The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017499	Mannheimia haemolytica strain 33702 chromosome, complete genome	2512791	322158	393221	2512791	protease,tRNA,transposase	Mannheimia_phage(26.67%)	59	NA	NA
WP_020824074.1|322158_323199_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_032844699.1|324833_326012_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_006251742.1|326038_327091_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	2.3e-21
WP_020824074.1|327166_328207_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006251253.1|328345_328801_-	redoxin family protein	NA	NA	NA	NA	NA
WP_020830985.1|328830_329874_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006251250.1|330612_330795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251249.1|330853_331843_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.4	7.2e-17
WP_006251248.1|331970_332960_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-16
WP_006248479.1|332970_333864_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248481.1|333965_334970_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_020830984.1|335241_336843_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006251246.1|337112_337823_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_006251245.1|337966_338608_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4UU96	Bodo_saltans_virus	29.4	2.8e-06
WP_006248486.1|338604_339267_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_006248487.1|339466_340204_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_006248488.1|340218_340416_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_020830982.1|340601_341159_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_006248491.1|341155_343114_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_006248492.1|343160_343778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251242.1|343862_345029_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_006251241.1|345218_346946_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.5	7.5e-86
WP_015484031.1|346979_347579_+	VOC family protein	NA	NA	NA	NA	NA
WP_006248496.1|347599_348064_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_006251239.1|348094_348370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248499.1|348431_349382_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	28.3	7.4e-11
WP_006248501.1|349530_350103_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_006251238.1|350102_350975_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_006251237.1|351185_352589_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_020824044.1|358637_359678_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824277.1|359761_360715_-	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_006252247.1|360897_361740_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006252246.1|361870_362461_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252245.1|362526_363405_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252244.1|363618_364536_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006252243.1|364671_365331_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|365515_366580_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252239.1|367488_368040_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252238.1|368231_369593_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_006252237.1|369640_370138_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252234.1|371247_372210_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_006248541.1|372318_373176_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006248542.1|373175_373523_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_020824275.1|373652_374801_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_020824274.1|374911_376246_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_041447977.1|376354_376951_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_100067210.1|376935_377382_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_006248546.1|377403_377625_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_006248547.1|377687_379196_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248549.1|379483_380623_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.5	2.7e-23
WP_006252924.1|380788_381091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252227.1|381232_383131_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006248552.1|383388_383727_+	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_020824273.1|384647_384878_+	membrane protein	NA	NA	NA	NA	NA
WP_020824272.1|385384_385642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252223.1|385857_387600_+	autotransporter	NA	NA	NA	NA	NA
WP_020824074.1|387838_388879_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_147008981.1|388913_392471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008980.1|392570_393221_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017499	Mannheimia haemolytica strain 33702 chromosome, complete genome	2512791	660456	724726	2512791	tail,transposase,terminase,holin,integrase,protease,portal,tRNA	Mannheimia_phage(57.45%)	74	662453:662470	722837:722854
WP_006252121.1|660456_662388_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.8e-128
662453:662470	attL	CTACAAGCGGTCTTTTTT	NA	NA	NA	NA
WP_020824230.1|662554_663904_-	MFS transporter	NA	NA	NA	NA	NA
WP_006252126.1|664107_664674_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_006252127.1|664754_665513_+	biotin ligase	NA	NA	NA	NA	NA
WP_006252128.1|665503_666298_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_006252129.1|666358_667945_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_006252130.1|668130_669984_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006249901.1|670028_670841_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_006252131.1|671021_672056_+	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_006252132.1|672065_672950_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_006252133.1|673088_674066_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_006252134.1|674153_675185_+	methionine synthase	NA	NA	NA	NA	NA
WP_006249906.1|675272_675494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249908.1|675769_677032_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
