The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	43992	51536	2729419	tail,transposase	Mannheimia_phage(81.82%)	11	NA	NA
WP_095586248.1|43992_44223_-	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	89.5	1.9e-05
WP_006248673.1|44209_44452_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_134983781.1|44452_46513_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	98.7	0.0e+00
WP_006253441.1|46509_47067_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47015_48011_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48063_48252_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48281_48650_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|48649_49024_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49513_50317_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50361_50640_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|50816_51536_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	577791	661817	2729419	head,tRNA,plate,tail,protease,transposase	Mannheimia_phage(17.02%)	92	NA	NA
WP_006249683.1|577791_578469_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|578682_578901_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_020828826.1|578910_580881_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	43.9	9.6e-146
WP_006253638.1|581060_581549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|581580_582522_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|582524_582839_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|582850_583087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|583070_583364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|583485_583704_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|583713_583896_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|583912_584302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|584350_584638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|584756_585302_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|585288_585822_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|585986_586346_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|586481_586991_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|586993_587263_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|587256_587604_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|587782_588118_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|588119_588416_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|588438_589011_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|589010_590567_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|590685_592140_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|592132_593410_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|593611_593956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|594019_594484_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|594718_595834_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|595864_596791_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|596859_597141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|597140_597575_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|597580_598078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|598162_599548_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|599558_600074_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|600169_600484_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|600480_600633_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|600611_600914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715984.1|600961_603619_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|603628_604552_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|604535_604763_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|604755_605820_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|605806_606343_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|606397_606760_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|606769_607873_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|607865_608432_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|608441_610721_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|610721_611324_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|611307_611583_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|611582_611870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|612036_612741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623879.1|612909_613104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|613156_613945_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|613981_616420_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|616739_618506_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|618660_619572_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|619694_620777_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|620864_621734_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|621787_622282_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|622482_623307_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|623396_625721_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|625955_626981_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|627229_627970_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|628100_630167_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|630288_631446_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|631504_631720_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|631909_632725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|632786_633431_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|633542_635246_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|635280_635679_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|635706_636843_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|636839_637655_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|637654_638536_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|638532_639201_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|639544_640828_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|640993_644710_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|644817_646821_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006251873.1|648302_649037_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|649039_649675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062715982.1|649942_650680_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|650676_651645_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|651825_652161_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|652144_652468_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|652457_654344_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|654391_655174_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|655222_656383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|656442_657459_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|657546_657708_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|657685_658687_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|658688_659093_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|659227_659410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|659413_659743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|659778_660531_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|660569_661817_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	917846	973811	2729419	integrase,transposase	Mannheimia_phage(26.67%)	59	940683:940698	974712:974727
WP_096864247.1|917846_918887_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006252258.1|919040_919814_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|919962_924159_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|924213_925308_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|925394_925664_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|925727_926366_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|926449_927226_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|927235_927490_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|927491_927785_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015587023.1|927851_928892_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_015587024.1|928890_929622_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006248322.1|929939_930494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248324.1|930761_930992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|931112_931430_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248329.1|931927_932185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|932619_933708_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248333.1|933772_934204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|934207_936310_-	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006253298.1|936336_936615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248336.1|937583_938015_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032845458.1|938032_939025_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_005719386.1|939021_940011_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
940683:940698	attL	ATATCTATTGGTGTTT	NA	NA	NA	NA
