The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	44694	52021	2645998	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|44694_44937_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44937_46998_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|46994_47552_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47500_48496_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48548_48737_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48766_49135_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49134_49509_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49998_50802_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50846_51125_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51301_52021_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	574304	658273	2645998	plate,transposase,protease,tRNA,head,tail	Mannheimia_phage(17.02%)	92	NA	NA
WP_006249683.1|574304_574982_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|575195_575414_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|575423_577394_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|577573_578062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|578093_579035_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|579037_579352_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|579363_579600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|579583_579877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|579998_580217_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|580226_580409_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|580425_580815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|580863_581151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|581269_581815_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|581801_582335_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|582499_582859_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|582994_583504_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|583506_583776_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|583769_584117_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|584295_584631_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|584632_584929_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|584951_585524_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|585523_587080_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|587198_588653_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|588645_589923_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|590124_590469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|590532_590997_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|591231_592347_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|592377_593304_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|593372_593654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|593653_594088_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|594093_594591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|594675_596061_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|596071_596587_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|596682_596997_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|596993_597146_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|597124_597427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249645.1|597474_600132_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|600141_601065_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_147008889.1|601048_601276_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	47.8	5.5e-13
WP_006249642.1|601268_602333_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|602319_602856_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|602910_603273_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|603282_604386_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|604378_604945_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|604954_607234_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|607234_607837_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_147010630.1|607820_608132_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	8.0e-31
WP_006249634.1|608094_608382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|608548_609253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|609616_610405_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|610441_612880_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|613199_614966_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|615120_616032_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|616154_617237_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|617324_618194_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|618247_618742_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|618942_619767_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|619856_622181_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_147008890.1|622415_623441_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.9	1.7e-90
WP_006250031.1|623689_624430_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|624560_626627_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|626748_627906_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|627964_628180_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|628369_629185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|629246_629891_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|630002_631706_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|631740_632139_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|632166_633303_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|633299_634115_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|634114_634996_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|634992_635661_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|636004_637288_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|637453_641170_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|641277_643281_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_061888036.1|643379_644735_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|644758_645493_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|645495_646131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249329.1|646398_647136_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|647132_648101_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|648281_648617_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|648600_648924_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|648913_650800_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|650847_651630_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|651678_652839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|652898_653915_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|654002_654164_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|654141_655143_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|655144_655549_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|655683_655866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|655869_656199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|656234_656987_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|657025_658273_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1056445	1063230	2645998		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1056445_1057228_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1057237_1057966_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1058101_1059121_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1059122_1059725_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1059853_1060009_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1060086_1060668_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1060682_1061330_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1061433_1062063_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1062177_1063230_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 4
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1459672	1586151	2645998	plate,transposase,capsid,portal,tRNA,integrase,terminase,holin,tail,head	Mannheimia_phage(93.65%)	155	1578198:1578216	1594967:1594985
WP_006248143.1|1459672_1462300_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1462494_1462920_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1463150_1463924_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1464067_1464859_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1464911_1465208_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1465232_1465511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1465670_1467647_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1467738_1468539_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1468906_1469905_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1470182_1470365_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1470634_1470925_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1470899_1471169_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1471158_1471491_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1471501_1471954_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1471953_1472286_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1472298_1474659_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1474655_1474988_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1474984_1475227_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1475378_1475672_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1475684_1476017_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1476099_1476372_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1476504_1476750_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1476848_1477061_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1477184_1477871_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1477874_1478393_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1478410_1478821_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1478920_1479181_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1479215_1480022_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1480204_1481443_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1481442_1481880_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1481881_1482229_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1482292_1482409_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1482432_1482747_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1482825_1483332_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1483340_1484522_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1484911