The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	43941	51268	2640172	tail,transposase	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|43941_44184_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44184_46245_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|46241_46799_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|46747_47743_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|47795_47984_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48013_48382_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|48381_48756_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49245_50049_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50093_50372_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|50548_51268_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	533837	591633	2640172	plate,tail,tRNA,transposase	Burkholderia_phage(19.05%)	61	NA	NA
WP_006253631.1|533837_534998_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_006251771.1|535038_535386_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	51.8	8.3e-21
WP_006251772.1|535369_535621_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.9	5.8e-16
WP_006251773.1|535840_536395_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_006249721.1|536394_538719_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_006249720.1|538789_539353_-	nitroreductase	NA	NA	NA	NA	NA
WP_006249718.1|539455_541312_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_006251776.1|541352_541529_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_080542704.1|541536_541746_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_006249715.1|541784_542957_-	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_006249714.1|542949_544479_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_006249713.1|544778_546092_-	MFS transporter	NA	NA	NA	NA	NA
WP_006249712.1|546084_546903_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_006249710.1|547112_548894_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	59.0	1.0e-207
WP_006249709.1|548890_549364_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_006249708.1|549576_549795_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_006249707.1|549804_551457_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	33.3	2.5e-62
WP_006249706.1|551798_553301_+	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_006249705.1|553319_553976_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_006249704.1|553975_554653_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_006249703.1|554652_555600_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_006249702.1|555869_557774_+	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
WP_006249701.1|557770_558304_+	redoxin family protein	NA	NA	NA	NA	NA
WP_006249700.1|558293_558746_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_006249699.1|558732_559494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249698.1|559545_560940_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.8	7.5e-28
WP_006249696.1|561164_561968_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	33.7	6.4e-24
WP_006249695.1|561960_562737_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_006249694.1|562757_563282_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_006249693.1|563327_563963_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_006249692.1|563974_564298_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_006249691.1|564330_564591_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006249690.1|564700_565981_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006249689.1|566046_566625_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	3.8e-10
WP_006249688.1|566691_567219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249687.1|567348_568089_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006249686.1|568101_568542_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_006249685.1|568677_569553_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249684.1|569660_570497_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015484421.1|570571_573424_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_006249683.1|573471_574149_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|574362_574581_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|574590_576561_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|576740_577229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147009615.1|577260_577614_+	hypothetical protein	NA	A0A0C4UQR3	Shigella_phage	43.6	4.5e-14
WP_147009616.1|577558_577759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249643.1|577742_577970_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|577962_579027_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|579013_579550_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|579604_579967_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|579976_581080_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|581072_581639_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|581648_583928_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|583928_584531_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|584514_584790_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|584789_585077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|585243_585948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095586252.1|586116_586236_+	adhesin	NA	NA	NA	NA	NA
WP_006249630.1|586283_587072_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|587108_589547_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|589866_591633_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
>prophage 3
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	1035463	1042248	2640172		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1035463_1036246_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1036255_1036984_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1037119_1038139_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1038140_1038743_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1038871_1039027_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1039104_1039686_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1039700_1040348_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1040451_1041081_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1041195_1042248_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 4
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	1223103	1322654	2640172	integrase,tRNA,terminase,tail,protease,capsid,transposase	Mannheimia_phage(85.0%)	117	1222889:1222907	1245034:1245052
1222889:1222907	attL	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250229.1|1223103_1224054_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1224064_1224724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1224733_1224940_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_006250224.1|1225409_1226624_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1226995_1227733_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1227764_1228151_-	RidA family protein	NA	NA	NA	NA	NA
WP_006249038.1|1228231_1229233_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249037.1|1229299_1229641_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1229833_1231174_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1231335_1232301_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1232567_1234238_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1234398_1234842_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1234892_1235468_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1235574_1236465_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1236531_1237098_-	elongation factor P	NA	NA	NA	NA	NA
WP_006253558.1|1237264_1237834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249378.1|1237887_1238880_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1238979_1240383_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1240855_1241845_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1241841_1242099_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1242125_1242617_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1243116_1243581_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1243564_1243768_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1243764_1244292_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1244369_1244822_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1245031_1245667_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
1245034:1245052	attR	AAAAAGCCCCTTTCGGGGC	NA	NA	NA	NA