WP_006251368.1|677179_678235_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824229.1|678194_678470_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_020824134.1|678519_678903_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824228.1|678965_679808_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_006248807.1|679854_679980_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824227.1|680126_680336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824226.1|680356_680845_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824225.1|680854_681289_-	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824224.1|681382_682186_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_006250991.1|682257_682617_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_006253113.1|682652_683111_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_020824222.1|683264_683450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250988.1|683642_683966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250987.1|684444_684675_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250986.1|684964_685240_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250985.1|685248_685554_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250984.1|685620_686040_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250075.1|686078_686261_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_020824221.1|686391_686889_-	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006248823.1|686881_687262_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006252485.1|687336_688020_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248825.1|688150_688351_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252483.1|688371_688632_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006252350.1|688807_689647_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_020824125.1|689643_690690_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_061888639.1|690700_691294_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824219.1|691420_692449_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_020824218.1|692441_692801_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_006252752.1|692790_693231_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_006251708.1|693198_693393_-	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006251707.1|693901_694087_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_041447996.1|694434_694779_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	99.1	5.9e-59
WP_020824215.1|694768_695362_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_020824214.1|695362_695692_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_015484698.1|695741_695891_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824213.1|696160_696640_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_147009560.1|696639_698751_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_015484701.1|698747_698972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|698971_700483_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_020824210.1|700486_701683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824209.1|702086_704048_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824208.1|704300_704624_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824207.1|704616_704919_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|704922_705447_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824205.1|705443_705836_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824204.1|705863_706505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824203.1|706587_706989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|707033_707264_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824201.1|707326_707554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782940.1|707607_711159_+|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824199.1|711158_711488_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_021280070.1|711487_712204_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	97.9	5.2e-134
WP_020828760.1|712207_712939_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_142782939.1|713207_713798_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	94.9	4.9e-98
WP_142782938.1|713800_720934_+	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_020824044.1|721205_722246_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247812.1|722515_722809_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|722952_723342_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
722837:722854	attR	AAAAAAGACCGCTTGTAG	NA	NA	NA	NA
WP_006247810.1|723313_723613_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|723685_724726_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
>prophage 3
NZ_CP017499	Mannheimia haemolytica strain 33702 chromosome, complete genome	2512791	1167385	1221176	2512791	head,transposase,terminase,holin,integrase	Mannheimia_phage(45.28%)	70	1167215:1167234	1218583:1218602
1167215:1167234	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_020824135.1|1167385_1168426_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
WP_006247823.1|1168447_1168669_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824134.1|1168718_1169102_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824132.1|1169617_1170460_-	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_061888593.1|1170845_1171682_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_006252707.1|1172376_1172595_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_006252708.1|1172693_1173146_-	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252710.1|1173173_1173440_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_032848956.1|1173480_1174143_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_020824130.1|1175071_1175284_-	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824129.1|1175417_1175897_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	95.0	3.1e-74
WP_006252960.1|1175893_1176253_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_020824128.1|1176256_1176763_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_020824127.1|1176869_1177580_-	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_006252947.1|1177846_1178362_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_006248787.1|1179039_1179315_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_142782926.1|1179317_1179569_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	84.0	1.1e-30
