The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	44670	51997	2683719	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|44670_44913_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_134983781.1|44913_46974_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	98.7	0.0e+00
WP_006253441.1|46970_47528_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47476_48472_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48524_48713_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48742_49111_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49110_49485_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49974_50778_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50822_51101_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51277_51997_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	575271	659230	2683719	transposase,tail,protease,plate,tRNA,head	Mannheimia_phage(17.02%)	93	NA	NA
WP_006249683.1|575271_575949_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|576162_576381_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_020828826.1|576390_578361_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	43.9	9.6e-146
WP_006253638.1|578540_579029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|579060_580002_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|580004_580319_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|580330_580567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|580550_580844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|580965_581184_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|581193_581376_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|581392_581782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|581830_582118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|582236_582782_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249670.1|582768_583302_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249669.1|583466_583826_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249668.1|583961_584471_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249667.1|584473_584743_+	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|584736_585084_+	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249664.1|585262_585598_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_006249663.1|585599_585896_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249662.1|585918_586491_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249661.1|586490_588047_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249659.1|588165_589620_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|589612_590890_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|591091_591436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|591499_591964_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|592198_593314_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|593344_594271_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|594339_594621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|594620_595055_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|595060_595558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|595642_597028_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|597038_597554_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|597649_597964_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|597960_598113_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|598091_598394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062715984.1|598441_601099_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|601108_602032_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|602015_602243_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|602235_603300_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|603286_603823_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|603877_604240_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|604249_605353_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|605345_605912_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|605921_608201_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|608201_608804_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|608787_609063_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|609062_609350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|609516_610221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274821.1|610389_610521_+	adhesin	NA	NA	NA	NA	NA
WP_006249630.1|610568_611357_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|611393_613832_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|614151_615918_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|616072_616984_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|617106_618189_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|618276_619146_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|619199_619694_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|619894_620719_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|620808_623133_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|623367_624393_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|624641_625382_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|625512_627579_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|627700_628858_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|628916_629132_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|629321_630137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|630198_630843_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|630954_632658_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|632692_633091_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|633118_634255_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|634251_635067_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|635066_635948_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|635944_636613_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|636956_638240_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|638405_642122_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|642229_644233_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_041447882.1|644331_645702_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|645715_646450_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|646452_647088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062715982.1|647355_648093_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|648089_649058_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|649238_649574_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|649557_649881_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|649870_651757_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|651804_652587_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|652635_653796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|653855_654872_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|654959_655121_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|655098_656100_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|656101_656506_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|656640_656823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|656826_657156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|657191_657944_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|657982_659230_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	915326	971291	2683719	transposase,integrase	Mannheimia_phage(26.67%)	59	938163:938178	972192:972207
WP_015587023.1|915326_916367_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006252258.1|916520_917294_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|917442_921639_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|921693_922788_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|922874_923144_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|923207_923846_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|923929_924706_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|924715_924970_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|924971_925265_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015587023.1|925331_926372_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_015587024.1|926370_927102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006248322.1|927419_927974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248324.1|928241_928472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|928592_928910_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248329.1|929407_929665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|930099_931188_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248333.1|931252_931684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|931687_933790_-	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006253298.1|933816_934095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248336.1|935063_935495_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032845458.1|935512_936505_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_005719386.1|936501_937491_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
