The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	732866	783797	2591838	transposase,tail,terminase,integrase,head,plate	Mannheimia_phage(78.72%)	60	782616:782675	788700:789115
WP_147009073.1|732866_733907_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|734030_734591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|734571_736503_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|736645_736828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|736977_738018_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|738017_738491_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|738480_739689_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|739951_741184_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|741250_742237_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|742277_742688_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|742753_744064_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|744478_745198_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|745374_745653_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|747579_748461_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|748471_748720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|748729_749050_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|749052_749244_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|749256_749874_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|750192_750405_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|750410_750593_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|750615_751191_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|751203_751572_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|751813_752368_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|752351_752774_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|753129_753729_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|753739_753946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|754038_754929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|755056_755488_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|755573_756107_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|756109_756352_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|756348_756708_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|756870_757128_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|757127_757382_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|757389_757890_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|758039_759665_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|759733_761407_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|761393_762683_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|762830_763247_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|763243_763462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|763505_764573_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|764572_765490_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|765535_765853_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|765852_766278_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|766274_766916_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|766916_767096_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|767095_768505_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|768515_768890_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|768889_769258_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|769287_769476_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|769528_771808_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|771807_773100_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006251299.1|774981_775632_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|775740_776091_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|776103_777165_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|777164_777731_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|777731_780458_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|780458_781082_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|781074_781539_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|781659_782448_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
782616:782675	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|783032_783797_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|783032_783797_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
788700:789115	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	1036460	1043245	2591838		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|1036460_1037243_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1037252_1037981_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1038116_1039136_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1039137_1039740_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1039868_1040024_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1040101_1040683_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1040697_1041345_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1041448_1042078_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1042192_1043245_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	1352656	1428075	2591838	tRNA,capsid,portal,transposase,tail,integrase,holin,terminase,head,plate	Mannheimia_phage(84.48%)	82	1355073:1355089	1397100:1397116
WP_006252789.1|1352656_1355044_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1355073:1355089	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1355091_1356078_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1356306_1356966_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1358450_1359203_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1359202_1360102_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1360110_1360674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1360673_1361450_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1361549_1361945_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1361961_1362390_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1362688_1363084_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1363244_1364816_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1364832_1365144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1365265_1365937_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1366057_1367521_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1367748_1370916_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1370929_1372135_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1372165_1372738_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1372976_1373198_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1373202_1374936_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1375647_1376028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1376069_1380530_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1380705_1381422_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1381470_1382814_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1383071_1383959_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1384094_1384280_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1384369_1386997_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1387191_1387617_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1387847_1388621_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1388764_1389556_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1389608_1389905_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1389929_1390208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1390367_1392344_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1392435_1393248_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1393615_1394614_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1394891_1395074_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1395343_1395634_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_142778027.1|1395608_1395878_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	98.9	7.1e-44
WP_006248157.1|1395867_1396200_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1396210_1396663_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1396662_1396995_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1397007_1399368_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1397100:1397116	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1399364_1399697_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1399693_1399936_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1400086_1400380_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1400388_1400721_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1400803_1401076_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1401215_1401461_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1401559_1401772_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1401895_1402582_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1402585_1403104_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1403121_1403532_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1403643_1404684_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888663.1|1405731_1406169_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1406168_1406555_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1406615_1406756_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1406755_1407070_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1407150_1407657_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1407665_1408847_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1408948_1409212_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1409180_1409816_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1409816_1412831_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1412833_1413373_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1413359_1414277_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1414273_1414609_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1414608_1415214_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1415342_1415630_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_006250778.1|1415622_1415802_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_061888618.1|1415863_1418776_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1418814_1419093_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1419143_1419602_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1419594_1420080_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1420076_1420298_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1420446_1420902_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1420898_1421465_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1421457_1421664_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1421669_1421882_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1421878_1422394_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1422505_1423195_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_147009074.1|1423204_1424233_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	99.7	7.8e-192
