The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	43893	51220	2661933	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|43893_44136_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_147010789.1|44136_46197_-|tail	phage tail protein	tail	A0A0M3LRW6	Mannheimia_phage	99.6	0.0e+00
WP_006253441.1|46193_46751_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|46699_47695_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|47747_47936_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|47965_48334_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|48333_48708_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49197_50001_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50045_50324_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|50500_51220_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	568786	648930	2661933	head,tail,tRNA,protease,transposase,plate	Mannheimia_phage(17.07%)	84	NA	NA
WP_006249683.1|568786_569464_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|569677_569896_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|569905_571876_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|572055_572544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249679.1|572575_573517_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006249678.1|573519_573834_+	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249677.1|573845_574082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249676.1|574065_574359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051133738.1|574480_574699_+	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249674.1|574708_574891_+	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_006249673.1|574907_575297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249672.1|575345_575633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249671.1|575751_576297_+	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249659.1|576611_578066_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249658.1|578058_579336_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249656.1|579537_579882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249655.1|579945_580410_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249654.1|580644_581760_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249653.1|581790_582717_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|582785_583067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|583066_583501_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|583506_584004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|584088_585474_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|585484_586000_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|586095_586410_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|586406_586559_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|586537_586840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249645.1|586887_589545_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|589554_590478_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|590461_590689_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|590681_591746_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|591732_592269_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|592323_592686_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|592695_593799_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|593791_594358_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|594367_596647_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|596647_597250_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|597233_597509_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|597508_597796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|597962_598667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147010792.1|598835_599063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|599110_599899_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_020910232.1|600015_601056_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253687.1|601134_603582_-|protease	Immunoglobulin A1 protease	protease	Q9LA58	Enterobacterial_phage	33.7	6.1e-49
WP_006249628.1|603901_605668_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|605773_606685_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|606807_607890_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|607977_608847_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|608900_609395_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|609595_610420_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|610509_612834_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006250030.1|613068_614094_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006250031.1|614342_615083_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|615213_617280_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|617401_618559_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|618617_618833_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|619022_619838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|619899_620544_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|620655_622359_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|622393_622792_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|622819_623956_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|623952_624768_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|624767_625649_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|625645_626314_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|626657_627941_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|628106_631823_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|631930_633934_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006251873.1|635415_636150_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|636152_636788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249329.1|637055_637793_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|637789_638758_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|638938_639274_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|639257_639581_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|639570_641457_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|641504_642287_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|642335_643496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|643555_644572_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|644659_644821_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|644798_645800_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|645801_646206_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|646340_646523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|646526_646856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|646891_647644_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|647682_648930_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	1060901	1067686	2661933		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1060901_1061684_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1061693_1062422_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1062557_1063577_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1063578_1064181_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1064309_1064465_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1064542_1065124_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1065138_1065786_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1065889_1066519_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1066633_1067686_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 4