938163:938178	attL	ATATCTATTGGTGTTT	NA	NA	NA	NA
WP_006248338.1|938482_939124_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_006248339.1|939141_939897_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005719377.1|939900_940548_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005719374.1|940544_941708_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006248340.1|941704_943006_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719369.1|943147_944035_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248341.1|944059_944614_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719365.1|944673_944997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719361.1|945020_946124_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_015484362.1|947352_948000_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_006248344.1|948023_948431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|948528_948879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|948969_949332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|949444_949705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248349.1|950995_951832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|951935_952400_-	ArdC family protein	NA	NA	NA	NA	NA
WP_006253302.1|952608_952872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270676.1|952955_954023_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075270679.1|954279_954489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248352.1|954633_956802_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_006253295.1|956802_958785_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006253296.1|958846_959152_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015484352.1|959186_960227_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	95.7	1.1e-193
WP_021265545.1|960325_960556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|960625_961177_-	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_049800970.1|961513_961768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|962006_962261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248359.1|962426_962633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248360.1|962629_963406_+	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248362.1|964181_965156_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248363.1|965242_965440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587023.1|965552_966593_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	4.6e-200
WP_006248364.1|966724_966967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|967126_967384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248367.1|967395_967896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147008793.1|968399_970373_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248370.1|970526_971291_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
972192:972207	attR	AAACACCAATAGATAT	NA	NA	NA	NA
>prophage 4
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1071137	1077922	2683719		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1071137_1071920_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1071929_1072658_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1072793_1073813_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1073814_1074417_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1074545_1074701_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1074778_1075360_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1075374_1076022_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1076125_1076755_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1076869_1077922_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 5
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1269155	1360714	2683719	portal,terminase,transposase,tail,integrase,capsid,plate,tRNA,head,holin	Mannheimia_phage(88.46%)	107	1338095:1338111	1363619:1363635
WP_006249379.1|1269155_1270559_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1271031_1272021_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1272017_1272275_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1272301_1272793_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1273292_1273757_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1273740_1273944_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1273940_1274468_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1274545_1274998_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1275207_1275843_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1275839_1276634_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1276674_1277625_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1277637_1277850_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1277983_1278463_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1278459_1278819_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1278822_1279329_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1279897_1280134_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1280515_1280746_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1281037_1281313_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1281321_1281627_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_020910232.1|1281764_1282805_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006249172.1|1283026_1283545_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249171.1|1283614_1284205_-	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249169.1|1285388_1286027_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249168.1|1286017_1287004_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249167.1|1287108_1288554_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249166.1|1288624_1289494_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249165.1|1289502_1290663_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249164.1|1290955_1292185_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249163.1|1292287_1295101_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_095578364.1|1295265_1296012_-	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249161.1|1296236_1297766_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_006249160.1|1297775_1298459_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249159.1|1298543_1300265_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_031192872.1|1300392_1301241_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006249157.1|1301328_1302147_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_015587056.1|1302149_1303841_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249155.1|1303891_1304410_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006249154.1|1304452_1305052_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249153.1|1305048_1305369_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249152.1|1305372_1305825_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249151.1|1305865_1306447_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006248209.1|1306755_1307715_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_006253548.1|1307707_1309459_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248207.1|1309461_1310427_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248206.1|1310413_1311307_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248205.1|1311377_1312430_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248204.1|1312438_1312669_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248203.1|1312798_1313881_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1313967_1314363_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248201.1|1314587_1315592_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248200.1|1316367_1317408_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006250768.1|1317416_1319255_-|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248198.1|1319368_1320196_+|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006248197.1|1320209_1321238_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006250770.1|1321247_1321937_+|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248195.1|1322048_1322564_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250771.1|1322560_1322773_+|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006250772.1|1322778_1322985_+|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250773.1|1322977_1323544_+	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006248210.1|1323540_1323996_+	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006248194.1|1324144_1324366_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248193.1|1324362_1324848_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_062716029.1|1324840_1325299_+	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	99.3	9.8e-78
