The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	696646	746827	2590588	terminase,head,transposase,plate,integrase,tail	Mannheimia_phage(79.17%)	61	745646:745705	751730:752145
WP_147009073.1|696646_697687_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|697810_698371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698351_700283_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700425_700608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700757_701798_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701797_702271_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702260_703469_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703731_704964_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|705030_706017_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|706057_706468_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706533_707844_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708258_708978_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|709154_709433_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711359_712241_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712251_712500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712509_712830_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712832_713024_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|713036_713654_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713972_714185_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714190_714373_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714395_714971_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714983_715352_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715593_716148_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|716131_716554_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716909_717509_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717519_717726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717818_718709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718836_719268_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719353_719887_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719889_720132_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|720128_720488_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720650_720908_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720907_721162_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|721169_721670_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721819_723445_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723513_725187_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|725173_726463_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726610_727027_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|727023_727242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727285_728353_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|728352_729270_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|729315_729633_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729632_730058_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|730054_730696_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730696_730876_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730875_732285_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732295_732670_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732669_733038_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|733067_733256_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733308_735588_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735587_736880_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736882_738010_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|738011_738662_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738770_739121_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|739133_740195_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740194_740761_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740761_743488_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743488_744112_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|744104_744569_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744689_745478_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745646:745705	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|746062_746827_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|746062_746827_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751730:752145	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	999507	1006292	2590588		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999507_1000290_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000299_1001028_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1001163_1002183_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1002184_1002787_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002915_1003071_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1003148_1003730_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003744_1004392_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004495_1005125_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005239_1006292_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	1316027	1393515	2590588	head,terminase,transposase,tRNA,holin,plate,portal,integrase,capsid,tail	Mannheimia_phage(85.25%)	85	1318444:1318460	1361913:1361929
WP_006252789.1|1316027_1318415_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1318444:1318460	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1318462_1319449_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1319677_1320337_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1321821_1322574_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1322573_1323473_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1323481_1324045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1324044_1324821_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1324920_1325316_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1325332_1325761_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1326059_1326455_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1326615_1328187_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1328203_1328515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1328636_1329308_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1329428_1330892_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1331119_1334287_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1334300_1335506_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1335536_1336109_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1336347_1336569_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1336573_1338307_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1339018_1339399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1339440_1343901_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1344076_1344793_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1344841_1346185_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1346442_1347330_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1347465_1347651_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1347740_1350368_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1350562_1350988_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1351218_1351992_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1352135_1352927_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1352979_1353276_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1353300_1353579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1353738_1355715_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1355806_1356619_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006252804.1|1356983_1357982_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	100.0	3.1e-185
WP_006248154.1|1358259_1358442_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_134916677.1|1358570_1359611_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.1	6.1e-200
WP_075271718.1|1359708_1360200_-	methyltransferase	NA	A0A0M3LQB3	Mannheimia_phage	100.0	1.2e-97
WP_006252806.1|1360199_1360490_-	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	100.0	5.5e-50
WP_006252807.1|1360464_1360734_-	hypothetical protein	NA	A0A0M3LPF0	Mannheimia_phage	100.0	1.1e-44
WP_006252809.1|1361066_1361510_-	single-stranded DNA-binding protein	NA	A0A0M3LP18	Mannheimia_phage	100.0	1.5e-75
WP_006250958.1|1361509_1361836_-	hypothetical protein	NA	A0A0M3LSB5	Mannheimia_phage	100.0	3.4e-56
WP_075271719.1|1361820_1364181_-	replication endonuclease	NA	A0A0M3LSC6	Mannheimia_phage	100.0	0.0e+00
1361913:1361929	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1364177_1364510_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1364506_1364749_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1364899_1365193_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1365201_1365534_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1365616_1365889_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1366028_1366274_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1366372_1366585_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1366708_1367395_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1367398_1367917_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1367934_1368345_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1368456_1369497_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888665.1|1369556_1369931_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1369930_1371172_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1371171_1371609_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1371608_1371995_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1372055_1372196_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1372195_1372510_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1372590_1373097_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1373105_1374287_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1374388_1374652_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1374620_1375256_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_147010270.1|1375256_1378271_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	100.0	0.0e+00
WP_061888620.1|1378273_1378813_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1378799_1379717_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1379713_1380049_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1380048_1380654_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1380782_1381070_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006250778.1|1381062_1381242_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_075271747.1|1381303_1384216_-|tail	phage tail protein	tail	A0A0M3LS92	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1384254_1384533_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1384583_1385042_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1385034_1385520_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_075271746.1|1385516_1385738_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LQ09	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1385886_1386342_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1386338_1386905_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1386897_1387104_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1387109_1387322_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006252832.1|1387318_1387834_-|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1387945_1388635_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1388644_1389673_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006248198.1|1389686_1390514_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1390627_1392466_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_040081096.1|1392474_1393515_+|portal	phage portal protein	portal	A0A0M3LQ03	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	1425565	1481310	2590588	integrase,holin,head,terminase	Mannheimia_phage(46.55%)	74	1428140:1428159	1481462:1481481
