The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	732864	783795	2591830	transposase,integrase,plate,head,tail,terminase	Mannheimia_phage(78.72%)	60	782614:782673	788698:789113
WP_147009073.1|732864_733905_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	1.2e-195
WP_051138299.1|734028_734589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|734569_736501_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|736643_736826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|736975_738016_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|738015_738489_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|738478_739687_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|739949_741182_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|741248_742235_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|742275_742686_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|742751_744062_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|744476_745196_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|745372_745651_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|747577_748459_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|748469_748718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|748727_749048_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|749050_749242_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|749254_749872_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|750190_750403_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|750408_750591_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|750613_751189_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|751201_751570_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|751811_752366_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|752349_752772_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|753127_753727_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|753737_753944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|754036_754927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|755054_755486_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|755571_756105_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|756107_756350_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|756346_756706_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|756868_757126_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|757125_757380_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|757387_757888_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|758037_759663_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|759731_761405_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|761391_762681_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|762828_763245_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|763241_763460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|763503_764571_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|764570_765488_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|765533_765851_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|765850_766276_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|766272_766914_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|766914_767094_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|767093_768503_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|768513_768888_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|768887_769256_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|769285_769474_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|769526_771806_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|771805_773098_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006251299.1|774979_775630_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|775738_776089_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|776101_777163_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|777162_777729_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|777729_780456_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|780456_781080_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|781072_781537_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|781657_782446_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
782614:782673	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|783030_783795_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|783030_783795_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
788698:789113	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	1036459	1043244	2591830		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|1036459_1037242_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1037251_1037980_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1038115_1039135_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1039136_1039739_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1039867_1040023_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1040100_1040682_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1040696_1041344_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1041447_1042077_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1042191_1043244_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	1352655	1428074	2591830	tRNA,capsid,transposase,integrase,portal,plate,head,tail,terminase,holin	Mannheimia_phage(84.48%)	82	1355072:1355088	1397099:1397115
WP_006252789.1|1352655_1355043_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1355072:1355088	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1355090_1356077_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1356305_1356965_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1358449_1359202_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1359201_1360101_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1360109_1360673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1360672_1361449_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1361548_1361944_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1361960_1362389_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1362687_1363083_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1363243_1364815_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1364831_1365143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1365264_1365936_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1366056_1367520_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1367747_1370915_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1370928_1372134_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006251539.1|1372164_1372737_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1372975_1373197_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1373201_1374935_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1375646_1376027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1376068_1380529_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1380704_1381421_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1381469_1382813_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1383070_1383958_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1384093_1384279_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1384368_1386996_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1387190_1387616_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1387846_1388620_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1388763_1389555_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1389607_1389904_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1389928_1390207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1390366_1392343_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1392434_1393247_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1393614_1394613_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1394890_1395073_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1395342_1395633_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_142778027.1|1395607_1395877_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	98.9	7.1e-44
WP_006248157.1|1395866_1396199_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1396209_1396662_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1396661_1396994_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1397006_1399367_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1397099:1397115	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1399363_1399696_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1399692_1399935_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1400085_1400379_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1400387_1400720_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1400802_1401075_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1401214_1401460_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1401558_1401771_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1401894_1402581_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1402584_1403103_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1403120_1403531_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824074.1|1403642_1404683_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_061888663.1|1405730_1406168_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1406167_1406554_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1406614_1406755_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1406754_1407069_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1407149_1407656_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1407664_1408846_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1408947_1409211_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1409179_1409815_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1409815_1412830_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1412832_1413372_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1413358_1414276_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1414272_1414608_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1414607_1415213_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1415341_1415629_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_006250778.1|1415621_1415801_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_061888618.1|1415862_1418775_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1418813_1419092_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1419142_1419601_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1419593_1420079_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1420075_1420297_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1420445_1420901_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1420897_1421464_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1421456_1421663_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1421668_1421881_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1421877_1422393_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1422504_1423194_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_147009074.1|1423203_1424232_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	99.7	7.8e-192