WP_006248191.1|1325349_1325628_-	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_021265529.1|1328812_1329082_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LP36	Mannheimia_phage	91.7	3.6e-40
WP_020910232.1|1329116_1330157_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006248188.1|1330436_1331042_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006248187.1|1331041_1331377_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248186.1|1331373_1332291_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248185.1|1332277_1332910_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_015981653.1|1332912_1335192_+|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248181.1|1335192_1335435_+	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_006248179.1|1335864_1337046_+|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248178.1|1337054_1337561_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248177.1|1337639_1337954_+|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_075270712.1|1337977_1338094_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
1338095:1338111	attL	AACAAGCGGTCGTTTTT	NA	NA	NA	NA
WP_006253663.1|1338157_1338505_+	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_006248175.1|1338506_1338944_+|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006248174.1|1338943_1340182_+	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248173.1|1340364_1341171_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248172.1|1341205_1341466_-	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006253662.1|1341565_1341976_-	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248170.1|1341993_1342512_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006248169.1|1342515_1343202_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248168.1|1343325_1343538_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006253660.1|1343636_1343882_-	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248166.1|1344014_1344287_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006248165.1|1344369_1344702_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248164.1|1344714_1345008_+	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248162.1|1345159_1345402_+	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248161.1|1345398_1345731_+	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_147035466.1|1345727_1348088_+	replication endonuclease	NA	Q19US8	Mannheimia_phage	99.7	0.0e+00
WP_006248159.1|1348100_1348433_+	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248158.1|1348432_1348885_+	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248157.1|1348895_1349228_+	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248156.1|1349217_1349487_+	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248155.1|1349461_1349752_+	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248154.1|1350021_1350204_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248153.1|1350481_1351480_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248152.1|1351847_1352648_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_062715986.1|1352739_1354716_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248149.1|1354875_1355154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248148.1|1355178_1355475_+	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248147.1|1355527_1356319_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006251533.1|1356462_1357236_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248145.1|1357466_1357892_+	universal stress protein	NA	NA	NA	NA	NA
WP_006248143.1|1358086_1360714_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
1363619:1363635	attR	AACAAGCGGTCGTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1526123	1623278	2683719	terminase,transposase,tail,protease,integrase,tRNA	Mannheimia_phage(89.16%)	116	1615325:1615343	1632094:1632112
WP_147008792.1|1526123_1527164_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	99.7	5.5e-201
WP_006253551.1|1527366_1528683_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_006253552.1|1528811_1528997_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_006249010.1|1529112_1530435_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_006249011.1|1530650_1530974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249013.1|1532265_1532484_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_006249014.1|1532539_1533121_+	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	52.1	5.6e-54
WP_006249015.1|1533211_1534330_-	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	28.2	1.3e-06
WP_006249016.1|1534419_1535868_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.1	7.1e-13
WP_006249017.1|1536014_1537712_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_006249018.1|1537855_1538407_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249019.1|1538505_1539315_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006249020.1|1539331_1540024_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_006249021.1|1540110_1541193_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249022.1|1541281_1542121_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249023.1|1542272_1544933_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249024.1|1544943_1545426_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249025.1|1545482_1546601_-	ribonuclease D	NA	NA	NA	NA	NA
WP_006249026.1|1546734_1547922_+	ROK family protein	NA	NA	NA	NA	NA
WP_006249027.1|1547969_1548692_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249028.1|1548740_1548950_-	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249029.1|1549101_1549857_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249030.1|1549887_1550964_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249031.1|1550977_1551916_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_006249032.1|1551965_1554572_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249033.1|1554701_1555592_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249034.1|1555641_1555902_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249035.1|1555981_1556941_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006251052.1|1557137_1557545_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249369.1|1557544_1558189_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006249370.1|1558362_1558860_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_015484189.1|1558874_1559840_+	asparaginase	NA	NA	NA	NA	NA
WP_006249372.1|1559858_1560947_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006249373.1|1561167_1561578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249374.1|1561580_1563599_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249376.1|1563837_1564074_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_080628642.1|1564236_1565082_+	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006253556.1|1565095_1566289_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_015484185.1|1566299_1566650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484184.1|1566646_1566919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1566954_1567773_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_006249381.1|1567784_1568384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249380.1|1568380_1569928_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_015484183.1|1570347_1570938_+	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249172.1|1571007_1571526_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484180.1|1572072_1572366_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006250517.1|1572480_1573080_-	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_100067196.1|1573080_1573524_-	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_147008794.1|1573523_1576517_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.7	0.0e+00
WP_075270690.1|1576513_1580245_-	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_147015534.1|1580254_1580884_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	99.5	1.3e-109
