The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	732865	783046	2591109	terminase,plate,transposase,head,integrase,tail	Mannheimia_phage(79.17%)	61	781865:781924	787949:788364
WP_147009073.1|732865_733906_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|734029_734590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|734570_736502_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|736644_736827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|736976_738017_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|738016_738490_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|738479_739688_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|739950_741183_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|741249_742236_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|742276_742687_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|742752_744063_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|744477_745197_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|745373_745652_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|747578_748460_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|748470_748719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|748728_749049_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|749051_749243_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|749255_749873_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|750191_750404_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|750409_750592_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|750614_751190_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|751202_751571_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|751812_752367_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|752350_752773_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|753128_753728_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|753738_753945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|754037_754928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|755055_755487_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|755572_756106_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|756108_756351_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|756347_756707_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|756869_757127_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|757126_757381_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|757388_757889_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|758038_759664_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|759732_761406_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|761392_762682_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|762829_763246_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|763242_763461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|763504_764572_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|764571_765489_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|765534_765852_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|765851_766277_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|766273_766915_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|766915_767095_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|767094_768504_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|768514_768889_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|768888_769257_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|769286_769475_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|769527_771807_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|771806_773099_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|773101_774229_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|774230_774881_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|774989_775340_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|775352_776414_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|776413_776980_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|776980_779707_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|779707_780331_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|780323_780788_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|780908_781697_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
781865:781924	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|782281_783046_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|782281_783046_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
787949:788364	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	1035710	1042495	2591109		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|1035710_1036493_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1036502_1037231_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1037366_1038386_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1038387_1038990_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1039118_1039274_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1039351_1039933_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1039947_1040595_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1040698_1041328_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1041442_1042495_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	1351913	1427332	2591109	tRNA,portal,holin,terminase,plate,transposase,head,capsid,integrase,tail	Mannheimia_phage(84.21%)	81	1354330:1354346	1396357:1396373
WP_006252789.1|1351913_1354301_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1354330:1354346	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1354348_1355335_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1355563_1356223_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1357707_1358460_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1358459_1359359_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1359367_1359931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1359930_1360707_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1360806_1361202_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1361218_1361647_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1361945_1362341_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1362501_1364073_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1364089_1364401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1364522_1365194_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1365314_1366778_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1367005_1370173_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1370186_1371392_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1371422_1371995_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1372233_1372455_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1372459_1374193_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1374904_1375285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1375326_1379787_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1379962_1380679_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1380727_1382071_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1382328_1383216_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1383351_1383537_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1383626_1386254_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1386448_1386874_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1387104_1387878_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1388021_1388813_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1388865_1389162_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1389186_1389465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1389624_1391601_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1391692_1392505_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1392872_1393871_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1394148_1394331_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1394600_1394891_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_142778027.1|1394865_1395135_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	98.9	7.1e-44
WP_006248157.1|1395124_1395457_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1395467_1395920_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1395919_1396252_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1396264_1398625_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1396357:1396373	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1398621_1398954_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1398950_1399193_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1399343_1399637_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1399645_1399978_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1400060_1400333_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1400472_1400718_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1400816_1401029_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1401152_1401839_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1401842_1402361_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1402378_1402789_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1402900_1403941_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888663.1|1404988_1405426_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1405425_1405812_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1405872_1406013_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1406012_1406327_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1406407_1406914_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1406922_1408104_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1408205_1408469_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1408437_1409073_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1409073_1412088_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1412090_1412630_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1412616_1413534_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1413530_1413866_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1413865_1414471_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1414599_1414887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_061888618.1|1415120_1418033_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1418071_1418350_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1418400_1418859_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1418851_1419337_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1419333_1419555_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1419703_1420159_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1420155_1420722_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1420714_1420921_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1420926_1421139_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1421135_1421651_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1421762_1422452_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_147009074.1|1422461_1423490_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	99.7	7.8e-192