WP_006252023.1|1425565_1426030_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1426022_1426646_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009275.1|1426646_1429586_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.6	0.0e+00
1428140:1428159	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1429658_1430279_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1430275_1431472_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1431468_1431819_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1431822_1432485_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1432474_1433362_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1433361_1433658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1433660_1434368_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1434602_1435499_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1435783_1435963_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1436114_1436786_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1436808_1437471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1437470_1440140_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1440312_1440717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1440784_1441306_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1441440_1441884_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1441941_1443420_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1443435_1443942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1443926_1444307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1444314_1445019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1445021_1445627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1445623_1446055_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1446057_1446432_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1446501_1447632_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1447643_1448153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1448164_1449421_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1449417_1450608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1450660_1451491_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1451465_1452977_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1453044_1454424_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1454426_1454924_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1455124_1455304_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1455313_1455463_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1455491_1455842_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1455842_1456439_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1456453_1456897_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1456948_1457422_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_032844502.1|1457411_1457981_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	82.5	3.1e-81
WP_032844503.1|1458171_1458477_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	56.0	1.8e-19
WP_032844505.1|1458487_1458808_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	58.9	1.5e-24
WP_032844506.1|1459108_1459639_+	antirepressor	NA	D0UIM5	Aggregatibacter_phage	50.3	3.5e-42
WP_032844507.1|1459794_1460223_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	7.8e-37
WP_006252693.1|1460209_1460422_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	86.8	5.8e-33
WP_006250086.1|1460512_1461049_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_032844508.1|1461045_1461693_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	95.3	9.2e-114
WP_032844512.1|1461692_1461977_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	95.7	4.2e-47
WP_006252350.1|1462474_1463314_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1463376_1463820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1463868_1464063_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1464159_1464819_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1464818_1465658_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1465674_1466502_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252943.1|1466532_1467360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252944.1|1467518_1467815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252945.1|1468278_1468530_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	81.5	1.6e-29
WP_006248787.1|1468532_1468808_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1469485_1470001_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_147010271.1|1470320_1471016_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	59.3	1.6e-47
WP_020824128.1|1471122_1471629_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006250254.1|1471632_1471992_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|1471988_1472468_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1472601_1472814_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1472826_1473750_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1473742_1474405_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|1474445_1475291_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|1475318_1475771_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_147010273.1|1475815_1476319_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	99.4	1.1e-82
WP_061888593.1|1477013_1477850_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1478235_1479078_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1479593_1479977_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1480026_1480248_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1480269_1481310_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1481462:1481481	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	1634604	1683967	2590588	transposase,tRNA,protease	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1634604_1635645_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1635970_1636369_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1636455_1639182_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1639240_1639561_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1639681_1639984_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1640008_1640383_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1640739_1641051_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1641142_1641730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1642055_1642346_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1642405_1643137_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1643136_1643697_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1643696_1644122_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1644168_1645221_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1645605_1646973_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1647016_1647685_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1649772_1650690_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1650686_1651034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1651706_1652357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1652346_1652685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1653381_1653585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1653596_1653845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1654279_1654465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1655024_1655243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1655846_1657043_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1657149_1658124_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1658191_1658899_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1658943_1660395_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1660509_1661370_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1661876_1663175_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1663348_1664236_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1664238_1665462_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1665652_1666303_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1666359_1666689_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1667855_1670423_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1670363_1670546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251668.1|1670636_1671779_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_006251672.1|1673383_1674283_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1674296_1675199_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1675195_1675552_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1675621_1676227_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1676300_1678208_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1678506_1679685_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1679763_1680804_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1681019_1681442_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1682926_1683967_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	1925346	1968058	2590588	terminase,protease,transposase,holin,portal,integrase,tail	Mannheimia_phage(57.78%)	60	1926460:1926475	1966673:1966688
WP_020824044.1|1925346_1926387_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
1926460:1926475	attL	AAACGTTCCGAAAAAA	NA	NA	NA	NA
WP_006247812.1|1926656_1926950_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|1927093_1927483_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1927454_1927754_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|1927826_1928867_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824196.1|1930071_1930662_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_020824197.1|1930930_1931662_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1931665_1932382_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1932381_1932711_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1932710_1936262_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1936315_1936543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1936605_1936836_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1936880_1937282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1937364_1938006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1938033_1938426_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1938422_1938947_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1938950_1939253_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1939245_1939569_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1939821_1941783_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1942186_1943383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1943386_1944898_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1944897_1945122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1945118_1947230_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1947229_1947709_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1947978_1948128_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1948177_1948507_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1948507_1949101_