WP_006249177.1|1581152_1581884_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_006251213.1|1581887_1582604_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_006251214.1|1582611_1583082_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251215.1|1583081_1583411_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251216.1|1583414_1585910_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251218.1|1586454_1586913_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|1587081_1587315_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|1587329_1588001_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|1588096_1588273_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|1588328_1588745_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|1588784_1589267_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|1589270_1589651_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|1589647_1590016_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|1590017_1590362_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|1590361_1590739_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_020828758.1|1590741_1591038_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	4.2e-21
WP_006251229.1|1591049_1592039_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|1592053_1592488_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|1592480_1593851_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|1593837_1594776_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|1594729_1596106_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015484276.1|1596102_1597323_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006250104.1|1597306_1597831_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_020824300.1|1598222_1598456_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1598400_1598751_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1598723_1599293_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1599285_1599531_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1599869_1600055_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_020910232.1|1600465_1601506_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_062716082.1|1601603_1602056_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	5.1e-79
WP_006250093.1|1602045_1602615_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1602742_1602937_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1602982_1603195_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1603244_1603751_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1603734_1603950_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1604040_1604577_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1604573_1605935_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1605931_1606801_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1607109_1607370_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1607390_1607597_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1607726_1608386_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1608436_1608817_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1608809_1609307_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_020910232.1|1609416_1610457_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1610594_1610900_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1610908_1611184_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1611475_1611706_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1612087_1612324_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1612892_1613399_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1613402_1613762_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1613758_1614238_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1614371_1614584_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1614596_1615547_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1615325:1615343	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1615587_1616382_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1616378_1617014_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250260.1|1617223_1617676_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1617753_1618281_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1618277_1618481_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1618464_1618929_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1618932_1619121_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1619582_1619798_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1620342_1621044_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1621561_1621945_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1621994_1622216_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1622237_1623278_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1632094:1632112	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 7
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1628851	1637261	2683719	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006247813.1|1628851_1631710_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247812.1|1631994_1632288_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1632431_1632821_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1632792_1633092_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1633268_1633955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253310.1|1634065_1634677_-	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247807.1|1634725_1635352_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006247806.1|1635573_1636293_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006253312.1|1636550_1637261_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
>prophage 8
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1640494	1650811	2683719		Mannheimia_phage(50.0%)	14	NA	NA
WP_006247798.1|1640494_1640869_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
WP_006253314.1|1640876_1641044_+	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006253316.1|1641124_1641448_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247795.1|1643557_1644151_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006247794.1|1644161_1645208_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247793.1|1645204_1645888_-	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247792.1|1645945_1646134_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247791.1|1646258_1646915_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247790.1|1646926_1647301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1647452_1648190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1648225_1648822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1649467_1649653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249219.1|1649636_1649834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249218.1|1649836_1650811_+	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
>prophage 9
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1728216	1843952	2683719	portal,terminase,transposase,tail,integrase,tRNA,holin	Mannheimia_phage(45.9%)	112	1730275:1730333	1853871:1853929
WP_015587099.1|1728216_1729149_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	94.1	5.3e-163
WP_147010780.1|1729232_1730279_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	2.6e-198
1730275:1730333	attL	TCTGACAGACACGGTAATTTAAAACGGGGGACTGTCAGATTAGGTTTGATCTTCTACAA	NA	NA	NA	NA
WP_006253498.1|1730327_1732559_-	collagen-binding protein	NA	NA	NA	NA	NA
WP_006248069.1|1732752_1733982_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253499.1|1734254_1736048_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248071.1|1736134_1737094_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006248072.1|1737139_1737814_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248073.1|1737916_1738834_+	GTPase Era	NA	NA	NA	NA	NA
WP_006248074.1|1739063_1739786_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248075.1|1739873_1741109_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248076.1|1741167_1742658_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248077.1|1742719_1743346_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248078.1|1743355_1744366_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248079.1|1744375_1746022_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253500.1|1746144_1747173_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006253501.1|1747517_1748237_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006248082.1|1748332_1749184_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_006248083.1|1749247_1750810_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248084.1|1750901_1751618_+	UMP kinase	NA	NA	NA	NA	NA
WP_006248085.1|1751669_1752227_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248086.1|1752363_1753047_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248087.1|1753214_1754378_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248088.1|1754378_1755224_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248089.1|1755235_1757071_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_006253502.1|1757151_1761249_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_006248092.1|1761363_1763130_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006248093.1|1763129_1764794_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248094.1|1764925_1765555_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248095.1|1765588_1766956_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248096.1|1767022_1767784_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248097.1|1767776_1768652_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006250663.1|1769109_1770942_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