WP_006252839.1|1424246_1425074_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1425187_1427026_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1427034_1428075_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	1460125	1512707	2591838	head,terminase,holin,integrase	Mannheimia_phage(45.28%)	70	1462700:1462719	1512859:1512878
WP_006252023.1|1460125_1460590_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1460582_1461206_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009075.1|1461206_1464146_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	93.7	0.0e+00
1462700:1462719	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1464218_1464839_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1464835_1466032_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1466028_1466379_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1466382_1467045_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1467034_1467922_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1467921_1468218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1468220_1468928_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1469162_1470059_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1470343_1470523_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1470674_1471346_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1471368_1472031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1472030_1474700_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1474872_1475277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1475344_1475866_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1476000_1476444_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1476501_1477980_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1477995_1478502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1478486_1478867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1478874_1479579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1479581_1480187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1480183_1480615_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1480617_1480992_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1481061_1482192_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1482203_1482713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1482724_1483981_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1483977_1485168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1485220_1486051_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1486025_1487537_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1487604_1488984_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1488986_1489484_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1489684_1489864_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1489873_1490023_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1490051_1490402_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1490402_1490999_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1491013_1491457_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1491508_1491982_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1491971_1492541_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1492613_1493075_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1493095_1493668_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1493678_1494725_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1494721_1495561_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1495623_1496067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1496115_1496310_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1496406_1497066_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1497065_1497905_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1497921_1498749_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_020824126.1|1498764_1499100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1499147_1499606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1499762_1500059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1500524_1500776_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1500778_1501054_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1501730_1502246_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1502512_1503223_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_020824128.1|1503329_1503836_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006252960.1|1503839_1504199_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_006250951.1|1504195_1504675_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1504808_1505021_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1505033_1505957_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1505949_1506612_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1506652_1506919_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1506946_1507399_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1507497_1507716_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1508410_1509247_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1509632_1510475_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1510990_1511374_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1511423_1511645_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1511666_1512707_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1512859:1512878	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	1665954	1715307	2591838	tRNA,protease,transposase	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1665954_1666995_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1667320_1667719_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1667805_1670532_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1670590_1670911_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1671031_1671334_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1671358_1671733_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1672089_1672401_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1672492_1673080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1673405_1673696_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1673755_1674487_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1674486_1675047_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1675046_1675472_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1675518_1676571_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1676955_1678323_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1678366_1679035_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1681122_1682040_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1682036_1682384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1683056_1683707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1683696_1684035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1684731_1684935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1684946_1685195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1685629_1685815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1686374_1686593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1687196_1688393_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1688499_1689474_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1689541_1690249_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1690293_1691745_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1691859_1692720_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1693226_1694525_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1694698_1695586_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1695588_1696812_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1697002_1697653_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1697709_1698039_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1699205_1701773_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1701713_1701896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009077.1|1701986_1703120_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.6	3.0e-160
WP_006251672.1|1704733_1705633_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1705646_1706549_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1706545_1706902_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1706971_1707577_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1707650_1709558_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1709846_1711025_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1711103_1712144_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1712359_1712782_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1714266_1715307_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	1956820	2005735	2591838	portal,transposase,tail,terminase,holin,integrase,protease	Mannheimia_phage(58.7%)	61	1959213:1959228	2004350:2004365
WP_020824044.1|1956820_1957861_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247810.1|1957933_1958233_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1958204_1958594_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1958737_1959031_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
1959213:1959228	attL	TTTTTTCGGAACGTTT	NA	NA	NA	NA
WP_020824044.1|1959300_1960341_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_147009079.1|1960612_1967746_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_061887268.1|1967748_1968339_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.9	4.0e-100
WP_020824197.1|1968607_1969339_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1969342_1970059_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1970058_1970388_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1970387_1973939_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1973992_1974220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1974282_1974513_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1974557_1974959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1975041_1975683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1975710_1976103_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1976099_1976624_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1976627_1976930_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1976922_1977246_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1977498_1979460_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1979863_1981060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1981063_1982575_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1982574_1982799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1982795_1984907_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1984906_1985386_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1985655_1985805_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1985854_1986184_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1986184_1986778_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1986767_1987112_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1987459_1987645_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1988153_1988348_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1988315_1988756_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1988745_1989105_