WP_006248338.1|941002_941644_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_006248339.1|941661_942417_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005719377.1|942420_943068_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005719374.1|943064_944228_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006248340.1|944224_945526_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719369.1|945667_946555_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248341.1|946579_947134_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719365.1|947193_947517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719361.1|947540_948644_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_015484362.1|949872_950520_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_006248344.1|950543_950951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|951048_951399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|951489_951852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|951964_952225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248349.1|953515_954352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|954455_954920_-	ArdC family protein	NA	NA	NA	NA	NA
WP_006253302.1|955128_955392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270676.1|955475_956543_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075270679.1|956799_957009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248352.1|957153_959322_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_006253295.1|959322_961305_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006253296.1|961366_961672_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_021265440.1|961706_962747_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	96.0	3.8e-194
WP_021265545.1|962845_963076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|963145_963697_-	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_049800970.1|964033_964288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|964526_964781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248359.1|964946_965153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248360.1|965149_965926_+	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248362.1|966701_967676_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248363.1|967762_967960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587023.1|968072_969113_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006248364.1|969244_969487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|969646_969904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248367.1|969915_970416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008793.1|970919_972893_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248370.1|973046_973811_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
974712:974727	attR	AAACACCAATAGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1073657	1080442	2729419		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1073657_1074440_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1074449_1075178_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1075313_1076333_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1076334_1076937_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1077065_1077221_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1077298_1077880_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1077894_1078542_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1078645_1079275_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1079389_1080442_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 5
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1156428	1174159	2729419	integrase,transposase	Staphylococcus_phage(28.57%)	19	1157161:1157175	1175034:1175048
WP_014325826.1|1156428_1157193_+|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	28.6	6.4e-05
1157161:1157175	attL	GAAATGTTGAGAGAG	NA	NA	NA	NA
WP_075266381.1|1157370_1158345_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_075270677.1|1158459_1159365_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_075266406.1|1159508_1159754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1159784_1161278_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1161389_1161695_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014325824.1|1161722_1162937_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001447541.1|1163213_1164098_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_075268008.1|1164418_1164643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325823.1|1164725_1166018_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025288851.1|1166180_1167026_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1167194_1167998_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1167997_1168834_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|1169169_1169985_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_021265455.1|1170953_1171139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075500167.1|1171300_1171912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075266381.1|1172012_1172987_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	8.8e-52
WP_087437310.1|1172956_1173181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340803.1|1173259_1174159_-|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	23.3	2.6e-05
1175034:1175048	attR	GAAATGTTGAGAGAG	NA	NA	NA	NA
>prophage 6
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1254581	1362521	2729419	terminase,tRNA,integrase,tail,protease,capsid,transposase	Mannheimia_phage(81.58%)	120	1247101:1247160	1301374:1301463
1247101:1247160	attL	TTTGGGTGGAAAAGAATTTAAGCTCAAATTAATCTGACAGACACGGTAATTTAAAACGGG	NA	NA	NA	NA
WP_006249223.1|1254581_1255931_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_006249222.1|1255969_1256506_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.9	9.9e-13
WP_006250946.1|1256672_1259060_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_006250245.1|1260378_1260966_-	SocA family protein	NA	NA	NA	NA	NA
WP_006250244.1|1261017_1261266_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_006250242.1|1261833_1262157_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	44.7	7.8e-13
WP_076621564.1|1262134_1262410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250240.1|1263143_1263434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250230.1|1265990_1266185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250229.1|1266181_1267132_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1267142_1267802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1267811_1268018_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_062715992.1|1268487_1269702_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1270073_1270811_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1270842_1271229_-	RidA family protein	NA	NA	NA	NA	NA
WP_006249038.1|1271309_1272311_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249037.1|1272377_1272719_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1272911_1274252_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1274413_1275379_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1275645_1277316_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1277476_1277920_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1277970_1278546_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1278652_1279543_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1279609_1280176_-	elongation factor P	NA	NA	NA	NA	NA
WP_006253558.1|1280342_1280912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249378.1|1280965_1281958_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1282057_1283461_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1283933_1284923_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1284919_1285177_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1285203_1285695_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1286194_1286659_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1286642_1286846_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1286842_1287370_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1287447_1287900_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1288109_1288745_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1288741_1289536_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1289576_1290527_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1290539_1290752_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1290885_1291365_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1291361_1291721_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1291724_1292231_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1292799_1293036_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1293417_1293648_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1293939_1294215_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1294223_1294529_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250077.1|1294608_1295106_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1295098_1295479_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1295529_1296189_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1296318_1296525_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1296545_1296806_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1297114_1297984_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1297980_1299342_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1299338_1299875_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1299965_1300181_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_015587044.1|1300364_1301405_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006251707.1|1301815_1302001_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
