_1392346_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1392437_1393250_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1393617_1394616_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1394893_1395076_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1395345_1395636_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_142778027.1|1395610_1395880_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	98.9	7.1e-44
WP_006248157.1|1395869_1396202_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1396212_1396665_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1396664_1396997_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1397009_1399370_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1397102:1397118	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1399366_1399699_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1399695_1399938_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1400088_1400382_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1400390_1400723_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1400805_1401078_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1401217_1401463_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1401561_1401774_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1401897_1402584_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1402587_1403106_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1403123_1403534_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1403645_1404686_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888663.1|1405733_1406171_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1406170_1406557_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1406617_1406758_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1406757_1407072_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1407152_1407659_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1407667_1408849_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1408950_1409214_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1409182_1409818_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1409818_1412833_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1412835_1413375_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1413361_1414279_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1414275_1414611_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1414610_1415216_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1415344_1415632_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_061888618.1|1415865_1418778_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1418816_1419095_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1419145_1419604_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1419596_1420082_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1420078_1420300_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1420448_1420904_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1420900_1421467_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1421459_1421666_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1421671_1421884_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1421880_1422396_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1422507_1423197_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_147009074.1|1423206_1424235_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	99.7	7.8e-192
WP_006252839.1|1424248_1425076_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1425189_1427028_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1427036_1428077_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	1460127	1512709	2591845	holin,head,terminase,integrase	Mannheimia_phage(45.28%)	70	1462702:1462721	1512861:1512880
WP_006252023.1|1460127_1460592_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1460584_1461208_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009075.1|1461208_1464148_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	93.7	0.0e+00
1462702:1462721	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1464220_1464841_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1464837_1466034_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1466030_1466381_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1466384_1467047_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1467036_1467924_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1467923_1468220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1468222_1468930_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1469164_1470061_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1470345_1470525_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1470676_1471348_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1471370_1472033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1472032_1474702_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1474874_1475279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1475346_1475868_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1476002_1476446_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1476503_1477982_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1477997_1478504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1478488_1478869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1478876_1479581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1479583_1480189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1480185_1480617_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1480619_1480994_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1481063_1482194_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1482205_1482715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1482726_1483983_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1483979_1485170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1485222_1486053_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1486027_1487539_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1487606_1488986_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1488988_1489486_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1489686_1489866_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1489875_1490025_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1490053_1490404_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1490404_1491001_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1491015_1491459_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1491510_1491984_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1491973_1492543_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1492615_1493077_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1493097_1493670_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1493680_1494727_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1494723_1495563_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1495625_1496069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1496117_1496312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1496408_1497068_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1497067_1497907_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1497923_1498751_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_142778103.1|1498766_1499144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1499149_1499608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1499764_1500061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1500526_1500778_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1500780_1501056_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1501732_1502248_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1502514_1503225_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_020824128.1|1503331_1503838_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006252960.1|1503841_1504201_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_006250951.1|1504197_1504677_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1504810_1505023_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1505035_1505959_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1505951_1506614_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1506654_1506921_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1506948_1507401_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1507499_1507718_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1508412_1509249_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1509634_1510477_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1510992_1511376_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1511425_1511647_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1511668_1512709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1512861:1512880	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	1665961	1715314	2591845	transposase,tRNA,protease	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1665961_1667002_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1667327_1667726_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1667812_1670539_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1670597_1670918_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1671038_1671341_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1671365_1671740_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1672096_1672408_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1672499_1673087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1673412_1673703_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1673762_1674494_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1674493_1675054_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1675053_1675479_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1675525_1676578_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1676962_1678330_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1678373_1679042_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1681129_1682047_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1682043_1682391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1683063_1683714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1683703_1684042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1684738_1684942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1684953_1685202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1685636_1685822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1686381_1686600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1687203_1688400_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1688506_1689481_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1689548_1690256_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1690300_1691752_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1691866_1692727_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1693233_1694532_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1694705_1695593_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1695595_1696819_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1697009_1697660_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1697716_1698046_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1699212_1701780_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1701720_1701903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009077.1|1701993_1703127_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.6	3.0e-160
WP_006251672.1|1704740_1705640_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1705653_1706556_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1706552_1706909_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1706978_1707584_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1707657_1709565_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1709853_1711032_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1711110_1712151_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1712366_1712789_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1714273_1715314_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	1956827	2005742	2591845	transposase,integrase,protease,portal,holin,tail,terminase	Mannheimia_phage(58.7%)	61	1959220:1959235	2004357:2004372
WP_020824044.1|1956827_1957868_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247810.1|1957940_1958240_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1958211_1958601_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1958744_1959038_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
1959220:1959235	attL	TTTTTTCGGAACGTTT	NA	NA	NA	NA
WP_020824044.1|1959307_1960348_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_147009079.1|1960619_1967753_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_061887268.1|1967755_1968346_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.9	4.0e-100