WP_006252839.1|1423503_1424331_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1424444_1426283_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1426291_1427332_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	1459382	1511964	2591109	head,terminase,integrase,holin	Mannheimia_phage(45.28%)	70	1461957:1461976	1512116:1512135
WP_006252023.1|1459382_1459847_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1459839_1460463_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009075.1|1460463_1463403_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	93.7	0.0e+00
1461957:1461976	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1463475_1464096_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1464092_1465289_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1465285_1465636_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1465639_1466302_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1466291_1467179_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1467178_1467475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1467477_1468185_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1468419_1469316_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1469600_1469780_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1469931_1470603_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1470625_1471288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1471287_1473957_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1474129_1474534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1474601_1475123_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1475257_1475701_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1475758_1477237_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1477252_1477759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1477743_1478124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1478131_1478836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1478838_1479444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1479440_1479872_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1479874_1480249_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1480318_1481449_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1481460_1481970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1481981_1483238_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1483234_1484425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1484477_1485308_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1485282_1486794_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1486861_1488241_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1488243_1488741_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1488941_1489121_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1489130_1489280_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1489308_1489659_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1489659_1490256_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1490270_1490714_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1490765_1491239_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1491228_1491798_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1491870_1492332_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1492352_1492925_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1492935_1493982_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1493978_1494818_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1494880_1495324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1495372_1495567_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1495663_1496323_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1496322_1497162_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1497178_1498006_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_142778103.1|1498021_1498399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1498404_1498863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1499019_1499316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1499781_1500033_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1500035_1500311_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1500987_1501503_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1501769_1502480_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_020824128.1|1502586_1503093_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006252960.1|1503096_1503456_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_006250951.1|1503452_1503932_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1504065_1504278_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1504290_1505214_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1505206_1505869_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1505909_1506176_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1506203_1506656_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1506754_1506973_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1507667_1508504_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1508889_1509732_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1510247_1510631_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1510680_1510902_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1510923_1511964_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1512116:1512135	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	1665216	1714569	2591109	protease,tRNA,transposase	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1665216_1666257_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1666582_1666981_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1667067_1669794_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1669852_1670173_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1670293_1670596_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1670620_1670995_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1671351_1671663_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1671754_1672342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1672667_1672958_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1673017_1673749_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1673748_1674309_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1674308_1674734_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1674780_1675833_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1676217_1677585_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1677628_1678297_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1680384_1681302_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1681298_1681646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1682318_1682969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1682958_1683297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1683993_1684197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1684208_1684457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1684891_1685077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1685636_1685855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1686458_1687655_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1687761_1688736_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1688803_1689511_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1689555_1691007_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1691121_1691982_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1692488_1693787_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1693960_1694848_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1694850_1696074_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1696264_1696915_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1696971_1697301_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1698467_1701035_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1700975_1701158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009077.1|1701248_1702382_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.6	3.0e-160
WP_006251672.1|1703995_1704895_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1704908_1705811_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1705807_1706164_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1706233_1706839_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1706912_1708820_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1709108_1710287_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1710365_1711406_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1711621_1712044_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1713528_1714569_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	1956083	2004998	2591109	portal,holin,terminase,transposase,protease,integrase,tail	Mannheimia_phage(58.7%)	61	1957197:1957212	2003613:2003628
WP_020824044.1|1956083_1957124_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
1957197:1957212	attL	AAACGTTCCGAAAAAA	NA	NA	NA	NA
WP_006247812.1|1957393_1957687_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|1957830_1958220_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1958191_1958491_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|1958563_1959604_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_147009079.1|1959875_1967009_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_061887268.1|1967011_1967602_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.9	4.0e-100
