The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	696471	746652	2592266	tail,transposase,plate,terminase,head,integrase	Mannheimia_phage(79.17%)	61	745471:745530	751555:751970
WP_061888624.1|696471_697512_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.4	1.8e-196
WP_051138299.1|697635_698196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831169.1|698176_700108_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_006253059.1|700250_700433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080542692.1|700582_701623_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_006248779.1|701622_702096_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006251194.1|702085_703294_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006248781.1|703556_704789_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_006251193.1|704855_705842_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_006248783.1|705882_706293_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_006251191.1|706358_707669_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	6.8e-132
WP_020831176.1|708083_708803_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	2.6e-64
WP_020831178.1|708979_709258_+	DNA-binding protein	NA	F6MII4	Haemophilus_phage	58.8	2.0e-17
WP_006251264.1|711184_712066_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	99.3	1.7e-155
WP_020831183.1|712076_712325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251265.1|712334_712655_+	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	90.3	1.8e-41
WP_005822932.1|712657_712849_+	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_006251266.1|712861_713479_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	99.5	3.7e-112
WP_006251267.1|713797_714010_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.4	1.9e-15
WP_032844828.1|714015_714198_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	98.3	5.0e-25
WP_006251269.1|714220_714796_+	DUF5420 family protein	NA	A0A0M3LP85	Mannheimia_phage	93.2	1.3e-98
WP_032848912.1|714808_715177_+	hypothetical protein	NA	F6MIJ4	Haemophilus_phage	53.0	1.5e-31
WP_006251272.1|715418_715973_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	98.4	9.7e-96
WP_020831190.1|715956_716379_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	97.1	3.3e-72
WP_020831192.1|716734_717334_+	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	55.0	8.7e-26
WP_006251275.1|717344_717551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251276.1|717643_718534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006251277.1|718661_719093_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.2	3.3e-51
WP_006248646.1|719178_719712_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	100.0	5.6e-101
WP_020831193.1|719714_719957_+	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	91.4	3.2e-35
WP_020831194.1|719953_720313_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	86.6	3.8e-53
WP_005606396.1|720475_720733_+	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	9.5e-14
WP_005606393.1|720732_720987_+	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	100.0	6.1e-29
WP_006251281.1|720994_721495_+	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	8.8e-80
WP_020831198.1|721644_723270_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	97.4	0.0e+00
WP_020831201.1|723338_725012_+	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.8	1.2e-298
WP_006251285.1|724998_726288_+|head	head morphogenesis protein	head	B7SDN5	Haemophilus_phage	85.5	2.1e-218
WP_006251286.1|726435_726852_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	96.4	2.3e-70
WP_132303683.1|726848_727067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020831206.1|727110_728178_+	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	93.2	1.1e-183
WP_006251289.1|728177_729095_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	84.9	5.6e-149
WP_115262444.1|729140_729458_+	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	90.8	1.9e-27
WP_006248659.1|729457_729883_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	100.0	4.0e-73
WP_006248660.1|729879_730521_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	100.0	4.0e-117
WP_006248661.1|730521_730701_+	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	100.0	2.2e-25
WP_020831214.1|730700_732110_+|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	99.4	7.6e-254
WP_006251294.1|732120_732495_+|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	99.2	3.3e-63
WP_006251295.1|732494_732863_+	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	98.4	1.0e-61
WP_006251296.1|732892_733081_+	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006251297.1|733133_735413_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	95.5	0.0e+00
WP_006251298.1|735412_736705_+	hypothetical protein	NA	A0A0M3LQ21	Mannheimia_phage	95.6	1.2e-232
WP_006248665.1|736707_737835_+	hypothetical protein	NA	A0A0M3LPS4	Mannheimia_phage	99.7	1.6e-209
WP_006251299.1|737836_738487_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	87.4	6.0e-97
WP_020831216.1|738595_738946_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	98.3	1.2e-59
WP_020831218.1|738958_740020_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	99.7	1.7e-194
WP_006251302.1|740019_740586_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	71.6	1.9e-70