WP_020824197.1|1968614_1969346_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1969349_1970066_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1970065_1970395_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1970394_1973946_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1973999_1974227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1974289_1974520_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1974564_1974966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1975048_1975690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1975717_1976110_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1976106_1976631_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1976634_1976937_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1976929_1977253_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1977505_1979467_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1979870_1981067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1981070_1982582_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1982581_1982806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1982802_1984914_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1984913_1985393_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1985662_1985812_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1985861_1986191_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1986191_1986785_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1986774_1987119_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1987466_1987652_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1988160_1988355_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1988322_1988763_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1988752_1989112_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1989104_1990133_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1990259_1990853_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1990863_1991910_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1991906_1992746_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1992921_1993182_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1993202_1993403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1993533_1994217_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1994291_1994672_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1994664_1995162_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1995292_1995475_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1995513_1995933_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1995999_1996305_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1996313_1996589_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1996878_1997109_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1997587_1997911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1998103_1998289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1998442_1998901_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1998936_1999296_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1999367_2000171_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|2000222_2000657_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|2000666_2001155_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|2001175_2001385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|2001531_2001657_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|2001703_2002546_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|2002608_2002992_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|2003041_2003317_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2003276_2004332_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|2004479_2005742_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
2004357:2004372	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017492	Mannheimia haemolytica strain 38202 chromosome, complete genome	2591845	2271215	2373065	2591845	transposase,integrase,tRNA,holin,tail,terminase	Mannheimia_phage(86.59%)	121	2311249:2311265	2370850:2370866
WP_020824044.1|2271215_2272256_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2272375_2272606_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2272792_2273470_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2273663_2273936_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2273944_2274070_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2274249_2275023_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2275105_2275822_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2275831_2276584_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2276799_2277333_-	YggT family protein	NA	NA	NA	NA	NA
WP_134916390.1|2277241_2277466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2277438_2277780_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2277803_2278553_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2278562_2279513_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2279658_2280678_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2280758_2281514_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2281500_2282145_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2282148_2282370_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2282480_2284118_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2284191_2285157_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2285329_2285977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2286167_2286956_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2287252_2288206_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2288981_2292539_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2292573_2293614_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2293852_2295595_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2295810_2296068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2296574_2296805_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2297725_2298064_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2298321_2300220_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2300361_2300664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2300829_2301969_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2302256_2303765_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2303827_2304049_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2304070_2304517_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2304501_2305098_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2305206_2306541_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2306651_2307800_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2307929_2308277_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2308276_2309134_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2309242_2310205_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2311249:2311265	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2311314_2311812_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2311859_2313221_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2313412_2313964_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2314872_2315937_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2316121_2316781_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2316916_2317834_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2318047_2318926_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2318991_2319582_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2319712_2320555_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2320839_2321133_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2321248_2321848_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2321848_2322292_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2328158_2328749_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2329017_2329749_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2329752_2330469_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2330476_2330923_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2330944_2331274_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2331277_2333773_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2333859_2334255_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2334322_2334781_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2334949_2335183_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2335197_2335869_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2335965_2336142_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2336197_2336614_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2336653_2337136_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2337139_2337520_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2337516_2337885_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2337886_2338231_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2338230_2338608_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_021265457.1|2338610_2338835_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.1e-21
WP_062627922.1|2338846_2339833_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2339847_2340282_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2340274_2341645_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2341631_2342570_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2342523_2343900_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2343896_2345117_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2345100_2345625_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2345991_2346249_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2346249_2346390_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2346418_2346769_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2346769_2347363_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2347352_2347697_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2347815_2348394_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2348910_2349105_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2349072_2349438_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2349427_2349796_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2349792_2350077_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2350453_2350666_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2350715_2351168_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2351286_2351859_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2351855_2352503_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2352502_2352787_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2353272_2353515_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2353671_2353905_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2354033_2354720_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2354733_2355114_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2355106_2355604_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2356185_2356455_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2356432_2356705_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2357372_2357879_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2357882_2358242_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2358238_2358718_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2358851_2359064_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2359076_2360000_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2359992_2360655_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2360695_2361541_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2361568_2362021_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2362065_2362557_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2362553_2362757_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2362740_2363205_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2363208_2363397_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2363528_2363906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2364135_2364975_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2365222_2365900_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2366133_2367039_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2368275_2368872_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2368849_2369356_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2369445_2369721_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2369680_2370736_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2370987_2371941_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2370850:2370866	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824044.1|2372024_2373065_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