WP_006250257.1|1245663_1246458_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1246498_1247449_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1247461_1247674_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1247807_1248287_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1248283_1248643_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1248646_1249153_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1249721_1249958_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1250339_1250570_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1250861_1251137_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1251145_1251451_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_015586954.1|1251588_1252629_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_020824298.1|1252738_1253236_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_006248823.1|1253228_1253609_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1253659_1254319_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1254448_1254655_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1254675_1254936_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1255244_1256114_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1256110_1257472_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1257468_1258005_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1258095_1258311_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1258294_1258801_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_015586954.1|1258985_1260026_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_147009647.1|1260064_1260271_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	1.5e-25
WP_006250091.1|1260316_1260511_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250093.1|1260638_1261208_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250094.1|1261197_1261671_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006251707.1|1261990_1262176_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1262514_1262760_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1262752_1263322_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1263294_1263645_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1264214_1264739_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_020824318.1|1264722_1265943_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1265939_1267316_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1267269_1268208_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1268194_1269565_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1269557_1269992_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1270006_1270996_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_075271287.1|1271007_1271241_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.3e-21
WP_006251227.1|1271243_1271621_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1271620_1271965_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1271966_1272335_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1272331_1272712_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1272715_1273198_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1273237_1273654_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1273709_1273886_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1273981_1274653_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1274667_1274901_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1275069_1275528_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1276072_1278568_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1278571_1278901_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1278900_1279371_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1279378_1280095_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_006249177.1|1280098_1280830_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_006249176.1|1281098_1281728_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_015484183.1|1284288_1284879_+	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249172.1|1284948_1285467_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484180.1|1286013_1286307_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006250517.1|1286421_1287021_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|1287021_1287465_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_095597182.1|1287464_1290458_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	99.9	0.0e+00
WP_147009629.1|1292057_1293605_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1293601_1294201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1294212_1295031_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1295066_1295339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1295335_1295686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1295696_1296890_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1296903_1297749_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1297911_1298148_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1298386_1300405_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1300407_1300818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1301038_1302127_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1302145_1303111_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1303125_1303623_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1303796_1304441_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1304440_1304848_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1305044_1306004_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1306083_1306344_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1306393_1307284_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1307413_1310020_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1310069_1311008_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249030.1|1311021_1312098_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1312128_1312884_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1313035_1313245_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1313293_1314016_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1314063_1315251_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1315384_1316503_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1316559_1317042_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1317052_1319713_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1319864_1320704_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1320792_1321875_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1321961_1322654_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	1467134	1643674	2640172	transposase,integrase,tRNA,head,terminase,tail,portal,capsid,holin,plate	Mannheimia_phage(89.93%)	199	1606390:1606449	1643673:1644874
WP_147009634.1|1467134_1468121_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.0	7.9e-32
WP_006249338.1|1468349_1469009_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006249339.1|1469068_1470394_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_006249340.1|1470494_1471247_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_006249341.1|1471246_1472152_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006249342.1|1472160_1472724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249343.1|1472723_1473500_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1477090_1477486_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1477502_1477931_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1478229_1478625_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006248129.1|1478785_1480357_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1480373_1480685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1480806_1481478_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006248132.1|1481598_1483062_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.9	3.9e-96
WP_006248134.1|1486469_1487675_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006248135.1|1487705_1488278_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1488516_1488738_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1488742_1490476_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_015484232.1|1490542_1491244_-	MFS transporter	NA	NA	NA	NA	NA
WP_006251537.1|1491240_1491621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248138.1|1491662_1496123_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_006248139.1|1496298_1497015_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_006248140.1|1497063_1498407_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_006248141.1|1498671_1499559_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	5.6e-61