WP_006252839.1|1424245_1425073_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1425186_1427025_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1427033_1428074_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	1460124	1512706	2591830	holin,terminase,integrase,head	Mannheimia_phage(45.28%)	70	1462699:1462718	1512858:1512877
WP_006252023.1|1460124_1460589_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1460581_1461205_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_147009075.1|1461205_1464145_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	93.7	0.0e+00
1462699:1462718	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1464217_1464838_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1464834_1466031_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1466027_1466378_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1466381_1467044_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1467033_1467921_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1467920_1468217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1468219_1468927_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1469161_1470058_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1470342_1470522_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1470673_1471345_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1471367_1472030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1472029_1474699_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1474871_1475276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1475343_1475865_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1475999_1476443_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1476500_1477979_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1477994_1478501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1478485_1478866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1478873_1479578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1479580_1480186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1480182_1480614_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1480616_1480991_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1481060_1482191_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1482202_1482712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1482723_1483980_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1483976_1485167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1485219_1486050_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1486024_1487536_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1487603_1488983_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1488985_1489483_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1489683_1489863_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1489872_1490022_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1490050_1490401_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1490401_1490998_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1491012_1491456_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1491507_1491981_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1491970_1492540_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1492612_1493074_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1493094_1493667_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1493677_1494724_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1494720_1495560_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1495622_1496066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1496114_1496309_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1496405_1497065_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1497064_1497904_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1497920_1498748_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_020824126.1|1498763_1499099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1499146_1499605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1499761_1500058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1500523_1500775_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1500777_1501053_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1501729_1502245_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1502511_1503222_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_020824128.1|1503328_1503835_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	91.1	1.1e-85
WP_006252960.1|1503838_1504198_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	95.8	2.7e-59
WP_006250951.1|1504194_1504674_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|1504807_1505020_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1505032_1505956_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1505948_1506611_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1506651_1506918_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1506945_1507398_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1507496_1507715_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1508409_1509246_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1509631_1510474_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1510989_1511373_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1511422_1511644_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1511665_1512706_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1512858:1512877	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	1665953	1715306	2591830	protease,transposase,tRNA	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1665953_1666994_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1667319_1667718_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1667804_1670531_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1670589_1670910_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1671030_1671333_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1671357_1671732_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1672088_1672400_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1672491_1673079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1673404_1673695_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1673754_1674486_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1674485_1675046_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1675045_1675471_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1675517_1676570_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1676954_1678322_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1678365_1679034_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1681121_1682039_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1682035_1682383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1683055_1683706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1683695_1684034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1684730_1684934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1684945_1685194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1685628_1685814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1686373_1686592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1687195_1688392_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1688498_1689473_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1689540_1690248_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1690292_1691744_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1691858_1692719_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1693225_1694524_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1694697_1695585_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1695587_1696811_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1697001_1697652_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1697708_1698038_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1699204_1701772_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1701712_1701895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009077.1|1701985_1703119_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.6	3.0e-160
WP_006251672.1|1704732_1705632_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1705645_1706548_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1706544_1706901_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1706970_1707576_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1707649_1709557_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1709845_1711024_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1711102_1712143_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1712358_1712781_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1714265_1715306_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	1956813	2005728	2591830	protease,transposase,integrase,portal,holin,tail,terminase	Mannheimia_phage(58.7%)	61	1959206:1959221	2004343:2004358
WP_020824044.1|1956813_1957854_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247810.1|1957926_1958226_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1958197_1958587_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1958730_1959024_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
1959206:1959221	attL	TTTTTTCGGAACGTTT	NA	NA	NA	NA
WP_020824044.1|1959293_1960334_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_147009079.1|1960605_1967739_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.3	0.0e+00
WP_061887268.1|1967741_1968332_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	96.9	4.0e-100
WP_020824197.1|1968600_1969332_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	98.8	1.8e-145
WP_020824198.1|1969335_1970052_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	96.6	3.7e-132
WP_020824199.1|1970051_1970381_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_020824200.1|1970380_1973932_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1973985_1974213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1974275_1974506_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1974550_1974952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1975034_1975676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1975703_1976096_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1976092_1976617_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1976620_1976923_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1976915_1977239_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1977491_1979453_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1979856_1981053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1981056_1982568_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1982567_1982792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1982788_1984900_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1984899_1985379_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1985648_1985798_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1985847_1986177_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1986177_1986771_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1986760_1987105_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1987452_1987638_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1988146_1988341_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1988308_1988749_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1988738_1989098_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1989090_1990119_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1990245_1990839