WP_006252067.1|1180034_1180331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1180487_1180946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778103.1|1180951_1181329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252070.1|1181344_1182172_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252071.1|1182188_1183028_-	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252072.1|1183027_1183687_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252073.1|1183783_1183978_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252074.1|1184026_1184470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252350.1|1184532_1185372_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_075271793.1|1185368_1186415_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_061888672.1|1186425_1186998_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_020824123.1|1187018_1187480_+	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_020824122.1|1187552_1188122_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_006251969.1|1188111_1188585_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_006251970.1|1188636_1189080_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_020824120.1|1189094_1189691_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006252685.1|1189691_1190042_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_006252684.1|1190070_1190220_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_081107630.1|1190229_1190409_-	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_020824116.1|1190609_1191107_+	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_020824115.1|1191109_1192489_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824114.1|1192556_1194068_+	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_006252680.1|1194042_1194873_+|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_006252039.1|1194925_1196116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1196112_1197369_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252041.1|1197380_1197890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252679.1|1197901_1199032_+	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252043.1|1199101_1199476_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252044.1|1199478_1199910_+	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252045.1|1199906_1200512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1200514_1201219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1201226_1201607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252048.1|1201591_1202098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252049.1|1202113_1203592_+	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252050.1|1203649_1204093_+	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252051.1|1204227_1204749_+	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_020824108.1|1204816_1205221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1205393_1208063_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_006252054.1|1208062_1208725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147009014.1|1208747_1209044_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_020824044.1|1209078_1210119_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006252056.1|1210778_1210958_+	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_020824105.1|1211242_1212139_+	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_020824103.1|1212373_1213081_+	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_132303704.1|1213083_1213380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252670.1|1213379_1214267_+	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_006252669.1|1214256_1214919_+	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252062.1|1214922_1215273_+	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252668.1|1215269_1216466_+	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252064.1|1216462_1217083_+	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_147009557.1|1217155_1220095_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.4	0.0e+00
1218583:1218602	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
WP_061888681.1|1220095_1220719_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	96.6	3.2e-111
WP_061888680.1|1220711_1221176_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	62.3	1.7e-53
>prophage 4
NZ_CP017499	Mannheimia haemolytica strain 33702 chromosome, complete genome	2512791	1817790	1918585	2512791	head,plate,tail,transposase,integrase,tRNA	Mannheimia_phage(61.9%)	108	1861871:1861930	1867955:1868371
WP_006250569.1|1817790_1819869_+|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	29.3	2.8e-55
WP_020831248.1|1819878_1820295_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	36.6	1.4e-11
WP_020831247.1|1820351_1820828_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_147009550.1|1820924_1822364_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_006249255.1|1823176_1823446_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_147009549.1|1823617_1825207_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	4.5e-77
WP_006250564.1|1825261_1826638_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006253083.1|1826694_1827921_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_006249250.1|1828190_1829078_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006250560.1|1829173_1830115_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.8	2.0e-53
WP_020831243.1|1830294_1830579_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_006250558.1|1830754_1830877_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_006250557.1|1830956_1831934_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	28.5	3.7e-05
WP_006253082.1|1832074_1832854_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006249246.1|1832926_1833958_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.8	3.4e-110
WP_006249245.1|1834039_1834831_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_006249244.1|1834841_1835147_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_006249243.1|1835255_1837055_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.3e-82
WP_075270716.1|1837213_1837756_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.4	1.5e-16
WP_006249241.1|1838019_1838217_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006249240.1|1838325_1838679_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006249239.1|1838803_1839079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253077.1|1839083_1840922_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_061888598.1|1840999_1841548_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006253076.1|1841753_1842419_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.3	1.5e-50
WP_095578366.1|1842462_1842798_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	55.9	2.0e-27
WP_006253708.1|1842931_1844779_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_132303665.1|1844796_1844991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250543.1|1844979_1846473_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_020831235.1|1846564_1847746_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005719747.1|1847880_1848519_-	YkgB family protein	NA	NA	NA	NA	NA