WP_020831220.1|740586_743313_+	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	90.6	0.0e+00
WP_020824100.1|743313_743937_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_006252023.1|743929_744394_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_050412813.1|744514_745303_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.7	7.8e-107
745471:745530	attL	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTT	NA	NA	NA	NA
WP_006248925.1|745887_746652_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
WP_006248925.1|745887_746652_+|integrase	site-specific integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	29.0	8.0e-08
751555:751970	attR	TTTGCAAGAGACTGGACAGCCTTATGATAAGGAAACAATTAATAATCTCCAGTATGATTTTCAAGGATTAGGGATTCATTCACCTAAAAACACAATGACCAACGGTAAGCCGGATACCATCAATTTTTGGAAATGTGATGTCATTGGACCGAGAAAGACTTCCTCTTTAACAGGATATTTGATAAAAAATACCCGTCTCTTTTTTGGGGATAAGGTACTATTAAATAATCACTGTTTAACTTTACAGAAAGAGGAAACTTAAAATGATAACTTCTATCTCTTTTGATTCGCTACTAGACCGATTTTTTTTTCTATCGTCACTATCTTCGTCCGGATACCAAACGGAGCTACAACAACGTAATCCGAATTATCAAAAAGCGTTATCCAAAGTTAAATGCCAATGACATTACCACCGA	NA	NA	NA	NA
>prophage 2
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	999312	1006097	2592266		Mycobacterium_phage(16.67%)	9	NA	NA
WP_031200389.1|999312_1000095_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006252001.1|1000104_1000833_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	1.2e-21
WP_006248949.1|1000968_1001988_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1001989_1002592_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1002720_1002876_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1002953_1003535_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1003549_1004197_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1004300_1004930_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1005044_1006097_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 3
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	1316590	1392636	2592266	portal,tail,tRNA,capsid,transposase,plate,terminase,head,holin,integrase	Mannheimia_phage(85.0%)	84	1319007:1319023	1361034:1361050
WP_006252789.1|1316590_1318978_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	4.7e-06
1319007:1319023	attL	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_006249336.1|1319025_1320012_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1320240_1320900_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006251547.1|1322384_1323137_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_020824087.1|1323136_1324036_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006251545.1|1324044_1324608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251544.1|1324607_1325384_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1325483_1325879_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1325895_1326324_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1326622_1327018_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006251541.1|1327178_1328750_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1328766_1329078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1329199_1329871_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006252792.1|1329991_1331455_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	8.8e-96
WP_006248133.1|1331682_1334850_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1334863_1336069_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_147009692.1|1336099_1336672_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1336910_1337132_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1337136_1338870_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_006251537.1|1339581_1339962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251536.1|1340003_1344464_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020824088.1|1344639_1345356_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_142777995.1|1345404_1346748_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_020824090.1|1347005_1347893_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	8.6e-62
WP_006248142.1|1348028_1348214_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006252798.1|1348303_1350931_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.3	9.3e-80
WP_006252799.1|1351125_1351551_-	universal stress protein	NA	NA	NA	NA	NA
WP_006252800.1|1351781_1352555_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006252801.1|1352698_1353490_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1353542_1353839_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006251532.1|1353863_1354142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252803.1|1354301_1356278_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006251529.1|1356369_1357182_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	35.6	4.5e-09
WP_006248153.1|1357549_1358548_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1358825_1359008_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1359277_1359568_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1359542_1359812_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1359801_1360134_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1360144_1360597_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1360596_1360929_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_061888586.1|1360941_1363302_-	replication endonuclease	NA	A0A0M3LNQ7	Mannheimia_phage	100.0	0.0e+00
1361034:1361050	attR	AAATTTTTAACCGCTTG	NA	NA	NA	NA