_1485154_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1485154_1487434_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1487436_1488069_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1488055_1488973_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1488969_1489305_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1489304_1489910_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1490038_1490326_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006248190.1|1490559_1493472_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1493510_1493789_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1493839_1494298_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1494290_1494776_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1494772_1494994_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1495142_1495598_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1495594_1496161_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1496153_1496360_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1496365_1496578_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1496574_1497090_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1497201_1497891_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1497900_1498929_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1498942_1499770_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1499883_1501722_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1501730_1502771_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1503546_1504551_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1504775_1505171_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1505257_1506340_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1506469_1506700_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1506708_1507761_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1507831_1508725_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1508711_1509677_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1509679_1511431_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1511423_1512383_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1512691_1513273_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1513313_1513766_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1513769_1514090_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1514086_1514686_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1514728_1515247_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1515297_1516989_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1516991_1517810_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1517897_1518746_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1518873_1520595_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1520679_1521363_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1521372_1522902_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1523126_1523873_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_147008904.1|1524037_1526851_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1526953_1528183_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1528475_1529636_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1529644_1530514_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1530584_1532030_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1532134_1533121_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1533111_1533750_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1534933_1535524_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1535593_1536112_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1536258_1536570_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1536945_1537239_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147008905.1|1537361_1544408_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	96.1	0.0e+00
WP_006248123.1|1544410_1545001_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	100.0	2.3e-103
WP_006248125.1|1545269_1546001_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.1	3.3e-144
WP_075272472.1|1546004_1546721_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	99.6	1.2e-135
WP_006251214.1|1546728_1547199_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251215.1|1547198_1547528_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251216.1|1547531_1550027_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251218.1|1550571_1551030_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|1551198_1551432_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|1551446_1552118_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|1552213_1552390_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|1552445_1552862_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|1552901_1553384_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|1553387_1553768_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|1553764_1554133_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|1554134_1554479_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|1554478_1554856_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_020824317.1|1554858_1555119_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.7e-21
WP_006251229.1|1555130_1556120_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|1556134_1556569_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|1556561_1557932_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|1557918_1558857_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|1558810_1560187_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_020824318.1|1560183_1561404_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	100.0	8.3e-241
WP_020849856.1|1561387_1561912_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	100.0	2.2e-89
WP_020824300.1|1562303_1562537_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1562481_1562832_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1562804_1563374_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1563366_1563612_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1563950_1564136_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1564455_1564929_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1564918_1565488_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1565615_1565810_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1565855_1566068_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1566117_1566624_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1566607_1566823_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1566913_1567450_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1567446_1568808_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1568804_1569674_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1569982_1570243_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1570263_1570470_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1570599_1571259_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1571309_1571690_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1571682_1572180_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_015587044.1|1572289_1573330_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253368.1|1573467_1573773_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1573781_1574057_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1574348_1574579_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1574960_1575197_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1575765_1576272_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1576275_1576635_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1576631_1577111_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1577244_1577457_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1577469_1578420_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1578198:1578216	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1578460_1579255_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1579251_1579887_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_015484282.1|1580096_1580549_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	100.0	6.3e-85
WP_006250261.1|1580626_1581154_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1581150_1581354_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1581337_1581802_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1581805_1581994_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1582455_1582671_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1583215_1583917_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1584434_1584818_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1584867_1585089_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1585110_1586151_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1594967:1594985	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1591724	1602119	2645998	integrase,transposase	Mannheimia_phage(66.67%)	13	1593306:1593322	1611987:1612003
WP_006247813.1|1591724_1594583_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
1593306:1593322	attL	ACAAGCGGTCAAATTTA	NA	NA	NA	NA
WP_006247812.1|1594867_1595161_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1595304_1595694_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1595665_1595965_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1596141_1596828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1597229_1597430_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1597560_1598244_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1598318_1598699_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1598691_1599189_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1599320_1599503_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1599541_1599961_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006253274.1|1600296_1600941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_041447883.1|1601078_1602119_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	9.4e-201
1611987:1612003	attR	TAAATTTGACCGCTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1626135	1731810	2645998	transposase,portal,tRNA,integrase,terminase,holin,tail	Mannheimia_phage(44.83%)	105	1641152:1641211	1741452:1741658
WP_006253506.1|1626135_1627272_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1627318_1627735_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1627796_1628390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1628520_1630809_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1631072_1632836_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1632932_1633895_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006248099.1|1633947_1636380_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_147008906.1|1636511_1639148_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	36.0	1.6e-140