WP_006249955.1|1848578_1848932_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_006249954.1|1848942_1849284_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020824074.1|1849443_1850484_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_147009008.1|1850625_1851414_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006250539.1|1851611_1852175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250538.1|1852279_1854715_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_006250537.1|1854881_1855517_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	47.1	7.1e-10
WP_020831229.1|1855608_1856289_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_020831228.1|1856377_1857109_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.6	4.0e-41
WP_006250610.1|1857234_1858272_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_006250609.1|1858396_1858978_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147009009.1|1859227_1859764_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.7	3.2e-43
WP_006250605.1|1860535_1861063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248925.1|1861105_1861870_-|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
1861871:1861930	attL	ATCGGTGGTAATGTCATTGGCATTTAACTTTGGATAACGCTTTTTGATAATTCGGATTAC	NA	NA	NA	NA
WP_015484309.1|1863138_1864830_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_006253291.1|1866430_1867147_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248925.1|1867189_1867954_-|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_050412813.1|1868545_1869334_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
1867955:1868371	attR	ATCGGTGGTAATGTCATTGGCATTTAACTTTGGATAACGCTTTTTGATAATTCGGATTACGTTGTTGTAGCTCCGTTTGGTATCCGGACGAAGATAGTGACGATAGAAAAAAAAATCGGTCTAGTAGCGAATCAAAAGAGATAGAAGTTATCATTTTAAGTTTCCTCTTTCTGTAAAGTTAAACAGTGATTATTTAATAGTACCTTATCCCCAAAAAAGAGACGGGTATTTTTTATCAAATATCCTGTTAAAGAGGAAGTCTTTCTCGGTCCAATGACATCACATTTCCAAAAATTGATGGTATCCGGCTTACCGTTGGTCATTGTGTTTTTAGGTGAATGAATCCCTAATCCTTGAAAATCATACTGGAGATTATTAATTGTTTCCTTATCATAAGGCTGTCCAGTCTCTTGCAAA	NA	NA	NA	NA
WP_006252023.1|1869454_1869919_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_061888681.1|1869911_1870535_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	96.6	3.2e-111
WP_147009010.1|1870535_1873262_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.5	0.0e+00
WP_006251302.1|1873262_1873829_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831218.1|1873828_1874890_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_020831216.1|1874902_1875253_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_006251299.1|1875361_1876012_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_006248665.1|1876013_1877141_-	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251298.1|1877143_1878436_-	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006251297.1|1878435_1880715_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251296.1|1880767_1880956_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251295.1|1880985_1881354_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251294.1|1881353_1881728_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_020831214.1|1881738_1883148_-|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006248661.1|1883147_1883327_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_006248660.1|1883327_1883969_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248659.1|1883965_1884391_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_115262444.1|1884390_1884708_-	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006251289.1|1884753_1885671_-|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_020831206.1|1885670_1886738_-	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_132303683.1|1886781_1887000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251286.1|1886996_1887413_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_006251285.1|1887560_1888850_-|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_020831201.1|1888836_1890510_-	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_020824044.1|1891554_1892595_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006251281.1|1893561_1894062_-	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_005606393.1|1894069_1894324_-	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_005606396.1|1894323_1894581_-	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_020831194.1|1894743_1895103_-	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_020831193.1|1895099_1895342_-	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_006248646.1|1895344_1895878_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_142782968.1|1895963_1896395_-	mor transcription activator family protein	NA	A0A0M3LRS6	Mannheimia_phage	68.5	1.3e-50
WP_006251276.1|1896522_1897413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251275.1|1897505_1897712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831192.1|1897722_1898322_-	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_020831190.1|1898677_1899100_-	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_006251272.1|1899083_1899638_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_032848912.1|1899879_1900248_-	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251269.1|1900260_1900836_-	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032844828.1|1900858_1901041_-	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251267.1|1901046_1901259_-	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_006251266.1|1901577_1902195_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_005822932.1|1902207_1902399_-	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251265.1|1902401_1902722_-	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_020831183.1|1902731_1902980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251264.1|1902990_1903872_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831178.1|1905798_1906077_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_020831176.1|1906253_1906973_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_142782924.1|1907387_1908698_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.7	2.0e-131
WP_006248783.1|1908763_1909174_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251193.1|1909214_1910201_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248781.1|1910267_1911500_-	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251194.1|1911762_1912971_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248779.1|1912960_1913434_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_080542692.1|1913433_1914474_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006253059.1|1914623_1914806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|1914948_1916880_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_051138299.1|1916860_1917421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009548.1|1917544_1918585_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	98.8	1.4e-199