WP_061888587.1|1363298_1363631_-	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	100.0	9.3e-62
WP_006248162.1|1363627_1363870_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_042803562.1|1364020_1364314_-	hypothetical protein	NA	A0A0M3LPS8	Mannheimia_phage	100.0	1.1e-50
WP_006248165.1|1364322_1364655_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1364737_1365010_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1365149_1365395_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1365493_1365706_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1365829_1366516_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_061888588.1|1366519_1367038_+	hypothetical protein	NA	A0A0M3LNP7	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1367055_1367466_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_020824044.1|1367577_1368618_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_061888665.1|1368677_1369052_-	hypothetical protein	NA	A0A0M3LQX4	Mannheimia_phage	100.0	1.6e-73
WP_061888664.1|1369051_1370293_-	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	100.0	1.2e-218
WP_061888663.1|1370292_1370730_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	100.0	2.5e-75
WP_006250974.1|1370729_1371116_-	hypothetical protein	NA	A0A0M3LPZ9	Mannheimia_phage	100.0	2.0e-63
WP_100067200.1|1371176_1371317_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	93.5	1.5e-18
WP_006248177.1|1371316_1371631_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006250976.1|1371711_1372218_-|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	100.0	3.5e-92
WP_061888662.1|1372226_1373408_-|tail	phage tail sheath protein	tail	A0A0M3LPE9	Mannheimia_phage	100.0	8.1e-225
WP_061888661.1|1373509_1373773_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	100.0	5.7e-46
WP_061888660.1|1373741_1374377_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	100.0	1.1e-119
WP_062627915.1|1374377_1377392_-	hypothetical protein	NA	A0A0M3LQ17	Mannheimia_phage	99.8	0.0e+00
WP_061888620.1|1377394_1377934_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	100.0	4.5e-98
WP_061888619.1|1377920_1378838_-|plate	baseplate assembly protein	plate	A0A0M3LPQ9	Mannheimia_phage	100.0	1.5e-165
WP_006250780.1|1378834_1379170_-	hypothetical protein	NA	A0A0M3LQ08	Mannheimia_phage	100.0	5.9e-56
WP_006248188.1|1379169_1379775_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_062627916.1|1379903_1380191_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LNM7	Mannheimia_phage	100.0	6.2e-46
WP_006250778.1|1380183_1380363_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_061888618.1|1380424_1383337_-|tail	phage tail protein	tail	A0A0M3LPE0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1383375_1383654_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_061888617.1|1383704_1384163_-	phage virion morphogenesis protein	NA	A0A0M3LNN0	Mannheimia_phage	100.0	6.8e-79
WP_061888616.1|1384155_1384641_-|tail	phage tail protein	tail	A0A0M3LRW0	Mannheimia_phage	100.0	4.5e-89
WP_006248194.1|1384637_1384859_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1385007_1385463_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006252831.1|1385459_1386026_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1386018_1386225_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1386230_1386443_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1386439_1386955_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_061888615.1|1387066_1387756_-|terminase	terminase endonuclease subunit	terminase	A0A0M3LP11	Mannheimia_phage	100.0	2.2e-121
WP_006250769.1|1387765_1388794_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	100.0	3.5e-192
WP_006252839.1|1388807_1389635_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	100.0	5.4e-135
WP_081107628.1|1389748_1391587_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M3LRV4	Mannheimia_phage	100.0	0.0e+00
WP_061888613.1|1391595_1392636_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	100.0	2.7e-200
>prophage 4
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	1424686	1477268	2592266	holin,terminase,head,integrase	Mannheimia_phage(45.28%)	70	1427261:1427280	1477420:1477439
WP_006252023.1|1424686_1425151_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	63.0	2.6e-54
WP_020824100.1|1425143_1425767_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	97.1	1.1e-111
WP_020824101.1|1425767_1428707_-	hypothetical protein	NA	A0A0M3LS19	Mannheimia_phage	93.5	0.0e+00
1427261:1427280	attL	CAAACGTGCTTAATTCTTGA	NA	NA	NA	NA
WP_006252064.1|1428779_1429400_-	DUF2612 domain-containing protein	NA	A0A220NQG4	Acinetobacter_phage	37.2	3.7e-27
WP_006252668.1|1429396_1430593_-	hypothetical protein	NA	K4I3B4	Acinetobacter_phage	36.6	3.0e-62
WP_006252062.1|1430589_1430940_-	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	39.5	1.7e-13
WP_006252669.1|1430943_1431606_-	hypothetical protein	NA	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	2.1e-36
WP_006252670.1|1431595_1432483_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	34.2	3.6e-44
WP_132303704.1|1432482_1432779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824103.1|1432781_1433489_-	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	45.5	1.8e-33
WP_020824105.1|1433723_1434620_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	40.4	1.4e-35
