The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	326339	337219	5302257	integrase,transposase	Enterobacteria_phage(22.22%)	10	328878:328894	345399:345415
WP_000749863.1|326339_327395_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|327682_328786_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|328797_330051_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
328878:328894	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000772642.1|330406_331621_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|331763_332645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|332842_333040_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|333039_333471_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_001019379.1|333483_334317_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_162829202.1|334450_335663_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000942525.1|336148_337219_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
345399:345415	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 2
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	551025	630917	5302257	tRNA,protease,head,transposase,tail,capsid	Escherichia_phage(33.33%)	70	NA	NA
WP_000186631.1|551025_551505_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|551708_552503_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_001342071.1|552640_552982_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|553095_555600_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|555861_556794_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|556796_558089_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|558213_558621_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|558621_559080_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|559076_559994_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|560139_560817_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|560803_561586_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|561648_562503_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|562563_563373_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|563362_563986_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|563956_564643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|564639_567054_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|571675_571936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|571992_572166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|573167_574262_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|574330_575257_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|575486_575969_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|576046_576862_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|576951_578733_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|578745_579522_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|579621_580500_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|580668_582123_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|582182_583544_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|583600_584902_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|584923_586069_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|586197_586983_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|586993_588229_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|588250_589300_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|589616_591284_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|591293_592553_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|592563_593379_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|593375_594269_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|594405_595473_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|595469_595979_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|596096_596819_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|596821_597316_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|597489_598875_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|598910_599432_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|599539_599752_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|599753_600620_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|601100_601643_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|601862_602555_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|602585_605195_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|606246_606762_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|606764_607397_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001277425.1|608025_608598_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.4	6.3e-90
WP_001345004.1|608607_608940_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|608995_610021_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|610062_610458_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|610469_610769_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|610789_612002_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985132.1|612095_612674_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683103.1|612670_613066_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|613073_613814_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|613829_614252_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|614233_614668_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|614660_616841_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_162829202.1|616846_618059_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000239881.1|618129_618798_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226384.1|619343_620828_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|621014_621968_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|622480_623242_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|623424_624315_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|624315_627288_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|627274_629512_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|629780_630917_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	850451	869773	5302257	integrase,transposase,tail,holin	Enterobacteria_phage(54.55%)	27	850364:850378	871100:871114
850364:850378	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000263438.1|850451_851528_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_162829202.1|851935_853149_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000075117.1|853154_853352_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_085948261.1|853351_853567_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000023272.1|854005_855856_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|856154_856313_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|856398_857142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|857326_858016_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|858030_858153_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|858493_859453_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|859664_859853_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|859849_860212_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_146868587.1|860208_860499_-	DUF1364 family protein	NA	K7PK25	Enterobacteria_phage	96.9	4.6e-49
WP_001286917.1|860491_860704_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|860696_860873_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|860872_861232_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|861234_861411_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814614.1|861407_861818_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_000344554.1|861789_862152_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000818841.1|862169_862376_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000145948.1|862448_862739_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_146868672.1|864024_864282_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
WP_000950982.1|864387_865269_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001369236.1|865492_866323_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_021351651.1|866446_866818_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001002868.1|868036_868417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|868560_869773_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
871100:871114	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
>prophage 4
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	1080426	1122985	5302257	holin,transposase,protease	Escherichia_phage(37.04%)	55	NA	NA
WP_000156528.1|1080426_1082187_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1082372_1082825_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1082900_1083941_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1084297_1084807_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1085079_1085655_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1085617_1087780_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1087789_1088236_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1088358_1090413_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1090444_1090903_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1090998_1091661_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1091833_1092247_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1092291_1092609_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1092666_1093857_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1093951_1094230_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1094226_1094556_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1094646_1095306_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1096706_1096949_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000878794.1|1097016_1098057_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	2.1e-59
WP_162829202.1|1098111_1099325_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000048507.1|1099376_1100801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1100893_1101085_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1101081_1101270_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1101801_1102176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1102187_1102340_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1102612_1103329_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1103378_1103594_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1103590_1104016_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1104087_1105158_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1105198_1105621_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1105617_1105914_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1105910_1106372_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1106349_1106706_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1106756_1106969_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1107220_1107484_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1107494_1108364_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1108479_1108584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1108772_1108985_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1109152_1109413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1109432_1110482_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1110494_1110866_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1110855_1111227_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1111378_1112197_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1112483_1112681_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1112818_1113532_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1114299_1116150_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024182511.1|1116588_1116804_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000138558.1|1117059_1117332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1117491_1118025_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1118245_1118359_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1118580_1118766_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1119292_1119607_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1119688_1119913_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_162829202.1|1119962_1121176_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_012817858.1|1121262_1122156_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1122601_1122985_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	1339987	1402679	5302257	holin,tRNA,terminase,head,integrase,tail,capsid	Stx2-converting_phage(43.48%)	65	1335081:1335095	1341562:1341576