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	1208826	1304015	2661933	terminase,integrase,capsid,tail,tRNA,protease,transposase	Mannheimia_phage(87.5%)	117	1212115:1212174	1265119:1265209
WP_006249234.1|1208826_1209981_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	4.8e-89
WP_006249233.1|1209993_1210506_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_006249232.1|1210564_1210765_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_006253419.1|1210960_1211212_-	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	77.4	7.8e-29
WP_075271292.1|1211310_1211850_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	78.1	2.5e-56
1212115:1212174	attL	TTTGGGTGGAAAAGAATTTAAGCTCAAATTAATCTGACAGACACGGTAATTTAAAACGGG	NA	NA	NA	NA
WP_006249231.1|1212254_1213691_-	DUF3327 domain-containing protein	NA	NA	NA	NA	NA
WP_006253571.1|1213734_1215810_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006249229.1|1215915_1216791_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249228.1|1216794_1217235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031192904.1|1217297_1217861_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_006249226.1|1217863_1218577_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_006249225.1|1218589_1218961_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_006249224.1|1218966_1219497_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_006249223.1|1219595_1220945_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_006249222.1|1220983_1221520_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.9	9.9e-13
WP_006250946.1|1221686_1224074_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_006250245.1|1225392_1225980_-	SocA family protein	NA	NA	NA	NA	NA
WP_006250244.1|1226031_1226280_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_006250242.1|1226847_1227171_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	44.7	7.8e-13
WP_076621564.1|1227148_1227424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250240.1|1228157_1228448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253562.1|1230591_1231077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250238.1|1231218_1231437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250237.1|1231430_1232066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250235.1|1232215_1233277_-	ash family protein	NA	NA	NA	NA	NA
WP_006250234.1|1233337_1233520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250233.1|1233587_1233968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250232.1|1233967_1234219_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006250231.1|1234296_1235145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250230.1|1235262_1235457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250229.1|1235453_1236404_-|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
WP_006250228.1|1236414_1237074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250227.1|1237083_1237290_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_006250224.1|1237759_1238974_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.1	2.8e-55
WP_006249040.1|1239345_1240083_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_006249039.1|1240114_1240501_-	RidA family protein	NA	NA	NA	NA	NA
WP_006249038.1|1240581_1241583_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249037.1|1241649_1241991_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006250748.1|1242183_1243524_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006253559.1|1243685_1244651_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250304.1|1244917_1246588_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006250302.1|1246748_1247192_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250301.1|1247242_1247818_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250739.1|1247924_1248815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250738.1|1248881_1249448_-	elongation factor P	NA	NA	NA	NA	NA
WP_147010795.1|1249614_1250202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587043.1|1250236_1251277_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	4.8e-197
WP_006249378.1|1251445_1252438_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006249379.1|1252537_1253941_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_015484287.1|1254413_1255403_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_015484286.1|1255399_1255657_-	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_020824296.1|1255683_1256175_-	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_006250263.1|1256674_1257139_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1257122_1257326_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1257322_1257850_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1257927_1258380_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1258589_1259225_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1259221_1260016_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1260056_1261007_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250256.1|1261019_1261232_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1261365_1261845_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1261841_1262201_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1262204_1262711_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1263279_1263516_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1263897_1264128_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1264419_1264695_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1264703_1265009_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_147010796.1|1265146_1266187_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	1.0e-199
1265119:1265209	attR	CCCGTTTTAAATTACCGTGTCTGTCAGATTAATTTGAGCTTAAATTCTTTTCCACCCAAATCCGTTTTCCATCAAGTAAGGTTGCCATCGG	NA	NA	NA	NA
WP_006253272.1|1266296_1266794_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	98.9	9.1e-45
WP_006248823.1|1266786_1267167_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250079.1|1267217_1267877_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1268006_1268213_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1268233_1268494_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1268802_1269672_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1269668_1271030_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1271026_1271563_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1271653_1271869_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1271852_1272359_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1272408_1272621_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250091.1|1272666_1272861_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250093.1|1272988_1273558_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250094.1|1273547_1274021_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006251707.1|1274340_1274526_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1274864_1275110_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1275102_1275672_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1275644_1275995_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1276564_1277089_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1277072_1278293_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_006251233.1|1278289_1279666_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015587047.1|1279619_1280558_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1280544_1281915_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1281907_1282342_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1282356_1283346_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_020824317.1|1283357_1283618_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	3.7e-21