WP_006252056.1|1434904_1435084_-	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	84.7	4.0e-19
WP_006252055.1|1435235_1435907_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_006252054.1|1435929_1436592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824107.1|1436591_1439261_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZ47	Acinetobacter_phage	31.9	3.3e-64
WP_020824108.1|1439433_1439838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252051.1|1439905_1440427_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	4.4e-34
WP_006252050.1|1440561_1441005_-	hypothetical protein	NA	Q8HAQ5	Burkholderia_phage	35.1	4.5e-11
WP_006252049.1|1441062_1442541_-	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	41.3	3.9e-99
WP_006252048.1|1442556_1443063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252047.1|1443047_1443428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824109.1|1443435_1444140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252045.1|1444142_1444748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252044.1|1444744_1445176_-	DUF4054 domain-containing protein	NA	A0A0S1WH65	Pseudomonas_phage	45.9	2.8e-26
WP_006252043.1|1445178_1445553_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.0	3.1e-13
WP_006252679.1|1445622_1446753_-	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	46.0	9.9e-79
WP_006252041.1|1446764_1447274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824111.1|1447285_1448542_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.0	2.4e-41
WP_006252039.1|1448538_1449729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252680.1|1449781_1450612_-|head	phage head protein	head	H9C0V1	Aeromonas_phage	28.7	8.4e-19
WP_020824114.1|1450586_1452098_-	DUF1073 domain-containing protein	NA	I7B6L5	Escherichia_phage	48.7	4.3e-114
WP_020824115.1|1452165_1453545_-|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	60.9	4.5e-150
WP_020824116.1|1453547_1454045_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	70.4	8.8e-48
WP_081107630.1|1454245_1454425_+	hypothetical protein	NA	A0A0M3LTH4	Mannheimia_phage	84.9	2.0e-18
WP_006252684.1|1454434_1454584_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	87.8	8.8e-20
WP_006252685.1|1454612_1454963_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	94.0	2.3e-26
WP_020824120.1|1454963_1455560_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.3	8.2e-93
WP_006251970.1|1455574_1456018_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	2.4e-12
WP_006251969.1|1456069_1456543_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	96.2	1.7e-80
WP_020824122.1|1456532_1457102_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	84.7	5.1e-84
WP_020824123.1|1457174_1457636_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	45.8	1.4e-31
WP_061888672.1|1457656_1458229_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	97.4	2.1e-106
WP_075271793.1|1458239_1459286_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1459282_1460122_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252074.1|1460184_1460628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252073.1|1460676_1460871_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006252072.1|1460967_1461627_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
WP_006252071.1|1461626_1462466_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	28.9	5.2e-16
WP_006252070.1|1462482_1463310_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	44.8	1.8e-58
WP_020824126.1|1463325_1463661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032849124.1|1463708_1464167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252067.1|1464323_1464620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248786.1|1465085_1465337_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1465339_1465615_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006252947.1|1466292_1466808_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_020824127.1|1467074_1467785_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	53.5	8.5e-28
WP_061888675.1|1467891_1468404_+	hypothetical protein	NA	A0A0M3LR61	Mannheimia_phage	100.0	1.4e-96
WP_006250950.1|1468400_1468760_+	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	100.0	5.9e-62
WP_147009013.1|1468756_1469236_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	98.1	6.2e-75
WP_020824130.1|1469369_1469582_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|1469594_1470518_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|1470510_1471173_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_006252710.1|1471213_1471480_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	100.0	2.6e-06
WP_006252708.1|1471507_1471960_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	99.3	1.1e-84
WP_006252707.1|1472058_1472277_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	98.4	1.7e-32
WP_061888593.1|1472971_1473808_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	50.7	1.7e-75
WP_020824132.1|1474193_1475036_+	antirepressor	NA	Q7Y5X0	Haemophilus_phage	62.8	1.5e-36
WP_020824134.1|1475551_1475935_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_006247823.1|1475984_1476206_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_020824135.1|1476227_1477268_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	96.2	2.4e-196
