The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017509	Mannheimia haemolytica strain 28226 chromosome, complete genome	2559915	328827	428273	2559915	transposase,tRNA,integrase,tail,terminase,holin	Mannheimia_phage(87.65%)	118	330609:330626	386179:386196
WP_006251584.1|328827_329577_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|329586_330537_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
330609:330626	attL	TTACAAGCGGTCATTTTT	NA	NA	NA	NA
WP_006251586.1|330682_331702_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|331782_332538_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|332524_333169_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|333172_333394_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|333504_335142_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|335215_336181_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|336353_337001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|337191_337980_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|338276_339230_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_147008980.1|339255_339906_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_147008981.1|340005_343563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824074.1|343597_344638_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824277.1|344721_345675_-	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_006251368.1|345926_346982_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824229.1|346941_347217_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_061888666.1|347306_347813_-	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_081107633.1|347790_348387_-	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_142777847.1|348307_349627_-	hypothetical protein	NA	A0A0M3LNT4	Mannheimia_phage	100.0	2.7e-261
WP_061888667.1|349623_350529_-	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_061888668.1|350762_351419_-	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	100.0	1.8e-125
WP_061888669.1|351822_352011_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	100.0	6.9e-30
WP_006250263.1|352014_352479_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|352462_352666_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_061888670.1|352662_353154_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_142777854.1|353198_353651_-	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_147008982.1|353678_354524_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	73.3	9.1e-53
WP_032848956.1|354564_355227_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_020824131.1|355219_356143_-	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_020824130.1|356155_356368_-	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_006250951.1|356501_356981_-	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_006250950.1|356977_357337_-	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	100.0	5.9e-62
WP_061888675.1|357333_357846_-	hypothetical protein	NA	A0A0M3LR61	Mannheimia_phage	100.0	1.4e-96
WP_006251561.1|358513_358786_+	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_061888676.1|358763_359033_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_142778493.1|359614_360112_-	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006248823.1|360104_360485_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_075271714.1|360498_361185_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_032848913.1|361313_361547_+	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_061888658.1|361703_361946_+	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_061888659.1|362431_362716_+	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888657.1|362715_363363_+	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_006251735.1|363359_363932_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_032849027.1|364050_364503_+	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_032849029.1|364552_364765_+	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_021280054.1|365141_365426_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_021280055.1|365422_365791_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_006252250.1|365780_366146_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280056.1|366113_366308_-	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252253.1|366824_367403_-	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_031200637.1|367521_367866_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_061888656.1|367855_368449_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	100.0	2.3e-111
WP_006252032.1|368449_368800_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_142778549.1|368744_368969_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	100.0	7.7e-36
WP_006251710.1|368969_369227_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_006251235.1|369593_370118_+|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251234.1|370101_371322_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251233.1|371318_372695_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|372648_373587_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|373573_374944_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|374936_375371_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|375385_376375_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_032848903.1|376386_376584_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	2.8e-21
WP_006251227.1|376586_376964_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|376963_377308_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_061888643.1|377309_377678_+	hypothetical protein	NA	A0A0M3LS24	Mannheimia_phage	100.0	1.3e-59
WP_006251224.1|377674_378055_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|378058_378541_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|378580_378997_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|379052_379229_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|379324_379996_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|380010_380244_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|380412_380871_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251217.1|380938_381334_+	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_061888644.1|381420_383916_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251215.1|383919_384249_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_020849872.1|384270_384717_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_061888645.1|384724_385441_+|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_075271799.1|385444_386176_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_062627925.1|386444_387035_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