WP_006251227.1|1283620_1283998_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1283997_1284342_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1284343_1284712_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251224.1|1284708_1285089_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251223.1|1285092_1285575_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1285614_1286031_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1286086_1286263_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1286358_1287030_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1287044_1287278_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1287446_1287905_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1288449_1290945_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1290948_1291278_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1291277_1291748_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1291755_1292472_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_147010797.1|1292475_1293207_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	97.5	1.5e-144
WP_006249176.1|1293475_1294105_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_147010798.1|1294114_1297849_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	99.9	0.0e+00
WP_095597182.1|1297845_1300839_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	99.9	0.0e+00
WP_100067196.1|1300838_1301282_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1301282_1301882_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1301996_1302290_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1302836_1303355_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_075270766.1|1303424_1304015_-	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	99.5	8.4e-98
>prophage 5
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	1551342	1612567	2661933	terminase,transposase,tail	Mannheimia_phage(94.52%)	79	NA	NA
WP_006249171.1|1551342_1551933_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1552002_1552521_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1552667_1552979_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1553354_1553648_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147010799.1|1553770_1560829_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	96.9	0.0e+00
WP_006249176.1|1560838_1561468_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_147010797.1|1561736_1562468_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	97.5	1.5e-144
WP_006248126.1|1562471_1563188_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	99.2	8.0e-135
WP_006253542.1|1563195_1566222_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	100.0	0.0e+00
WP_006253540.1|1566285_1566978_-	hypothetical protein	NA	A0A0M3LQM1	Mannheimia_phage	96.1	5.5e-48
WP_006253539.1|1567064_1567388_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	100.0	2.5e-59
WP_006250119.1|1567389_1567716_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	100.0	7.5e-56
WP_006250118.1|1567730_1568132_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	100.0	6.6e-70
WP_006250117.1|1568221_1569244_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	100.0	3.7e-186
WP_006250116.1|1569253_1569646_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	100.0	9.3e-69
WP_006250115.1|1569645_1570059_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	100.0	1.9e-72
WP_006250114.1|1570051_1570423_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	100.0	1.7e-67
WP_006250113.1|1570422_1570860_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	100.0	3.0e-76
WP_006250112.1|1570849_1571200_-	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	100.0	4.6e-59
WP_006250111.1|1571259_1572207_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	100.0	4.7e-175
WP_006250110.1|1572272_1573007_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	100.0	1.7e-124
WP_006250109.1|1573124_1573538_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	100.0	2.3e-73
WP_006250108.1|1573538_1573757_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	100.0	2.6e-36
WP_006250107.1|1573756_1575418_-	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	100.0	4.6e-311
WP_006250106.1|1575365_1576769_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	100.0	3.3e-265
WP_147010800.1|1576781_1578014_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	99.5	4.0e-243
WP_006250104.1|1577997_1578522_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_020824300.1|1578913_1579147_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1579091_1579442_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1579414_1579984_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1579976_1580222_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1580560_1580746_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1581065_1581539_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1581528_1582098_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1582225_1582420_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1582465_1582678_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1582727_1583234_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1583217_1583433_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_147010801.1|1583489_1584059_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	9.9e-104
WP_006250085.1|1584055_1585417_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1585413_1586283_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1586591_1586852_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1586872_1587079_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1587208_1587868_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1587918_1588299_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006253272.1|1588291_1588789_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	98.9	9.1e-45
WP_147010796.1|1588898_1589939_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	1.0e-199
WP_006253368.1|1590076_1590382_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1590390_1590666_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1590957_1591188_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1591569_1591806_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1592374_1592881_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1592884_1593244_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1593240_1593720_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1593853_1594066_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_015587043.1|1594972_1596013_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	4.8e-197
WP_006250257.1|1596277_1597072_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_147010802.1|1597068_1597704_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	99.5	1.4e-119
WP_006250260.1|1597913_1598366_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1598443_1598971_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1598967_1599171_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1599154_1599619_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1599622_1599811_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1600272_1600488_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1601032_1601734_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247798.1|1602251_1602626_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