WP_006248142.1|1499694_1499880_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006248143.1|1499969_1502597_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1502791_1503217_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1503447_1504221_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1504364_1505156_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1505208_1505505_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1505529_1505808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1505967_1507944_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1508035_1508836_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1509203_1510202_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1510479_1510662_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1510931_1511222_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1511196_1511466_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1511455_1511788_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1511798_1512251_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1512250_1512583_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1512595_1514956_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1514952_1515285_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1515281_1515524_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1515675_1515969_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1515981_1516314_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1516396_1516669_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1516801_1517047_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1517145_1517358_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1517481_1518168_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1518171_1518690_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1518707_1519118_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1519217_1519478_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1519512_1520319_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1520501_1521740_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1521739_1522177_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1522178_1522526_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1522589_1522706_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1522729_1523044_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1523122_1523629_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1523637_1524819_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1525200_1525443_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_147009635.1|1525443_1527723_-|tail	phage tail protein	tail	A0A0M3LQQ3	Mannheimia_phage	99.6	0.0e+00
WP_147009206.1|1527725_1528271_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	98.9	7.8e-98
WP_006248186.1|1528257_1529175_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1529171_1529507_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1529506_1530112_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1530240_1530528_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006250778.1|1530520_1530700_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_006248190.1|1530761_1533674_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1533712_1533991_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1534041_1534500_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1534492_1534978_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1534974_1535196_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1535344_1535800_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1535796_1536363_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1536355_1536562_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1536567_1536780_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1536776_1537292_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1537403_1538093_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1538102_1539131_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1539144_1539972_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1540085_1541924_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1541932_1542973_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1543748_1544753_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1544977_1545373_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1545459_1546542_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1546671_1546902_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1546910_1547963_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1548033_1548927_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1548913_1549879_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1549881_1551633_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1551625_1552585_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1552893_1553475_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1553515_1553968_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1553971_1554292_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1554288_1554888_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1554930_1555449_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006249157.1|1557192_1558011_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1558098_1558947_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1559074_1560796_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1560880_1561564_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1561573_1563103_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1563327_1564074_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249163.1|1564238_1567052_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1567154_1568384_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1568676_1569837_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1569845_1570715_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1570785_1572231_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1572335_1573322_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1573312_1573951_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1575134_1575725_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1575794_1576313_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1576459_1576771_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1577146_1577440_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147009636.1|1577562_1584612_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	96.5	0.0e+00
WP_006248123.1|1584614_1585205_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	100.0	2.3e-103
WP_006248125.1|1585473_1586205_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.1	3.3e-144
WP_006248126.1|1586208_1586925_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	99.2	8.0e-135
WP_006253542.1|1586932_1589959_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	100.0	0.0e+00
WP_006253540.1|1590022_1590715_-	hypothetical protein	NA	A0A0M3LQM1	Mannheimia_phage	96.1	5.5e-48
WP_006253539.1|1590801_1591125_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	100.0	2.5e-59
WP_006250119.1|1591126_1591453_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	100.0	7.5e-56
WP_006250118.1|1591467_1591869_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	100.0	6.6e-70
WP_006250117.1|1591958_1592981_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	100.0	3.7e-186
WP_006250116.1|1592990_1593383_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	100.0	9.3e-69
WP_006250115.1|1593382_1593796_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	100.0	1.9e-72
WP_006250114.1|1593788_1594160_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	100.0	1.7e-67
WP_006250113.1|1594159_1594597_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	100.0	3.0e-76
WP_006250112.1|1594586_1594937_-	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	100.0	4.6e-59
WP_006250111.1|1594996_1595944_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	100.0	4.7e-175
WP_006250110.1|1596009_1596744_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	100.0	1.7e-124
WP_006250109.1|1596861_1597275_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	100.0	2.3e-73
WP_006250108.1|1597275_1597494_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	100.0	2.6e-36
WP_006250107.1|1597493_1599155_-	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	100.0	4.6e-311
WP_006250106.1|1599102_1600506_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	100.0	3.3e-265
WP_020849857.1|1600518_1601751_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	100.0	2.8e-244
WP_006250104.1|1601734_1602259_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_020824300.1|1602650_1602884_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1602828_1603179_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1603151_1603721_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1603713_1603959_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1604297_1604483_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1604802_1605276_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1605265_1605835_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1605962_1606157_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_147009647.1|1606202_1606409_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	1.5e-25