386179:386196	attR	AAAAATGACCGCTTGTAA	NA	NA	NA	NA
WP_100067196.1|392901_393345_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|393345_393945_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_006250518.1|394060_394354_+	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006252247.1|394638_395481_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006252246.1|395611_396202_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252245.1|396267_397146_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252244.1|397359_398277_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006252243.1|398412_399072_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|399256_400321_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252239.1|401229_401781_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252238.1|401972_403334_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_006252237.1|403381_403879_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252234.1|404988_405951_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_006248541.1|406059_406917_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006248542.1|406916_407264_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_020824275.1|407393_408542_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_020824274.1|408652_409987_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_041447977.1|410095_410692_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_100067210.1|410676_411123_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_006248546.1|411144_411366_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_006248547.1|411428_412937_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248549.1|413224_414364_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.5	2.7e-23
WP_006252924.1|414529_414832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252227.1|414973_416872_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006248552.1|417129_417468_+	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_020824273.1|418388_418619_+	membrane protein	NA	NA	NA	NA	NA
WP_020824272.1|419125_419383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252223.1|419598_421341_+	autotransporter	NA	NA	NA	NA	NA
WP_147008979.1|421579_422617_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	1.3e-199
WP_006251112.1|422711_423278_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_015484056.1|423270_423462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251113.1|423701_424982_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8CWQ1	Bacillus_phage	38.5	1.7e-10
WP_006249474.1|425000_425201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249473.1|425213_425714_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006249472.1|425731_426316_-	DedA family protein	NA	NA	NA	NA	NA
WP_006251114.1|426302_427091_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.2	1.2e-59
WP_006251115.1|427253_428273_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017509	Mannheimia haemolytica strain 28226 chromosome, complete genome	2559915	672824	737094	2559915	transposase,portal,tRNA,integrase,protease,tail,terminase,holin	Mannheimia_phage(57.45%)	74	674821:674838	735205:735222
WP_006252121.1|672824_674756_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.8e-128
674821:674838	attL	CTACAAGCGGTCTTTTTT	NA	NA	NA	NA
WP_020824230.1|674922_676272_-	MFS transporter	NA	NA	NA	NA	NA
WP_006252126.1|676475_677042_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_006252127.1|677122_677881_+	biotin ligase	NA	NA	NA	NA	NA
WP_006252128.1|677871_678666_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_006252129.1|678726_680313_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_006252130.1|680498_682352_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006249901.1|682396_683209_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_006252131.1|683389_684424_+	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_006252132.1|684433_685318_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_006252133.1|685456_686434_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_006252134.1|686521_687553_+	methionine synthase	NA	NA	NA	NA	NA
WP_006249906.1|687640_687862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249908.1|688137_689400_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
WP_006251368.1|689547_690603_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824229.1|690562_690838_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_020824134.1|690887_691271_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824228.1|691333_692176_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_006248807.1|692222_692348_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824227.1|692494_692704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824226.1|692724_693213_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824225.1|693222_693657_-	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824224.1|693750_694554_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_006250991.1|694625_694985_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_006253113.1|695020_695479_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_020824222.1|695632_695818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250988.1|696010_696334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250987.1|696812_697043_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250986.1|697332_697608_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250985.1|697616_697922_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250984.1|697988_698408_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250075.1|698446_698629_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_020824221.1|698759_699257_-	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006248823.1|699249_699630_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006252485.1|699704_700388_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248825.1|700518_700719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252483.1|700739_701000_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006252350.1|701175_702015_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_020824125.1|702011_703058_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_061888639.1|703068_703662_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824219.1|703788_704817_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_020824218.1|704809_705169_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_006252752.1|705158_705599_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_006251708.1|705566_705761_-	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006251707.1|706269_706455_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_041447996.1|706802_707147_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	99.1	5.9e-59