_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1990849_1991896_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1991892_1992732_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1992907_1993168_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1993188_1993389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1993519_1994203_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1994277_1994658_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1994650_1995148_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1995278_1995461_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1995499_1995919_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1995985_1996291_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1996299_1996575_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1996864_1997095_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1997573_1997897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1998089_1998275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1998428_1998887_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1998922_1999282_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1999353_2000157_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|2000208_2000643_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|2000652_2001141_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|2001161_2001371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|2001517_2001643_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|2001689_2002532_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|2002594_2002978_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|2003027_2003303_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2003262_2004318_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|2004465_2005728_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
2004343:2004358	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017518	Mannheimia haemolytica strain 22604 chromosome, complete genome	2591830	2266008	2373051	2591830	tRNA,transposase,integrase,tail,terminase,holin	Mannheimia_phage(86.75%)	125	2311235:2311251	2370836:2370852
WP_020824074.1|2266008_2267049_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006251963.1|2267835_2268042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252627.1|2269236_2269560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251957.1|2269683_2269971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824044.1|2271201_2272242_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2272361_2272592_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2272778_2273456_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2273649_2273922_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2273930_2274056_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2274235_2275009_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2275091_2275808_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2275817_2276570_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2276785_2277319_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2277227_2277449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2277424_2277766_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2277789_2278539_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2278548_2279499_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2279644_2280664_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2280744_2281500_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2281486_2282131_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2282134_2282356_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2282466_2284104_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2284177_2285143_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2285315_2285963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2286153_2286942_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2287238_2288192_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2288967_2292525_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2292559_2293600_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2293838_2295581_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2295796_2296054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2296560_2296791_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2297711_2298050_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2298307_2300206_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2300347_2300650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2300815_2301955_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2302242_2303751_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2303813_2304035_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2304056_2304503_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2304487_2305084_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2305192_2306527_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2306637_2307786_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2307915_2308263_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2308262_2309120_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2309228_2310191_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
2311235:2311251	attL	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_006252237.1|2311300_2311798_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2311845_2313207_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_142778013.1|2313398_2313950_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2314858_2315923_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2316107_2316767_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2316902_2317820_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2318033_2318912_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2318977_2319568_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2319698_2320541_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2320825_2321119_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2321234_2321834_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2321834_2322278_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2328144_2328735_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2329003_2329735_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2329738_2330455_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2330462_2330909_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2330930_2331260_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2331263_2333759_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2333845_2334241_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2334308_2334767_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|2334935_2335169_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|2335183_2335855_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2335951_2336128_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2336183_2336600_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2336639_2337122_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2337125_2337506_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|2337502_2337871_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|2337872_2338217_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2338216_2338594_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_021265457.1|2338596_2338821_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.1e-21
WP_062627922.1|2338832_2339819_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	99.7	1.4e-185
WP_006251230.1|2339833_2340268_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2340260_2341631_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2341617_2342556_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2342509_2343886_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2343882_2345103_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2345086_2345611_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2345977_2346235_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_075271814.1|2346235_2346376_-	lytic transglycosylase	NA	A0A0M3LNX0	Mannheimia_phage	95.7	1.8e-19
WP_006252032.1|2346404_2346755_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_020824215.1|2346755_2347349_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|2347338_2347683_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2347801_2348380_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2348896_2349091_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2349058_2349424_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2349413_2349782_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2349778_2350063_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2350439_2350652_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2350701_2351154_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2351272_2351845_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2351841_2352489_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2352488_2352773_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2353258_2353501_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2353657_2353891_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2354019_2354706_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2354719_2355100_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2355092_2355590_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2356171_2356441_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2356418_2356691_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_006252958.1|2357358_2357865_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	90.5	7.0e-85
WP_006250254.1|2357868_2358228_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250951.1|2358224_2358704_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2358837_2359050_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2359062_2359986_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2359978_2360641_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147009080.1|2360681_2361527_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	74.0	1.1e-53
WP_142777854.1|2361554_2362007_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2362051_2362543_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2362539_2362743_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2362726_2363191_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|2363194_2363383_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006248797.1|2363514_2363892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|2364121_2364961_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_062627972.1|2365208_2365886_+	antirepressor	NA	A0A0M3LQ72	Mannheimia_phage	93.9	6.1e-60
WP_061888667.1|2366119_2367025_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2368261_2368858_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2368835_2369342_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2369431_2369707_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2369666_2370722_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2370973_2371927_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
2370836:2370852	attR	AAAATTTTGCAAATTTT	NA	NA	NA	NA
WP_020824044.1|2372010_2373051_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