1606390:1606449	attL	TGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGATT	NA	NA	NA	NA
WP_015586954.1|1606447_1607488_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_006253274.1|1607625_1608270_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1608605_1609025_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006250075.1|1609063_1609246_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006253272.1|1609377_1609875_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	98.9	9.1e-45
WP_006248823.1|1609867_1610248_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1610322_1611006_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1611136_1611337_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1611738_1612425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1612601_1612901_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015484247.1|1612872_1613262_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1613405_1613699_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247813.1|1613983_1616842_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247814.1|1616952_1617594_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_006247815.1|1617673_1617994_+	trp operon repressor	NA	NA	NA	NA	NA
WP_006250687.1|1617968_1618754_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_006247817.1|1618765_1619485_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_006247818.1|1619481_1620393_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_006247820.1|1620549_1621818_+	malic enzyme	NA	NA	NA	NA	NA
WP_006247821.1|1621969_1622257_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_006247822.1|1622415_1623456_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
WP_006247823.1|1623477_1623699_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006253376.1|1623748_1624132_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	2.0e-68
WP_006253375.1|1624649_1625351_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247827.1|1625895_1626111_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253371.1|1626572_1626761_+	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006250263.1|1626764_1627229_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1627212_1627416_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1627412_1627940_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1628017_1628470_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1628679_1629315_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1629311_1630106_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1630146_1631097_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1631109_1631322_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1631455_1631935_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1631931_1632291_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1632294_1632801_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1633369_1633606_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1633987_1634218_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1634509_1634785_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1634793_1635099_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_015586954.1|1635236_1636277_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_006250089.1|1636461_1636968_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1636951_1637167_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1637257_1637794_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1637790_1639152_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1639148_1640018_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1640326_1640587_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1640607_1640814_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1640943_1641603_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1641653_1642034_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1642026_1642524_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_015586954.1|1642633_1643674_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
1643673:1644874	attR	AATCTGACAGACACGGTAATTTAAAACGGGGGACTGTCAGATTAGGTTTGATCTTCTACAAATTATGATTATTGCCCGAGTGAGCCTGCTCCCATCACAATCATAAACAGAGCCATTTGAAGTTCATCTTCGGTCAGTTCACGTCCGTTTAAATTCACTTTTCCGTTATCTATAGTTAATTCAATCTTCACATTGTTGTCATCTACTTTTCTTAATCCGTACTGTTCAACTCCCGCATTGAGAAAAACAGCATCAACTTGTTGCTTGGCAAATGCTTTCGCCTCTTCTTCGCCTAATTTTTCTGTAACTATTGAGACTTGGCGAATAATATCTTCCGCATATTGACGGTTGATATTTGAAGTGAATTTACTTGTTGAAAGGGCTTGCAATACCGCTTGCATATTACCAAGATTTTGTGGGTCAAATTGAGCCATATTCAGTAATAAAGCCAAATCAACTTTGCCTTTGCTGTTTTCAAGTGAGAAATTATTAATATGGAATTTAAATGATTTTGCTAATAGTTGTAATAATAACTCGCCTGTTTTTTCATTTTCTAATGTTTGAGGATTAGATAATAAAGGCGTAATATCATTGGTTAATTTAGCATCTAAATCGTATGCCATATCCATTTTTAATTTACCCATTTCAACACCCTCAATGTTGAAAGTGGCTGCCTCTAAATCTCCGGTAGAAATTAAACGATCGCCTTTTAATAGATTATCGCCCTTCACCACAACATCTTTAATTTGAGATAATTTGCCATCTTTAGACTTAAACTCAATAGCGTTAATTTTTCCACTACCTTTGCCTAAAGTTAAATTAGGATAACTTTCATTATTTTCTGTTTGAACATCATAAACTATACCTTGAATTTGAAAATCAAATTCTTCTGCTTTTATCTTAAGACTTTCTAGCTCAACAGTGCTATCAACCCCTTTTAATTTTTGGTCGTAGCTATATTGCACTTTGATTGGCGTGGTTTCAATATGACCTGTTTCATCACTATGTTTAATCGGGGAAATATCAAAATGCCCTTCCACATCGCCCGAATAGCTGATATTAGAAAAACCGGTGCCAATATGTTCACCCATCAATTTTTTAAGGGCTTCAGGAGCTTGTAATTTGCTTTCCGCACTCATCATTACAGGAGCTAAATTAAGTTTCGCTAAACGATTAAGCGGTAGCGGACCGTGATGAAGTTT	NA	NA	NA	NA
>prophage 6
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	1800864	1811182	2640172		Mannheimia_phage(50.0%)	14	NA	NA
WP_006249218.1|1800864_1801839_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1801841_1802039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1802022_1802208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1802853_1803450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1803485_1804223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1804374_1804749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1804760_1805417_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1805541_1805730_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1805787_1806471_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1806467_1807514_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1807524_1808118_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1810228_1810552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1810632_1810800_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1810807_1811182_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
>prophage 7
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	1814415	1821359	2640172	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006253312.1|1814415_1815126_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1815383_1816103_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1816324_1816951_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1816999_1817611_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1817721_1818408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1818584_1818884_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1818855_1819245_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1819388_1819682_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1820060_1821359_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
>prophage 8
NZ_CP017523	Mannheimia haemolytica strain 1582 chromosome, complete genome	2640172	2254624	2262779	2640172	integrase,terminase	Synechococcus_phage(16.67%)	12	2257830:2257889	2263195:2263268
WP_006250276.1|2254624_2255164_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2255301_2255592_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2255563_2255866_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2255883_2256177_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2256127_2256340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2256342_2257302_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2257830:2257889	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2258108_2259335_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2259609_2259828_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2259940_2260264_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2260658_2261345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2261664_2262090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2262086_2262779_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2263195:2263268	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