1477420:1477439	attR	TCAAGAATTAAGCACGTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	1630659	1679997	2592266	protease,tRNA,transposase	Mannheimia_phage(25.0%)	45	NA	NA
WP_020824074.1|1630659_1631700_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006250724.1|1632025_1632424_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006250723.1|1632510_1635237_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1635295_1635616_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1635736_1636039_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1636063_1636438_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_020824156.1|1636794_1637106_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1637197_1637785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1638110_1638401_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020824157.1|1638460_1639192_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_147009693.1|1639191_1639752_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1639751_1640177_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1640223_1641276_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1641660_1643028_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1643071_1643740_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1645827_1646745_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1646741_1647089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484678.1|1647761_1648412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1648401_1648740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1649436_1649640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1649651_1649900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1650334_1650520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1651079_1651298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251854.1|1651901_1653098_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	8.1e-23
WP_006251855.1|1653204_1654179_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1654246_1654954_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006251857.1|1654998_1656450_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_032844896.1|1656564_1657425_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	2.6e-31
WP_006250049.1|1657931_1659230_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1659403_1660291_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006251657.1|1660293_1661517_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020824049.1|1661707_1662358_-|transposase	IS1595-like element ISMha4 family transposase	transposase	NA	NA	NA	NA
WP_006250045.1|1662414_1662744_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_142778024.1|1663910_1666478_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	4.9e-126
WP_100067206.1|1666418_1666601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251668.1|1666691_1667834_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.5	1.5e-162
WP_006251672.1|1669438_1670338_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006251674.1|1670351_1671254_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1671250_1671607_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1671676_1672282_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006251675.1|1672355_1674263_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.6e-92
WP_142778025.1|1674536_1675715_+	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	35.9	8.5e-25
WP_020824074.1|1675793_1676834_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_020824163.1|1677049_1677472_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_020824074.1|1678956_1679997_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
>prophage 6
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	1922443	1971400	2592266	portal,tail,transposase,terminase,protease,holin,integrase	Mannheimia_phage(58.7%)	61	1924836:1924851	1970015:1970030
WP_020824044.1|1922443_1923484_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006247810.1|1923556_1923856_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1923827_1924217_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1924360_1924654_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
1924836:1924851	attL	TTTTTTCGGAACGTTT	NA	NA	NA	NA
WP_020824044.1|1924923_1925964_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_020824195.1|1926235_1933369_-	DUF1983 domain-containing protein	NA	A0A0M3LQ28	Mannheimia_phage	97.4	0.0e+00
WP_142782939.1|1933371_1933962_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	94.9	4.9e-98
WP_020828760.1|1934230_1934962_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_021280070.1|1934965_1935682_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	97.9	5.2e-134
WP_020824199.1|1935681_1936011_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	5.3e-17
WP_142782940.1|1936010_1939562_-|tail	phage tail tape measure protein	tail	A0A125RN77	Pseudomonas_phage	35.4	1.2e-34
WP_020824201.1|1939615_1939843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824202.1|1939905_1940136_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_020824203.1|1940180_1940582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824204.1|1940664_1941306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824205.1|1941333_1941726_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824206.1|1941722_1942247_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	38.1	4.2e-16