1301374:1301463	attR	TTTGGGTGGAAAAGAATTTAAGCTCAAATTAATCTGACAGACACGGTAATTTAAAACGGGGGACTGTCAGATTAGGTTTGATCTTCTACA	NA	NA	NA	NA
WP_006250098.1|1302339_1302585_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1302577_1303147_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1303119_1303470_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1304039_1304564_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1304547_1305768_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1305764_1307141_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1307094_1308033_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1308019_1309390_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1309382_1309817_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1309831_1310821_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251227.1|1311113_1311491_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1311490_1311835_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1311836_1312205_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1312201_1312582_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1312585_1313068_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1313107_1313524_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1313579_1313756_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1313851_1314523_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1314537_1314771_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1314939_1315398_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1315942_1318438_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1318441_1318771_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1318770_1319241_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1319248_1319965_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_006249177.1|1319968_1320700_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_147015534.1|1320968_1321598_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	99.5	1.3e-109
WP_075270690.1|1321607_1325339_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008794.1|1325335_1328329_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.7	0.0e+00
WP_100067196.1|1328328_1328772_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1328772_1329372_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1329486_1329780_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1330326_1330845_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484183.1|1330914_1331505_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249380.1|1331924_1333472_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1333468_1334068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1334079_1334898_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1334933_1335206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1335202_1335553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1335563_1336757_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1336770_1337616_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1337778_1338015_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1338253_1340272_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1340274_1340685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1340905_1341994_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1342012_1342978_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1342992_1343490_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1343663_1344308_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1344307_1344715_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1344911_1345871_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1345950_1346211_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1346260_1347151_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1347280_1349887_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1349936_1350875_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249030.1|1350888_1351965_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1351995_1352751_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1352902_1353112_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1353160_1353883_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1353930_1355118_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1355251_1356370_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1356426_1356909_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1356919_1359580_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1359731_1360571_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1360659_1361742_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1361828_1362521_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1541126	1670093	2729419	portal,terminase,tRNA,head,plate,integrase,tail,holin,capsid,transposase	Mannheimia_phage(92.8%)	154	1662140:1662158	1678909:1678927
WP_006248143.1|1541126_1543754_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1543948_1544374_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1544604_1545378_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1545521_1546313_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1546365_1546662_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1546686_1546965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1547124_1549101_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1549192_1549993_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1550360_1551359_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1551636_1551819_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1552088_1552379_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1552353_1552623_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1552612_1552945_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1552955_1553408_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1553407_1553740_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1553752_1556113_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1556109_1556442_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1556438_1556681_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1556832_1557126_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1557138_1557471_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1557553_1557826_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1557958_1558204_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1558302_1558515_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1558638_1559325_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1559328_1559847_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1559864_1560275_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1560374_1560635_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1560669_1561476_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1561658_1562897_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1562896_1563334_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1563335_1563683_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1563746_1563863_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1563886_1564201_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1564279_1564786_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1564794_1565976_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1566389_1566632_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1566632_1568912_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1568914_1569547_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1569533_1570451_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1570447_1570783_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1570782_1571388_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_015586960.1|1571667_1572708_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.7	5.5e-201
WP_021265529.1|1572742_1573012_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LP36	Mannheimia_phage	91.7	3.6e-40
WP_006250778.1|1573004_1573184_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_006248191.1|1576196_1576475_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_062716029.1|1576525_1576984_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	99.3	9.8e-78