WP_020824197.1|1967870_1968602_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1968605_1969322_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1969321_1969651_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1969650_1973202_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1973255_1973483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1973545_1973776_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1973820_1974222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1974304_1974946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1974973_1975366_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1975362_1975887_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1975890_1976193_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1976185_1976509_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1976761_1978723_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1979126_1980323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1980326_1981838_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1981837_1982062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1982058_1984170_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1984169_1984649_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1984918_1985068_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1985117_1985447_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1985447_1986041_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1986030_1986375_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1986722_1986908_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1987416_1987611_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1987578_1988019_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1988008_1988368_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1988360_1989389_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1989515_1990109_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1990119_1991166_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1991162_1992002_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1992177_1992438_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1992458_1992659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1992789_1993473_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1993547_1993928_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1993920_1994418_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1994548_1994731_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1994769_1995189_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1995255_1995561_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1995569_1995845_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1996134_1996365_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1996843_1997167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1997359_1997545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1997698_1998157_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1998192_1998552_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1998623_1999427_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1999478_1999913_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1999922_2000411_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|2000431_2000641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|2000787_2000913_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|2000959_2001802_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|2001864_2002248_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|2002297_2002573_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2002532_2003588_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|2003735_2004998_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
2003613:2003628	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017493	Mannheimia haemolytica strain 38120 chromosome, complete genome	2591109	2270471	2372321	2591109	tRNA,holin,terminase,transposase,integrase,tail	Mannheimia_phage(86.59%)	121	2310505:2310521	2370106:2370122
WP_020824044.1|2270471_2271512_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2271631_2271862_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2272048_2272726_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2272919_2273192_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2273200_2273326_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2273505_2274279_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2274361_2275078_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2275087_2275840_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2276055_2276589_-	YggT family protein	NA	NA	NA	NA	NA
WP_134916390.1|2276497_2276722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2276694_2277036_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2277059_2277809_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2277818_2278769_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2278914_2279934_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2280014_2280770_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2280756_2281401_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2281404_2281626_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2281736_2283374_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2283447_2284413_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2284585_2285233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2285423_2286212_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2286508_2287462_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2288237_2291795_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2291829_2292870_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2293108_2294851_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2295066_2295324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2295830_2296061_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2296981_2297320_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2297577_2299476_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2299617_2299920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2300085_2301225_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2301512_2303021_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2303083_2303305_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2303326_2303773_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2303757_2304354_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2304462_2305797_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2305907_2307056_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2307185_2307533_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2307532_2308390_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2308498_2309461_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2310505:2310521	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2310570_2311068_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2311115_2312477_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2312668_2313220_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2314128_2315193_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2315377_2316037_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2316172_2317090_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2317303_2318182_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2318247_2318838_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2318968_2319811_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2320095_2320389_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2320504_2321104_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2321104_2321548_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2327414_2328005_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2328273_2329005_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2329008_2329725_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2329732_2330179_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2330200_2330530_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2330533_2333029_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2333115_2333511_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2333578_2334037_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2334205_2334439_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2334453_2335125_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2335221_2335398_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2335453_2335870_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2335909_2336392_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2336395_2336776_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2336772_2337141_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2337142_2337487_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2337486_2337864_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_021265457.1|2337866_2338091_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.1e-21
WP_062627922.1|2338102_2339089_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2339103_2339538_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2339530_2340901_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2340887_2341826_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2341779_2343156_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2343152_2344373_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2344356_2344881_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2345247_2345505_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2345505_2345646_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2345674_2346025_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2346025_2346619_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2346608_2346953_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2347071_2347650_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2348166_2348361_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2348328_2348694_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2348683_2349052_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2349048_2349333_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2349709_2349922_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2349971_2350424_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2350542_2351115_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2351111_2351759_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2351758_2352043_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2352528_2352771_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2352927_2353161_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2353289_2353976_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2353989_2354370_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2354362_2354860_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2355441_2355711_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2355688_2355961_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2356628_2357135_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2357138_2357498_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2357494_2357974_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2358107_2358320_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2358332_2359256_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2359248_2359911_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2359951_2360797_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2360824_2361277_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2361321_2361813_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2361809_2362013_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2361996_2362461_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2362464_2362653_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2362784_2363162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2363391_2364231_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2364478_2365156_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2365389_2366295_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2367531_2368128_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2368105_2368612_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2368701_2368977_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2368936_2369992_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2370243_2371197_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2370106:2370122	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824044.1|2371280_2372321_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