WP_020824215.1|707136_707730_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_020824214.1|707730_708060_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_015484698.1|708109_708259_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824213.1|708528_709008_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_020824212.1|709007_711119_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_015484701.1|711115_711340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|711339_712851_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_020824210.1|712854_714051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824209.1|714454_716416_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824208.1|716668_716992_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824207.1|716984_717287_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|717290_717815_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824205.1|717811_718204_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824204.1|718231_718873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824203.1|718955_719357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|719401_719632_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824201.1|719694_719922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142782940.1|719975_723527_+|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824199.1|723526_723856_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_021280070.1|723855_724572_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	97.9	5.2e-134
WP_147008988.1|724575_725307_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	98.4	6.0e-146
WP_142782939.1|725575_726166_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	94.9	4.9e-98
WP_142782938.1|726168_733302_+	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_020824044.1|733573_734614_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247812.1|734883_735177_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247811.1|735320_735710_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
735205:735222	attR	AAAAAAGACCGCTTGTAG	NA	NA	NA	NA
WP_006247810.1|735681_735981_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_020824044.1|736053_737094_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
>prophage 3
NZ_CP017509	Mannheimia haemolytica strain 28226 chromosome, complete genome	2559915	1563661	1570446	2559915		Organic_Lake_phycodnavirus(16.67%)	9	NA	NA
WP_006248955.1|1563661_1564714_-	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
WP_006248954.1|1564828_1565458_-	amino acid transporter	NA	NA	NA	NA	NA
WP_006248953.1|1565561_1566209_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248952.1|1566223_1566805_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248951.1|1566882_1567038_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248950.1|1567166_1567769_-	DedA family protein	NA	NA	NA	NA	NA
WP_006248949.1|1567770_1568790_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006252001.1|1568925_1569654_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_031200389.1|1569663_1570446_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
>prophage 4
NZ_CP017509	Mannheimia haemolytica strain 28226 chromosome, complete genome	2559915	1774566	1917619	2559915	transposase,plate,tRNA,integrase,tail,terminase,holin,head	Mannheimia_phage(54.78%)	169	1847718:1847777	1902143:1903348
WP_006250569.1|1774566_1776645_+|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	29.3	2.8e-55
WP_020831248.1|1776654_1777071_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	36.6	1.4e-11
WP_020831247.1|1777127_1777604_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_006250566.1|1777700_1779146_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_006249255.1|1779232_1779502_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006250565.1|1779673_1781263_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	4.5e-77
WP_006250564.1|1781317_1782694_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006253083.1|1782750_1783977_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_006249250.1|1784246_1785134_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006250560.1|1785229_1786171_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.8	2.0e-53
WP_020831243.1|1786350_1786635_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_006250558.1|1786810_1786933_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_006250557.1|1787012_1787990_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	28.5	3.7e-05
WP_006253082.1|1788130_1788910_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006249246.1|1788982_1790014_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.8	3.4e-110
WP_006249245.1|1790095_1790887_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_006249244.1|1790897_1791203_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_006249243.1|1791311_1793111_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.3e-82
WP_075270716.1|1793269_1793812_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.4	1.5e-16
WP_006249241.1|1794075_1794273_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006249240.1|1794381_1794735_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006249239.1|1794859_1795135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253077.1|1795139_1796978_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_061888598.1|1797055_1797604_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006253076.1|1797809_1798475_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.3	1.5e-50
WP_095578366.1|1798518_1798854_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	55.9	2.0e-27