WP_020824207.1|1942250_1942553_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020824208.1|1942545_1942869_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	37.4	2.7e-13
WP_020824209.1|1943121_1945083_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	55.2	1.7e-198
WP_020824210.1|1945486_1946683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824211.1|1946686_1948198_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	56.1	3.7e-158
WP_015484701.1|1948197_1948422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142778020.1|1948418_1950530_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.6	3.2e-272
WP_020824213.1|1950529_1951009_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.0	1.2e-41
WP_015484698.1|1951278_1951428_-	hypothetical protein	NA	A0A0M3LSZ0	Mannheimia_phage	85.7	2.0e-19
WP_020824214.1|1951477_1951807_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.8e-26
WP_020824215.1|1951807_1952401_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	97.0	8.2e-109
WP_031200637.1|1952390_1952735_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006251707.1|1953082_1953268_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006251708.1|1953776_1953971_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	61.9	2.0e-11
WP_006252752.1|1953938_1954379_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	63.0	6.4e-42
WP_020824218.1|1954368_1954728_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	1.3e-13
WP_020824219.1|1954720_1955749_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	36.7	5.3e-47
WP_061888639.1|1955875_1956469_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	81.6	4.8e-93
WP_020824125.1|1956479_1957526_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006252350.1|1957522_1958362_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	37.4	2.2e-27
WP_006252483.1|1958537_1958798_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	97.7	6.2e-37
WP_006248825.1|1958818_1959019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006252485.1|1959149_1959833_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.1	1.4e-19
WP_006248823.1|1959907_1960288_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824221.1|1960280_1960778_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	97.9	5.9e-44
WP_006250075.1|1960908_1961091_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250984.1|1961129_1961549_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	48.9	8.5e-28
WP_006250985.1|1961615_1961921_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	99.0	8.6e-54
WP_006250986.1|1961929_1962205_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250987.1|1962494_1962725_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006250988.1|1963203_1963527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824222.1|1963719_1963905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253113.1|1964058_1964517_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.7	9.3e-36
WP_006250991.1|1964552_1964912_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	2.8e-19
WP_020824224.1|1964983_1965787_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.2e-49
WP_020824225.1|1965880_1966315_+	hypothetical protein	NA	S4T7U9	Vibrio_phage	39.1	1.6e-05
WP_020824226.1|1966324_1966813_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	74.1	6.0e-65
WP_020824227.1|1966833_1967043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1967189_1967315_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020824228.1|1967361_1968204_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	66.5	6.8e-109
WP_020824134.1|1968266_1968650_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	9.1e-69
WP_020824229.1|1968699_1968975_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|1968934_1969990_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_006249908.1|1970137_1971400_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	6.9e-97
1970015:1970030	attR	TTTTTTCGGAACGTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017526	Mannheimia haemolytica strain 1567 chromosome, complete genome	2592266	2236783	2337147	2592266	tail,tRNA,transposase,terminase,holin,integrase	Mannheimia_phage(87.65%)	119	2236726:2236785	2337146:2338347
2236726:2236785	attL	TGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGATT	NA	NA	NA	NA
WP_020824044.1|2236783_2237824_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
WP_006249478.1|2237943_2238174_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	4.0e-11
WP_006251580.1|2238360_2239038_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006249480.1|2239231_2239504_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006249481.1|2239512_2239638_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_006249482.1|2239817_2240591_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249483.1|2240673_2241390_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006251583.1|2241399_2242152_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.9e-35
WP_006249485.1|2242367_2242901_-	YggT family protein	NA	NA	NA	NA	NA
WP_100067205.1|2242809_2243031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249486.1|2243006_2243348_-	YggL family protein	NA	NA	NA	NA	NA
WP_006251584.1|2243371_2244121_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_020824270.1|2244130_2245081_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_006251586.1|2245226_2246246_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_006251587.1|2246326_2247082_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.9	2.6e-19