WP_006248098.1|1770951_1773588_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.9	4.3e-141
WP_006248099.1|1773719_1776152_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_006248100.1|1776204_1777167_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006253504.1|1777263_1779027_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248102.1|1779290_1781579_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006248103.1|1781709_1782303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253505.1|1782364_1782781_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1782827_1783964_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_134983790.1|1784122_1784584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248107.1|1786566_1787244_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_031192850.1|1787265_1789047_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248109.1|1789056_1789920_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_006253509.1|1789919_1790594_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248111.1|1790620_1791541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134916814.1|1791541_1791835_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248113.1|1791937_1792951_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_006248114.1|1793017_1793311_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248118.1|1794653_1796129_+	ribonuclease G	NA	NA	NA	NA	NA
WP_006248119.1|1796282_1797785_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006247812.1|1798089_1798383_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_147008795.1|1798505_1801832_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_075272501.1|1801828_1805560_-	host specificity protein J	NA	A0A0M3LQG1	Mannheimia_phage	98.9	0.0e+00
WP_006249176.1|1805569_1806199_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_020828760.1|1806467_1807199_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.2	1.2e-146
WP_006249178.1|1807202_1807919_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1807918_1808248_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1808247_1811814_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1811867_1812095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1812157_1812388_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1812432_1812834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1812917_1813559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1813586_1813982_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1813978_1814503_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1814506_1814809_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1814801_1815125_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1815198_1817160_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1817171_1818671_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1818670_1818895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1818891_1821003_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1821002_1821479_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1821626_1822025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824324.1|1822160_1822394_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	86.5	7.0e-32
WP_006249197.1|1822338_1822689_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1822689_1823286_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1823275_1823623_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1823786_1824593_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1824672_1825032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1825021_1825381_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1825373_1826402_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1826471_1827044_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1827040_1827676_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1827663_1828455_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1828451_1829213_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1829261_1829486_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1829612_1830344_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1830348_1830852_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1830848_1831961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1832224_1832455_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1832907_1833159_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1833161_1833437_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1833650_1833836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1833819_1834017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1834019_1834478_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1834513_1834873_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1834942_1835746_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1835855_1836374_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1836370_1836571_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1836554_1837052_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1837055_1837244_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1837375_1837753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1837982_1838822_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1839069_1839747_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1839985_1840423_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1840415_1840709_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1840711_1840921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1841067_1841193_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1841239_1842082_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1842144_1842636_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1842661_1842937_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1842896_1843952_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1853871:1853929	attR	TTGTAGAAGATCAAACCTAATCTGACAGTCCCCCGTTTTAAATTACCGTGTCTGTCAGA	NA	NA	NA	NA
>prophage 10
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	1853929	1861181	2683719	transposase,integrase	Mannheimia_phage(75.0%)	12	1846855:1846868	1856134:1856147
1846855:1846868	attL	TTCTCAACAAATTC	NA	NA	NA	NA
WP_015587044.1|1853929_1854970_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	100.0	1.1e-201
WP_006253274.1|1855107_1855752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1856087_1856507_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
1856134:1856147	attR	TTCTCAACAAATTC	NA	NA	NA	NA
WP_006250075.1|1856545_1856728_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250077.1|1856859_1857357_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1857349_1857730_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1857804_1858488_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1858618_1858819_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1859220_1859907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1860083_1860383_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1860354_1860744_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1860887_1861181_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
>prophage 11
NZ_CP017527	Mannheimia haemolytica strain 1563 chromosome, complete genome	2683719	2296112	2304267	2683719	terminase,integrase	Synechococcus_phage(16.67%)	12	2299318:2299377	2304683:2304756
WP_006250276.1|2296112_2296652_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2296789_2297080_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2297051_2297354_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2297371_2297665_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2297615_2297828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2297830_2298790_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2299318:2299377	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2299596_2300823_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2301097_2301316_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2301428_2301752_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2302146_2302833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2303152_2303578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2303574_2304267_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2304683:2304756	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