WP_006253708.1|1798987_1800835_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_132303665.1|1800852_1801047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250543.1|1801035_1802529_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_020831235.1|1802620_1803802_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005719747.1|1803936_1804575_-	YkgB family protein	NA	NA	NA	NA	NA
WP_006249955.1|1804634_1804988_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_006249954.1|1804998_1805340_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020824074.1|1805499_1806540_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_147009008.1|1806681_1807470_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006250539.1|1807667_1808231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250538.1|1808335_1810771_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_006250537.1|1810937_1811573_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	47.1	7.1e-10
WP_020831229.1|1811664_1812345_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_020831228.1|1812433_1813165_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.6	4.0e-41
WP_006250610.1|1813290_1814328_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_006250609.1|1814452_1815034_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147009009.1|1815283_1815820_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.7	3.2e-43
WP_006250605.1|1816591_1817119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021280009.1|1817161_1817926_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
WP_015484309.1|1819194_1820886_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_006253291.1|1822486_1823203_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248925.1|1823245_1824010_-|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_050584459.1|1824165_1824525_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_050412813.1|1824766_1825555_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
WP_006252023.1|1825675_1826140_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_061888681.1|1826132_1826756_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	96.6	3.2e-111
WP_147009010.1|1826756_1829483_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.5	0.0e+00
WP_006251302.1|1829483_1830050_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831218.1|1830049_1831111_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_020831216.1|1831123_1831474_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_006251299.1|1831582_1832233_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_006248665.1|1832234_1833362_-	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251298.1|1833364_1834657_-	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006251297.1|1834656_1836936_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251296.1|1836988_1837177_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251295.1|1837206_1837575_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251294.1|1837574_1837949_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_020831214.1|1837959_1839369_-|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006248661.1|1839368_1839548_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_006248660.1|1839548_1840190_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248659.1|1840186_1840612_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_115262444.1|1840611_1840929_-	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006251289.1|1840974_1841892_-|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_020831206.1|1841891_1842959_-	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_132303683.1|1843002_1843221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251286.1|1843217_1843634_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_006251285.1|1843781_1845071_-|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_020831201.1|1845057_1846731_-	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
1847718:1847777	attL	TGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGATT	NA	NA	NA	NA
WP_020824044.1|1847775_1848816_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006252056.1|1849475_1849655_+	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_147009011.1|1849939_1850836_+	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_020824103.1|1851070_1851778_+	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_132303704.1|1851780_1852077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252670.1|1852076_1852964_+	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_006252669.1|1852953_1853616_+	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252062.1|1853619_1853970_+	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252668.1|1853966_1855163_+	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252064.1|1855159_1855780_+	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_147009012.1|1855852_1858792_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.3	0.0e+00
WP_061888681.1|1858792_1859416_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	96.6	3.2e-111
WP_006252023.1|1859408_1859873_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824135.1|1860507_1861548_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
WP_006247823.1|1861569_1861791_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824134.1|1861840_1862224_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824132.1|1862739_1863582_-	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_061888593.1|1863967_1864804_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_006252707.1|1865498_1865717_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_006252708.1|1865815_1866268_-	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252710.1|1866295_1866562_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_032848956.1|1866602_1867265_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_020824131.1|1867257_1868181_-	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_020824130.1|1868193_1868406_-	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_147009013.1|1868539_1869019_-	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	98.1	6.2e-75
WP_006252960.1|1869015_1869375_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_020824128.1|1869378_1869885_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_020824127.1|1869991_1870702_-	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_006252947.1|1870968_1871484_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_006248787.1|1872161_1872437_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_142782926.1|1872439_1872691_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	84.0	1.1e-30