WP_006249492.1|2247068_2247713_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_006249493.1|2247716_2247938_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_006249494.1|2248048_2249686_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	5.0e-39
WP_075270707.1|2249759_2250725_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.7	6.3e-26
WP_006249496.1|2250897_2251545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251588.1|2251735_2252524_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_006249498.1|2252820_2253774_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_080651055.1|2254549_2258107_+	collagen-like protein	NA	NA	NA	NA	NA
WP_020824074.1|2258141_2259182_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	100.0	1.4e-201
WP_006252223.1|2259403_2261146_-	autotransporter	NA	NA	NA	NA	NA
WP_020824272.1|2261361_2261619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824273.1|2262125_2262356_-	membrane protein	NA	NA	NA	NA	NA
WP_006248552.1|2263276_2263615_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
WP_006252227.1|2263872_2265771_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	5.6e-151
WP_006252924.1|2265912_2266215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142778012.1|2266380_2267520_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.1	5.4e-24
WP_006248547.1|2267807_2269316_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.6	8.8e-99
WP_006248546.1|2269378_2269600_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_100067210.1|2269621_2270068_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_041447977.1|2270052_2270649_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020824274.1|2270757_2272092_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.4	1.1e-41
WP_020824275.1|2272202_2273351_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_006248542.1|2273480_2273828_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_006248541.1|2273827_2274685_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	27.9	6.2e-17
WP_006252234.1|2274793_2275756_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_006252237.1|2276865_2277363_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_006252238.1|2277410_2278772_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_006252239.1|2278963_2279515_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020824276.1|2280423_2281488_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_006252243.1|2281672_2282332_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006252244.1|2282467_2283385_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006252245.1|2283598_2284477_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006252246.1|2284542_2285133_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006252247.1|2285263_2286106_+	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
WP_006250518.1|2286390_2286684_-	hypothetical protein	NA	A0A0M3LS64	Mannheimia_phage	99.0	7.5e-47
WP_006250517.1|2286799_2287399_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|2287399_2287843_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_062627925.1|2293709_2294300_-|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	93.4	3.2e-97
WP_075271799.1|2294568_2295300_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	97.5	8.7e-145
WP_061888645.1|2295303_2296020_-|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	100.0	1.9e-136
WP_020849872.1|2296027_2296474_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	3.9e-79
WP_006251215.1|2296495_2296825_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_061888644.1|2296828_2299324_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	99.9	0.0e+00
WP_006251217.1|2299410_2299806_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	100.0	3.1e-64
WP_006251218.1|2299873_2300332_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251219.1|2300464_2300734_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	5.2e-47
WP_006251220.1|2300748_2301420_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|2301515_2301692_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|2301747_2302164_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|2302203_2302686_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|2302689_2303070_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_061888643.1|2303066_2303435_-	hypothetical protein	NA	A0A0M3LS24	Mannheimia_phage	100.0	1.3e-59
WP_006251226.1|2303436_2303781_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|2303780_2304158_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_032848903.1|2304160_2304358_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	2.8e-21
WP_006251229.1|2304369_2305359_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|2305373_2305808_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|2305800_2307171_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|2307157_2308096_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|2308049_2309426_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_006251234.1|2309422_2310643_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LNR4	Mannheimia_phage	100.0	4.9e-241
WP_006251235.1|2310626_2311151_-|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	100.0	1.7e-89