WP_006253314.1|1602633_1602801_+	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006253316.1|1602881_1603205_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247795.1|1605314_1605908_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006247794.1|1605918_1606965_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247793.1|1606961_1607645_-	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247792.1|1607702_1607891_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247791.1|1608015_1608672_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247790.1|1608683_1609058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1609209_1609947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1609982_1610579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1611223_1611409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249219.1|1611392_1611590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249218.1|1611592_1612567_+	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
>prophage 6
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	1689907	1805698	2661933	terminase,integrase,tail,tRNA,holin,transposase,portal	Mannheimia_phage(44.07%)	110	1768195:1768212	1814156:1814173
WP_015587099.1|1689907_1690840_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	94.1	5.3e-163
WP_006253498.1|1691984_1694216_-	collagen-binding protein	NA	NA	NA	NA	NA
WP_006248069.1|1694409_1695639_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_006253499.1|1695911_1697705_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	42.6	1.1e-23
WP_006248071.1|1697791_1698751_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006248072.1|1698796_1699471_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.0	7.8e-23
WP_006248073.1|1699573_1700491_+	GTPase Era	NA	NA	NA	NA	NA
WP_006248074.1|1700720_1701443_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006248075.1|1701530_1702766_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	1.9e-38
WP_006248076.1|1702824_1704315_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	6.2e-81
WP_006248077.1|1704376_1705003_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006248078.1|1705012_1706023_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	3.5e-27
WP_006248079.1|1706032_1707679_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253500.1|1707801_1708830_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006253501.1|1709174_1709894_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006248082.1|1709989_1710841_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_006248083.1|1710904_1712467_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_006248084.1|1712558_1713275_+	UMP kinase	NA	NA	NA	NA	NA
WP_006248085.1|1713326_1713884_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006248086.1|1714020_1714704_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_006248087.1|1714871_1716035_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_006248088.1|1716035_1716881_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_006248089.1|1716892_1718728_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_006253502.1|1718808_1722906_+	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_006248092.1|1723020_1724787_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_006248093.1|1724786_1726451_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.8e-21
WP_006248094.1|1726582_1727212_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_006248095.1|1727245_1728613_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	3.1e-111
WP_006248096.1|1728679_1729441_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	1.2e-19
WP_006248097.1|1729433_1730309_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006250663.1|1730716_1732549_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	48.4	4.9e-152
WP_006248098.1|1732558_1735195_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.9	4.3e-141
WP_006248099.1|1735326_1737759_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_006248100.1|1737811_1738774_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006253504.1|1738870_1740634_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248102.1|1740897_1743186_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006248103.1|1743316_1743910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253505.1|1743971_1744388_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1744434_1745571_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_134983790.1|1745729_1746191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248107.1|1748173_1748851_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_031192850.1|1748872_1750654_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248109.1|1750663_1751527_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_006253509.1|1751526_1752201_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248111.1|1752227_1753148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134916814.1|1753148_1753442_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248113.1|1753544_1754558_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_006248114.1|1754624_1754918_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248118.1|1756395_1757871_+	ribonuclease G	NA	NA	NA	NA	NA
WP_006248119.1|1758024_1759527_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006247812.1|1759831_1760125_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_147010799.1|1760247_1767306_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	96.9	0.0e+00
WP_006249176.1|1767315_1767945_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
1768195:1768212	attL	TACAAGCGGTCATTTTTT	NA	NA	NA	NA
WP_006249177.1|1768213_1768945_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	100.0	4.2e-147
WP_147010803.1|1768948_1769665_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	97.5	1.5e-133
WP_006249179.1|1769664_1769994_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1769993_1773560_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1773613_1773841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1773903_1774134_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1774178_1774580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249185.1|1774663_1775305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1775332_1775728_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1775724_1776249_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1776252_1776555_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1776547_1776871_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1776944_1778906_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1778917_1780417_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1780416_1780641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147010804.1|1780637_1782749_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.6e-274
WP_006249194.1|1782748_1783225_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1783372_1783771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020824324.1|1783906_1784140_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	86.5	7.0e-32
WP_006249197.1|1784084_1784435_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1784435_1785032_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1785021_1785369_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_147010805.1|1785532_1786339_-	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1786418_1786778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1786767_1787127_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1787119_1788148_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_147010806.1|1788217_1788790_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.3	1.2e-104