WP_006250663.1|1639157_1640990_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
WP_147010632.1|1641088_1641358_-	adenine methyltransferase	NA	NA	NA	NA	NA
1641152:1641211	attL	GCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGTGCTGT	NA	NA	NA	NA
WP_006248097.1|1641557_1642433_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006248096.1|1642425_1643187_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248095.1|1643253_1644621_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248094.1|1644654_1645284_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248093.1|1645415_1647080_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248092.1|1647079_1648846_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006253502.1|1648960_1653058_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_147008908.1|1653138_1654974_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_006248088.1|1654985_1655831_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248087.1|1655831_1656995_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248086.1|1657162_1657846_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248085.1|1657982_1658540_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248084.1|1658591_1659308_-	UMP kinase	NA	NA	NA	NA	NA
WP_006248083.1|1659399_1660962_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248082.1|1661025_1661877_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_006253501.1|1661972_1662692_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006253500.1|1663036_1664065_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248079.1|1664187_1665834_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006248078.1|1665843_1666854_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248077.1|1666863_1667490_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248076.1|1667551_1669042_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248075.1|1669100_1670336_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248074.1|1670423_1671146_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248073.1|1671375_1672293_-	GTPase Era	NA	NA	NA	NA	NA
WP_006248072.1|1672395_1673070_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248071.1|1673115_1674075_-	signal peptidase I	NA	NA	NA	NA	NA
WP_006253499.1|1674161_1675955_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248069.1|1676227_1677457_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253498.1|1677650_1679882_+	collagen-binding protein	NA	NA	NA	NA	NA
WP_147008909.1|1681026_1681959_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	96.7	1.4e-166
WP_006252769.1|1682200_1682641_+	DoxX family protein	NA	NA	NA	NA	NA
WP_006248065.1|1682666_1682954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248064.1|1683054_1683978_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_006248063.1|1683967_1684708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248062.1|1685508_1685679_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_006247812.1|1685946_1686240_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_147008910.1|1686362_1693418_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	96.6	0.0e+00
WP_006249176.1|1693427_1694057_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_095586241.1|1694325_1695057_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	96.7	5.7e-144
WP_006249178.1|1695060_1695777_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1695776_1696106_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1696105_1699672_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1699725_1699953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1700015_1700246_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1700290_1700692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1700775_1701417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1701444_1701840_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1701836_1702361_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1702364_1702667_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1702659_1702983_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1703056_1705018_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1705029_1706529_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1706528_1706753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1706749_1708861_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1708860_1709337_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1709484_1709883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824324.1|1710018_1710252_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	86.5	7.0e-32
WP_006249197.1|1710196_1710547_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1710547_1711144_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1711133_1711481_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1711644_1712451_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1712530_1712890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1712879_1713239_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1713231_1714260_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1714329_1714902_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1714898_1715534_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1715521_1716313_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1716309_1717071_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1717119_1717344_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1717470_1718202_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1718206_1718710_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1718706_1719819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1720082_1720313_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1720765_1721017_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1721019_1721295_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1721508_1721694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1721677_1721875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1721877_1722336_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1722371_1722731_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1722800_1723604_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1723713_1724232_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1724228_1724429_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1724412_1724910_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1724913_1725102_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1725233_1725611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1725840_1726680_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1726927_1727605_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1727843_1728281_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1728273_1728567_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1728569_1728779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1728925_1729051_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1729097_1729940_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1730002_1730494_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1730519_1730795_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1730754_1731810_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1741452:1741658	attR	ACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCACAGCGTGATCTCAACGCTGACACAAGTCAAGCCTTTTTAAACGAACTCGACCAAACCCTCTGGACTGCCGCCGACAAACTGCGTAAAAACCTCGATGCCGCCAACTACAAACACATCGTTCTTGGCTTTATCTTCCTAAAATACATCTCCG	NA	NA	NA	NA
>prophage 7
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1805626	1815943	2645998		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1805626_1806601_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1806603_1806801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1806784_1806970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1807615_1808212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1808247_1808985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1809136_1809511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1809522_1810179_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1810303_1810492_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1810549_1811233_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1811229_1812276_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1812286_1812880_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1814989_1815313_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1815393_1815561_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1815568_1815943_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 8
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	1819176	1826120	2645998	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1819176_1819887_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1820144_1820864_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1821085_1821712_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1821760_1822372_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1822482_1823169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1823345_1823645_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1823616_1824006_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1824149_1824443_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1824821_1826120_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 9
NZ_CP017501	Mannheimia haemolytica strain 33041 chromosome, complete genome	2645998	2259333	2267488	2645998	integrase,terminase	Synechococcus_phage(16.67%)	12	2262539:2262598	2267904:2267977
WP_006250276.1|2259333_2259873_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2260010_2260301_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2260272_2260575_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2260592_2260886_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2260836_2261049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2261051_2262011_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2262539:2262598	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2262817_2264044_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2264318_2264537_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2264649_2264973_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2265367_2266054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2266373_2266799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2266795_2267488_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2267904:2267977	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