WP_006248193.1|1576976_1577462_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1577458_1577680_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1577828_1578284_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1578280_1578847_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1578839_1579046_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1579051_1579264_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1579260_1579776_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1579887_1580577_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1580586_1581615_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1581628_1582456_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1582569_1584408_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1584416_1585457_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1586232_1587237_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1587461_1587857_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1587943_1589026_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1589155_1589386_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1589394_1590447_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1590517_1591411_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1591397_1592363_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1592365_1594117_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1594109_1595069_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1595377_1595959_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1595999_1596452_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1596455_1596776_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1596772_1597372_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1597414_1597933_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1597983_1599675_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1599677_1600496_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1600583_1601432_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1601559_1603281_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1603365_1604049_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1604058_1605588_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1605812_1606559_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249163.1|1606723_1609537_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1609639_1610869_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1611161_1612322_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1612330_1613200_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1613270_1614716_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1614820_1615807_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1615797_1616436_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1617619_1618210_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1618279_1618798_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1618944_1619256_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1619631_1619925_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147016025.1|1620047_1627097_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	99.4	0.0e+00
WP_147016026.1|1627099_1627690_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	92.3	3.5e-96
WP_142778495.1|1627772_1628435_-	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	38.4	1.4e-40
WP_142778496.1|1629068_1629800_-|tail	phage tail protein	tail	A0A0M3LP75	Mannheimia_phage	97.5	1.3e-143
WP_142778497.1|1629803_1630520_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	98.3	2.3e-134
WP_006253542.1|1630527_1633554_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	100.0	0.0e+00
WP_006253540.1|1633617_1634310_-	hypothetical protein	NA	A0A0M3LQM1	Mannheimia_phage	96.1	5.5e-48
WP_006253539.1|1634396_1634720_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	100.0	2.5e-59
WP_006250119.1|1634721_1635048_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	100.0	7.5e-56
WP_006250118.1|1635062_1635464_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	100.0	6.6e-70
WP_006250117.1|1635553_1636576_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	100.0	3.7e-186
WP_006250116.1|1636585_1636978_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	100.0	9.3e-69
WP_006250115.1|1636977_1637391_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	100.0	1.9e-72
WP_006250114.1|1637383_1637755_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	100.0	1.7e-67
WP_006250113.1|1637754_1638192_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	100.0	3.0e-76
WP_006250112.1|1638181_1638532_-	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	100.0	4.6e-59
WP_006250111.1|1638591_1639539_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	100.0	4.7e-175
WP_006250110.1|1639604_1640339_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	100.0	1.7e-124
WP_006250109.1|1640456_1640870_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	100.0	2.3e-73
WP_006250108.1|1640870_1641089_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	100.0	2.6e-36
WP_006250107.1|1641088_1642750_-	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	100.0	4.6e-311
WP_006250106.1|1642697_1644101_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	100.0	3.3e-265
WP_020849857.1|1644113_1645346_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	100.0	2.8e-244
WP_006250104.1|1645329_1645854_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_006250100.1|1646423_1646774_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1646746_1647316_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1647308_1647554_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1647892_1648078_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1648397_1648871_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1648860_1649430_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1649557_1649752_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1649797_1650010_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1650059_1650566_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1650549_1650765_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1650855_1651392_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1651388_1652750_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1652746_1653616_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1653924_1654185_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1654205_1654412_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1654541_1655201_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1655251_1655632_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_021279966.1|1655624_1656122_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_096864247.1|1656231_1657272_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1657409_1657715_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1657723_1657999_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1658290_1658521_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1658902_1659139_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1659707_1660214_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1660217_1660577_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1660573_1661053_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1661186_1661399_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1661411_1662362_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1662140:1662158	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1662402_1663197_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1663193_1663829_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250260.1|1664038_1664491_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1664568_1665096_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1665092_1665296_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1665279_1665744_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1665747_1665936_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1666397_1666613_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1667157_1667859_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006253376.1|1668376_1668760_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	2.0e-68
WP_006247823.1|1668809_1669031_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1669052_1670093_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1678909:1678927	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 8
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1675666	1763719	2729419	portal,terminase,tRNA,integrase,tail,holin,transposase	Mannheimia_phage(56.36%)	99	1684202:1684235	1707515:1707548
WP_006247813.1|1675666_1678525_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247812.1|1678809_1679103_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1679246_1679636_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1679607_1679907_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1680083_1680770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1681171_1681372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1681502_1682186_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1682260_1682641_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1682633_1683131_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1683262_1683445_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1683483_1683903_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
1684202:1684235	attL	CTACATTCACTAAGAATTTTTATCAAAGCCCTTT	NA	NA	NA	NA
WP_006253274.1|1684238_1684883_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_096864247.1|1685020_1686061_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253513.1|1686127_1687534_-	YdgA family protein	NA	NA	NA	NA	NA
WP_006248821.1|1687583_1688390_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006248820.1|1688391_1689582_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248819.1|1689593_1690346_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006253512.1|1690571_1692104_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248816.1|1692540_1692942_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006248815.1|1693011_1693851_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248814.1|1693887_1694571_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248812.1|1694838_1695912_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248811.1|1696038_1697094_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