WP_006249422.1|1788786_1789422_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1789409_1790201_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1790197_1790959_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1791007_1791232_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1791358_1792090_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1792094_1792598_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1792594_1793707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1793970_1794201_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1794653_1794905_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1794907_1795183_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1795396_1795582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1795565_1795763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1795765_1796224_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1796259_1796619_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1796688_1797492_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1797601_1798120_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1798116_1798317_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1798300_1798798_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1798801_1798990_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1799121_1799499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1799728_1800568_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1800815_1801493_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1801731_1802169_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1802161_1802455_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1802457_1802667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1802813_1802939_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1802985_1803828_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1803890_1804382_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1804407_1804683_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1804642_1805698_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1814156:1814173	attR	TACAAGCGGTCATTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	1816819	1862427	2661933	tRNA,protease,integrase,tail	Mannheimia_phage(50.0%)	57	1830052:1830068	1836919:1836935
WP_006253274.1|1816819_1817464_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1817799_1818219_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006250075.1|1818257_1818440_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250077.1|1818571_1819069_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1819061_1819442_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1819516_1820200_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1820330_1820531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1820932_1821619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1821795_1822095_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1822066_1822456_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1822599_1822893_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006247813.1|1823177_1826036_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
WP_006247814.1|1826146_1826788_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_006247815.1|1826867_1827188_+	trp operon repressor	NA	NA	NA	NA	NA
WP_006250687.1|1827162_1827948_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_006247817.1|1827959_1828679_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_006247818.1|1828675_1829587_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_006247820.1|1829743_1831012_+	malic enzyme	NA	NA	NA	NA	NA
1830052:1830068	attL	TGATGTGTTTGATATTG	NA	NA	NA	NA
WP_006247821.1|1831163_1831451_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_006247822.1|1831609_1832650_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
WP_006247823.1|1832671_1832893_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006253376.1|1832942_1833326_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	2.0e-68
WP_006247799.1|1833727_1834123_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006247800.1|1834154_1834796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247801.1|1834878_1835280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247802.1|1835324_1835555_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006247803.1|1835622_1835889_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_006247804.1|1835892_1836162_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_006247805.1|1836236_1836500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253312.1|1836559_1837270_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
1836919:1836935	attR	TGATGTGTTTGATATTG	NA	NA	NA	NA
WP_006247806.1|1837527_1838247_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1838468_1839095_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006253310.1|1839143_1839755_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247808.1|1839865_1840552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1840728_1841028_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1840999_1841389_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1841532_1841826_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1842204_1843503_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1843676_1844564_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006250046.1|1844566_1845790_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006250045.1|1845960_1846290_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.0e-16
WP_006253592.1|1846544_1847216_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_006249856.1|1847470_1850038_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.4	2.0e-127
WP_100067206.1|1849978_1850161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249857.1|1850251_1851394_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	71.1	1.0e-163
WP_006253591.1|1851450_1852842_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006253590.1|1853001_1853901_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006249771.1|1853914_1854817_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006249772.1|1854813_1855170_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006249773.1|1855239_1855845_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006249774.1|1855918_1857826_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.4	1.3e-91
WP_006249776.1|1858033_1858258_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_006249777.1|1858300_1858630_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_006249778.1|1858668_1859055_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_006249779.1|1859143_1859344_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	47.7	8.8e-07
WP_006249780.1|1859396_1861589_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	3.5e-104
WP_006249781.1|1861641_1862427_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP017529	Mannheimia haemolytica strain 1560 chromosome, complete genome	2661933	2275538	2283693	2661933	terminase,integrase	Synechococcus_phage(16.67%)	12	2278744:2278803	2284109:2284182
WP_006250276.1|2275538_2276078_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2276215_2276506_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2276477_2276780_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2276797_2277091_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2277041_2277254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2277256_2278216_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2278744:2278803	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2279022_2280249_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2280523_2280742_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2280854_2281178_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2281572_2282259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2282578_2283004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2283000_2283693_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2284109:2284182	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