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1949090_1949435_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1949782_1949968_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1950476_1950671_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1950638_1951079_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1951068_1951428_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1951420_1952449_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1952575_1953169_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1953179_1954226_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1954222_1955062_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1955237_1955498_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1955518_1955719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1955849_1956533_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1956607_1956988_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1956980_1957478_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1957608_1957791_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1957829_1958249_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1958315_1958621_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1958629_1958905_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1959194_1959425_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1959903_1960227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1960419_1960605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1960758_1961217_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1961252_1961612_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1961683_1962487_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1962538_1962973_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1962982_1963471_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|1963491_1963701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1963847_1963973_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|1964019_1964862_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|1964924_1965308_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|1965357_1965633_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|1965592_1966648_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|1966795_1968058_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
1966673:1966688	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017507	Mannheimia haemolytica strain 28253 chromosome, complete genome	2590588	2228338	2335453	2590588	terminase,transposase,tRNA,holin,integrase,tail	Mannheimia_phage(86.75%)	125	2273565:2273581	2333238:2333254
WP_020824044.1|2228338_2229379_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006251963.1|2230165_2230372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252627.1|2231566_2231890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251957.1|2232013_2232301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824044.1|2233531_2234572_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2234691_2234922_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2235108_2235786_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2235979_2236252_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2236260_2236386_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2236565_2237339_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2237421_2238138_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2238147_2238900_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2239115_2239649_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2239557_2239779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2239754_2240096_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2240119_2240869_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2240878_2241829_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2241974_2242994_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2243074_2243830_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2243816_2244461_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2244464_2244686_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2244796_2246434_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2246507_2247473_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2247645_2248293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2248483_2249272_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2249568_2250522_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2251297_2254855_+	collagen-like protein	NA	NA	NA	NA	NA
WP_147010288.1|2254889_2255930_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	1.5e-198
WP_006252223.1|2256168_2257911_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2258126_2258384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2258890_2259121_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2260041_2260380_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2260637_2262536_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2262677_2262980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2263145_2264285_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2264572_2266081_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2266143_2266365_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2266386_2266833_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2266817_2267414_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2267522_2268857_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2268967_2270116_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2270245_2270593_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2270592_2271450_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2271558_2272521_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2273565:2273581	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2273630_2274128_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2274175_2275537_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2275728_2276280_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2277188_2278253_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2278437_2279097_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2279232_2280150_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2280363_2281242_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2281307_2281898_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2282028_2282871_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2283155_2283449_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2283564_2284164_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2284164_2284608_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2290474_2291065_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2291333_2292065_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2292068_2292785_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2292792_2293239_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2293260_2293590_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2293593_2296089_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2296175_2296571_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2296638_2297097_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2297265_2297499_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2297513_2298185_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2298281_2298458_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2298513_2298930_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2298969_2299452_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2299455_2299836_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2299832_2300201_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2300202_2300547_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2300546_2300924_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_020828758.1|2300926_2301223_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	4.2e-21
WP_062627922.1|2301234_2302221_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2302235_2302670_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2302662_2304033_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2304019_2304958_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2304911_2306288_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2306284_2307505_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2307488_2308013_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2308379_2308637_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2308637_2308778_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2308806_2309157_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2309157_2309751_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2309740_2310085_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2310203_2310782_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2311298_2311493_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2311460_2311826_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2311815_2312184_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2312180_2312465_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2312841_2313054_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2313103_2313556_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2313674_2314247_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2314243_2314891_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2314890_2315175_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2315660_2315903_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2316059_2316293_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2316421_2317108_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2317121_2317502_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2317494_2317992_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2318573_2318843_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2318820_2319093_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2319760_2320267_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2320270_2320630_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2320626_2321106_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2321239_2321452_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2321464_2322388_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2322380_2323043_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2323083_2323929_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2323956_2324409_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2324453_2324945_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2324941_2325145_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2325128_2325593_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2325596_2325785_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2325916_2326294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2326523_2327363_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2327610_2328288_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2328521_2329427_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2330663_2331260_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2331237_2331744_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2331833_2332109_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2332068_2333124_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2333375_2334329_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2333238:2333254	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824074.1|2334412_2335453_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