WP_006252067.1|1873156_1873453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1873609_1874068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778103.1|1874073_1874451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252070.1|1874466_1875294_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_006252071.1|1875310_1876150_-	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252072.1|1876149_1876809_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252073.1|1876905_1877100_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252074.1|1877148_1877592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252350.1|1877654_1878494_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_075271793.1|1878490_1879537_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_061888672.1|1879547_1880120_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_020824123.1|1880140_1880602_+	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_020824122.1|1880674_1881244_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_006251969.1|1881233_1881707_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_006251970.1|1881758_1882202_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_020824120.1|1882216_1882813_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006252685.1|1882813_1883164_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_006252684.1|1883192_1883342_+	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_081107630.1|1883351_1883531_-	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_020824116.1|1883731_1884229_+	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_020824115.1|1884231_1885611_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824114.1|1885678_1887190_+	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_006252680.1|1887164_1887995_+|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_006252039.1|1888047_1889238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1889234_1890491_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252041.1|1890502_1891012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252679.1|1891023_1892154_+	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252043.1|1892223_1892598_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252044.1|1892600_1893032_+	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252045.1|1893028_1893634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1893636_1894341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1894348_1894729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252048.1|1894713_1895220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006252049.1|1895235_1896714_+	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252050.1|1896771_1897215_+	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252051.1|1897349_1897871_+	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_020824108.1|1897938_1898343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1898515_1901185_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_006252054.1|1901184_1901847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147009014.1|1901869_1902166_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_020824044.1|1902200_1903241_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006251281.1|1904207_1904708_-	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
1902143:1903348	attR	TGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGATTAATTTGAGCTTAAATTCTTTTCCACCCAAATCCGTTTTCCATCAAGTAAGGTTGCCATCGGTGTTCTGCCACAGCACATTTTTCCTTGATGTGTTCGATGGTGATTATAATACATTAACCACTCATCTAAATCCGCTTGTAATGTCGTTAAATCCGTATAAATTTTCTTCCTAAATGCCACTTGGTAAAATTCTTGTAAGATTGTTTTATGGAACCGTTCGCAGATGCCGTTAGTCTGCGGATGTTTTACCTTGGTTTTACTGTGTTCAATATCATTTATTGCTAAATAAAGCTCATAATCGTGATTTTCTACCTTGCCACAATATTCACTTCCTCGGTCAGTTAATATGCGTAACATCGGTAAACCTTGGCTTTCAAAGTATGGTAACACTTTATCATTCAGCATATCCGCAGCACTGATAGCGGTCTTCATTGTATAAAGTTTTGCAAACGCCACTTTACTGTAAGTATCAATAAACGTTTGTTGATAAATACGACCCACTCCTTTGAGGTTGCCCACATAGAAAGTATCTTGTGAGCCAAGATAGCCAGGGTGTGTCGTTTCAATTTCACCACAGGCAATCTCATCTTCTTTCTTACGCTCTAAGGCTTGTACCTGTGTTTCACTGAGTATAATACCTTGTTCTGCAACCAGTTTTTCCAGGGCGATTAATCTTTGCTTAAAATTGGCAAGATGATGACGTAACCAAATCGAACGTACACCTCCTGCTGAAACAAAGATGCCTTGTTTACGGAGTTCGTTACTCACTCTTACCTGTCCAAATGCCGGGTTATCAAGAGCAAACTTCACAACAGCTTGCTCTATTGCCTCATCAACACGATTTTTTAAGTTGGGAACGCGTCTATTTTGATTCAGCAATGCTTCAACACCACCTTGCTCAACCGCTTGTTGATAACGATAGAATGTATCTCGGCTCATTCCCATTACTTTGCAGGCTTGAGAAATATTACCCAGTTCTTCTGCTAAATTTAATAAACCGGTCTTGTGTTTAATGAGAGGGTTGTTAGAATAAAACATGAGAGTTTCCTTTTTGTTTAGATTGATTTTTGACACTCATATTCTAAACGGGAAACTCTCACTTTTTAGAGTGAATTGTCAGATCAAGTCTGATCTTCTACACATAA	NA	NA	NA	NA
WP_005606393.1|1904715_1904970_-	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_005606396.1|1904969_1905227_-	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_020831194.1|1905389_1905749_-	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_020831193.1|1905745_1905988_-	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_006248646.1|1905990_1906524_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_142782968.1|1906609_1907041_-	mor transcription activator family protein	NA	A0A0M3LRS6	Mannheimia_phage	68.5	1.3e-50
WP_006251276.1|1907168_1908059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251275.1|1908151_1908358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831192.1|1908368_1908968_-	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_020831190.1|1909323_1909746_-	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_006251272.1|1909729_1910284_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_032848912.1|1910525_1910894_-	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251269.1|1910906_1911482_-	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032844828.1|1911504_1911687_-	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251267.1|1911692_1911905_-	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_006251266.1|1912223_1912841_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_005822932.1|1912853_1913045_-	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251265.1|1913047_1913368_-	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_020831183.1|1913377_1913626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251264.1|1913636_1914518_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831178.1|1916444_1916723_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_020831176.1|1916899_1917619_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