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1989097_1990126_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1990252_1990846_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1990856_1991903_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1991899_1992739_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1992914_1993175_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1993195_1993396_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1993526_1994210_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1994284_1994665_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1994657_1995155_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1995285_1995468_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1995506_1995926_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1995992_1996298_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1996306_1996582_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1996871_1997102_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1997580_1997904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1998096_1998282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1998435_1998894_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1998929_1999289_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1999360_2000164_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|2000215_2000650_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|2000659_2001148_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|2001168_2001378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|2001524_2001650_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|2001696_2002539_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|2002601_2002985_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|2003034_2003310_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2003269_2004325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|2004472_2005735_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
2004350:2004365	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017494	Mannheimia haemolytica strain 38089 chromosome, complete genome	2591838	2266015	2373058	2591838	tRNA,transposase,tail,terminase,holin,integrase	Mannheimia_phage(86.75%)	125	2311242:2311258	2370843:2370859
WP_020824074.1|2266015_2267056_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006251963.1|2267842_2268049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252627.1|2269243_2269567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251957.1|2269690_2269978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824044.1|2271208_2272249_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2272368_2272599_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2272785_2273463_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2273656_2273929_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2273937_2274063_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2274242_2275016_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2275098_2275815_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2275824_2276577_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2276792_2277326_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2277234_2277456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2277431_2277773_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2277796_2278546_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2278555_2279506_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2279651_2280671_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2280751_2281507_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2281493_2282138_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2282141_2282363_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2282473_2284111_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2284184_2285150_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2285322_2285970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2286160_2286949_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2287245_2288199_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2288974_2292532_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2292566_2293607_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2293845_2295588_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2295803_2296061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2296567_2296798_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2297718_2298057_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2298314_2300213_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2300354_2300657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2300822_2301962_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2302249_2303758_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2303820_2304042_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2304063_2304510_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2304494_2305091_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2305199_2306534_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2306644_2307793_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2307922_2308270_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2308269_2309127_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2309235_2310198_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2311242:2311258	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2311307_2311805_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2311852_2313214_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2313405_2313957_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2314865_2315930_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2316114_2316774_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2316909_2317827_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2318040_2318919_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2318984_2319575_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2319705_2320548_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2320832_2321126_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2321241_2321841_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2321841_2322285_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2328151_2328742_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2329010_2329742_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2329745_2330462_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2330469_2330916_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2330937_2331267_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2331270_2333766_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2333852_2334248_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2334315_2334774_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2334942_2335176_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2335190_2335862_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2335958_2336135_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2336190_2336607_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2336646_2337129_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2337132_2337513_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2337509_2337878_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2337879_2338224_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2338223_2338601_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_021265457.1|2338603_2338828_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.1e-21
WP_062627922.1|2338839_2339826_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2339840_2340275_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2340267_2341638_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2341624_2342563_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2342516_2343893_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2343889_2345110_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2345093_2345618_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2345984_2346242_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2346242_2346383_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2346411_2346762_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2346762_2347356_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2347345_2347690_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2347808_2348387_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2348903_2349098_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2349065_2349431_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2349420_2349789_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2349785_2350070_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2350446_2350659_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2350708_2351161_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2351279_2351852_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2351848_2352496_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2352495_2352780_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2353265_2353508_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2353664_2353898_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2354026_2354713_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2354726_2355107_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2355099_2355597_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2356178_2356448_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2356425_2356698_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2357365_2357872_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2357875_2358235_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2358231_2358711_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2358844_2359057_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2359069_2359993_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2359985_2360648_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2360688_2361534_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2361561_2362014_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2362058_2362550_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2362546_2362750_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2362733_2363198_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2363201_2363390_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2363521_2363899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2364128_2364968_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2365215_2365893_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2366126_2367032_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2368268_2368865_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2368842_2369349_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2369438_2369714_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2369673_2370729_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2370980_2371934_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2370843:2370859	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824044.1|2372017_2373058_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