WP_006251710.1|2311517_2311775_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	100.0	1.2e-45
WP_142778549.1|2311775_2312000_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	100.0	7.7e-36
WP_006252032.1|2311944_2312295_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	100.0	2.0e-30
WP_061888656.1|2312295_2312889_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	100.0	2.3e-111
WP_031200637.1|2312878_2313223_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	100.0	2.6e-59
WP_006252253.1|2313341_2313920_+	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	100.0	2.6e-107
WP_021280056.1|2314436_2314631_+	hypothetical protein	NA	A0A0M3LS93	Mannheimia_phage	100.0	4.8e-26
WP_006252250.1|2314598_2314964_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	100.0	1.6e-62
WP_021280055.1|2314953_2315322_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	100.0	1.6e-67
WP_021280054.1|2315318_2315603_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	100.0	1.4e-50
WP_032849029.1|2315979_2316192_-	hypothetical protein	NA	A0A0M3LPA2	Mannheimia_phage	100.0	1.1e-31
WP_032849027.1|2316241_2316694_-	DUF1367 family protein	NA	A0A0M3LPN2	Mannheimia_phage	100.0	6.9e-84
WP_006251735.1|2316812_2317385_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	100.0	1.6e-109
WP_061888657.1|2317381_2318029_-	replication protein	NA	A0A0M3LS65	Mannheimia_phage	100.0	4.7e-118
WP_061888659.1|2318028_2318313_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	98.9	7.0e-50
WP_061888658.1|2318798_2319041_-	hypothetical protein	NA	A0A0M3LR73	Mannheimia_phage	100.0	4.7e-39
WP_032848913.1|2319197_2319431_-	antirepressor protein Cro	NA	A0A0M3LQ90	Mannheimia_phage	100.0	1.5e-37
WP_075271714.1|2319559_2320246_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	100.0	3.9e-131
WP_006248823.1|2320259_2320640_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_142782981.1|2320632_2321130_+	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	100.0	3.7e-46
WP_061888676.1|2321711_2321981_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	100.0	2.5e-41
WP_006251561.1|2321958_2322231_-	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	100.0	1.5e-46
WP_061888675.1|2322898_2323411_+	hypothetical protein	NA	A0A0M3LR61	Mannheimia_phage	100.0	1.4e-96
WP_006250950.1|2323407_2323767_+	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	100.0	5.9e-62
WP_006250951.1|2323763_2324243_+	hypothetical protein	NA	A0A0M3LQ82	Mannheimia_phage	100.0	1.3e-75
WP_020824130.1|2324376_2324589_+	hypothetical protein	NA	A0A0M3LQ55	Mannheimia_phage	100.0	8.9e-34
WP_020824131.1|2324601_2325525_+	hypothetical protein	NA	A0A0M3LNU3	Mannheimia_phage	100.0	2.9e-169
WP_032848956.1|2325517_2326180_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	100.0	4.5e-124
WP_147008982.1|2326220_2327066_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	73.3	9.1e-53
WP_142777854.1|2327093_2327546_+	pyruvate kinase	NA	A0A0M3LNU4	Mannheimia_phage	100.0	1.3e-85
WP_061888670.1|2327590_2328082_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	100.0	1.3e-83
WP_006250262.1|2328078_2328282_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|2328265_2328730_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_061888669.1|2328733_2328922_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	100.0	6.9e-30
WP_061888668.1|2329325_2329982_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	100.0	1.8e-125
WP_061888667.1|2330215_2331121_+	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	100.0	4.4e-170
WP_081107633.1|2332357_2332954_+	hypothetical protein	NA	A0A0M3LP83	Mannheimia_phage	100.0	2.1e-112
WP_061888666.1|2332931_2333438_+	hypothetical protein	NA	A0A0M3LPK6	Mannheimia_phage	100.0	8.8e-96
WP_020824229.1|2333527_2333803_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	100.0	1.2e-46
WP_006251368.1|2333762_2334818_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	100.0	2.8e-200
WP_020824277.1|2335069_2336023_+	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_020824044.1|2336106_2337147_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.7	4.2e-201
2337146:2338347	attR	AATCTGACAGACACGGTAATTTAAAACGGGGGACTGTCAGATTAGGTTTGATCTTCTACAGCTAAACTCAGTCTGCTTTCTTGTGTTTCATCTTTAACTAAGTAGGTGCAATCTATTTACTGTTATGACTAACCAGAAATTCATCAACTCTTCTCTTACTCTCGCTTTCTTTACTTTAATCTCTTTTTCTACCGCTTACTGTTATGCTTGGGGTATTGCTGCTTTTCATGGCTACCCGTGGTGGCATGTTGAGGTTGGTAATGCCGGTATAGCTCGCGCACTAGCCTACGTTTTTGGCACATTTTTAACTATCTTTCTTTTTTATTTGATAGGATACGCTTTAGTTAATAAAGTTTTTAAGCTGCATTACTTTAAATACCTTGGCTGGCTACGGGTGAGTGTTCTTGTTACTATTTTTAGCTTGCCAGTAATGATCAGTTTCTATCTGTTTATTGGCAAAGTGCCAATGTATTTACACCTACTCTATCTAGGGACAACTACCCTATCAGTATTATTATTTCACAAACATTGGGACCACCGCGTATTCCACTTAGATATTCAAAAAATGTTAAGCGAAGAACGCTTCGGTTTTTTCTATGTTTTTATTTTCATCTATTTTAGCTTACTTTCTTTGAGTATTGGCTACATTCGCCCTGAGCTGAGAACAACGTATGATTATCTTGAAATTGAAAATAAGCGATATTATGTCTTATCTATTCATCGCAATAACATTTATGTGCTGGGCGAAAAAACTAAAGATAACGATGAATTTCTCTTTTTCAACCAAGATACATTGAAATATTACCGCATTAATATTACCAAAATGCCAAATTAGCCTATCTAAAATAACAATCCGCACCTAAAACGTGCGGATTGTGGCTATTTGAGCTAAAGATTACTTAAATCTACCAAAGCATCTCTGCCGATGTCGCTAATTTTAGCATTGCTGGTAAGTGTCATCGCCACTTTCATTTCTTTAAGGAAGATGTCGAGCAGGTTTTCCACACCGGCTTGACCGGCGGCGCTAAGAGCGTAAACAAAGGAACGCCCGATCATCGTACAATCTGCGCCGAGAGCCAGCATTCTCACCACATCTAAGCCGTTGCGGATACCAGAGTCGGCAAGGATTTTGATCTCCCCTTTTACTGCATCGGCAATGCTTGGCAGGGCTTTGGCAGAAGAAAGTACCCCATCTAACTGAC	NA	NA	NA	NA