WP_006248810.1|1697053_1697329_-	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248809.1|1697354_1697846_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248808.1|1697908_1698751_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248807.1|1698797_1698923_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248806.1|1699069_1699279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248805.1|1699281_1699575_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248804.1|1699567_1700005_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248801.1|1700243_1700921_-	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248800.1|1701168_1702008_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248797.1|1702237_1702615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484162.1|1702746_1702935_+	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248795.1|1702938_1703436_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_006248794.1|1703419_1703620_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248793.1|1703616_1704135_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248792.1|1704244_1705048_-	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248791.1|1705117_1705477_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248790.1|1705512_1705971_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248789.1|1705973_1706171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248788.1|1706154_1706340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248787.1|1706553_1706829_+	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248786.1|1706831_1707083_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_015484163.1|1707535_1707766_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
1707515:1707548	attR	AAAGGGCTTTGATAAAAATTCTTAGTGAATGTAG	NA	NA	NA	NA
WP_015484164.1|1708029_1709142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249427.1|1709138_1709642_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_006249426.1|1709646_1710378_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249425.1|1710504_1710729_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249424.1|1710777_1711539_+	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249423.1|1711535_1712327_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249422.1|1712314_1712950_+	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_015484167.1|1712946_1713519_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_015587038.1|1713588_1714617_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_006249418.1|1714609_1714969_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015484169.1|1714958_1715318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587037.1|1715397_1716204_+	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006249199.1|1716367_1716715_+|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015484172.1|1716704_1717301_+	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249197.1|1717301_1717652_+	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_006249195.1|1717965_1718364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249194.1|1718511_1718988_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249193.1|1718987_1721099_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249192.1|1721095_1721320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249191.1|1721319_1722819_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249190.1|1722830_1724792_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249189.1|1724865_1725189_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249188.1|1725181_1725484_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1725487_1726012_+|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249186.1|1726008_1726404_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249185.1|1726431_1727073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249184.1|1727156_1727558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1727602_1727833_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249181.1|1727895_1728123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249180.1|1728176_1731743_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249179.1|1731742_1732072_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249178.1|1732071_1732788_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_020828760.1|1732791_1733523_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249176.1|1733791_1734421_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_075272501.1|1734430_1738162_+	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147008795.1|1738158_1741485_+	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_006247812.1|1741607_1741901_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006248119.1|1742205_1743708_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1743861_1745337_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1746612_1746906_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1746972_1747986_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_134916814.1|1748088_1748382_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1748382_1749303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1749329_1750004_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1750003_1750867_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1750876_1752658_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1752679_1753357_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_134983790.1|1755339_1755801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1755959_1757096_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1757142_1757559_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1757620_1758214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1758344_1760633_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1760896_1762660_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1762756_1763719_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1889122	1899439	2729419		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1889122_1890097_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1890099_1890297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1890280_1890466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1891111_1891708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1891743_1892481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1892632_1893007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1893018_1893675_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1893799_1893988_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1894045_1894729_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1894725_1895772_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1895782_1896376_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1898485_1898809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1898889_1899057_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1899064_1899439_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 10
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	1902672	1909616	2729419	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1902672_1903383_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1903640_1904360_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1904581_1905208_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1905256_1905868_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1905978_1906665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1906841_1907141_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1907112_1907502_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1907645_1907939_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1908317_1909616_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 11
NZ_CP017521	Mannheimia haemolytica strain 1584 chromosome, complete genome	2729419	2342839	2350994	2729419	integrase,terminase	Synechococcus_phage(16.67%)	12	2346045:2346104	2351410:2351483
WP_006250276.1|2342839_2343379_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2343516_2343807_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2343778_2344081_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2344098_2344392_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2344342_2344555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2344557_2345517_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2346045:2346104	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2346323_2347550_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2347824_2348043_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2348155_2348479_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2348873_2349560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2349879_2350305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2350301_2350994_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2351410:2351483	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