1335081:1335095	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1339987_1341106_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1341074_1341344_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1341405_1343871_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1341562:1341576	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1343963_1344155_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1344151_1344340_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1344679_1344820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1344823_1345042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1345082_1345472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1345767_1346046_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1346047_1346239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1346259_1346631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1346728_1347031_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|1347027_1347453_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_146868674.1|1348160_1348331_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.0	5.3e-13
WP_012817871.1|1348498_1348771_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1348772_1349828_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1349828_1350194_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1350202_1350733_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1350974_1351172_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1351322_1352381_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|1353177_1355028_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_024164617.1|1355466_1355682_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731236.1|1355686_1356031_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1356081_1356615_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1356885_1357455_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1357454_1357601_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1357828_1358014_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1358438_1358666_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1358707_1359073_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1359363_1359927_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1359923_1361585_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_061104266.1|1361648_1363586_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063097.1|1363630_1363852_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	1.3e-35
WP_000125988.1|1366540_1366867_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1366876_1367227_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1367223_1367670_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1367666_1368011_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1368077_1368794_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1368799_1369174_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1369269_1369479_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1369530_1372773_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1372765_1373107_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1373106_1373805_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1373821_1374142_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1374249_1374423_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1375470_1376208_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1376153_1376786_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|1377022_1380502_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|1380568_1381168_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|1381232_1382555_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|1382556_1382826_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1382932_1383022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1383041_1385390_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001369471.1|1385980_1389382_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_001303921.1|1390356_1390632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1390692_1392054_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1392417_1393281_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1393264_1394401_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359442.1|1394650_1395880_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1396025_1397147_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1397222_1398683_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1398682_1399354_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1399521_1400892_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1400895_1401537_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1401572_1402679_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	1503895	1576917	5302257	holin,lysis,terminase,protease,portal,transposase,tail	Enterobacteria_phage(44.23%)	79	NA	NA
WP_000268365.1|1503895_1504444_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_172965446.1|1506290_1507503_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_000075578.1|1507567_1508104_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1508136_1508418_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1508414_1508711_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1508707_1509169_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1509146_1509503_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1509598_1509970_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1509966_1510320_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1510525_1510825_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1510830_1511088_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1511223_1511502_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1511503_1512553_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1512565_1512940_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1512936_1513758_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1513984_1514182_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1514332_1515391_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1515985_1517932_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1518069_1518249_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1518289_1518535_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1518612_1518828_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1518831_1519077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172965446.1|1519102_1520315_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_000992150.1|1520738_1521272_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_001082532.1|1521570_1522038_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
WP_000373407.1|1522451_1522928_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1522924_1525048_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1525044_1525257_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1525256_1526759_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1526703_1528728_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1528815_1529142_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1529134_1529416_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1529418_1530042_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1530054_1530453_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_146868599.1|1530460_1531213_+	Ig-like domain-containing protein	NA	Q687F6	Enterobacteria_phage	99.6	6.4e-135
WP_000479043.1|1531226_1531649_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1531675_1531984_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1532027_1534673_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1534669_1534999_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|1535706_1536450_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|1536395_1537028_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_106895295.1|1537264_1540741_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_001230455.1|1540808_1541408_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_112033816.1|1541472_1542786_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1542787_1543057_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000692020.1|1544192_1544783_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1545160_1545331_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|1545819_1546326_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1546371_1546872_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1546957_1547137_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1547517_1548324_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1548323_1549517_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1549528_1550890_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1550890_1552486_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1552485_1554048_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1554139_1554184_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1554321_1555203_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1555199_1555820_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1555920_1556793_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1556832_1557423_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1557419_1558178_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1558397_1559447_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1559482_1559734_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1560113_1562711_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_000776253.1|1562920_1563895_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1564189_1564354_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001297116.1|1564356_1564524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1564637_1564733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099519.1|1564896_1567572_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1567635_1568226_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256539.1|1568395_1569160_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876286.1|1569308_1569617_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1569623_1570793_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000176278.1|1570984_1571722_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001295580.1|1571721_1572048_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000498253.1|1572173_1572392_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088625.1|1572660_1573410_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1573499_1573673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1575703_1576917_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 7
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	1637301	1733060	5302257	holin,tRNA,terminase,head,integrase,transposase,tail,capsid	Escherichia_phage(41.38%)	114	1667184:1667243	1726752:1728061
WP_000628065.1|1637301_1638534_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1638788_1639772_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1640249_1641623_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1641751_1642687_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1642738_1643974_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1643975_1644191_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1644290_1644479_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1644516_1644666_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1644721_1645531_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1645523_1648124_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1648225_1648501_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1648575_1648746_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1648745_1648967_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1649408_1649897_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1649893_1650049_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1650059_1650239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1650481_1650901_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1650980_1651235_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1651231_1651654_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|1651731_1652520_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|1652526_1653273_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|1653295_1654057_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|1654072_1654495_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|1654600_1654813_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1655064_1655328_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|1655338_1655500_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|1655578_1655824_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|1656255_1657407_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1657374_1658364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1658363_1659755_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000940319.1|1660254_1660854_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|1660853_1661144_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|1661140_1661695_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|1662256_1662688_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_106914131.1|1663258_1665112_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|1665261_1665477_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1665481_1665826_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|1665876_1666410_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|1666683_1667223_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
1667184:1667243	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|1667225_1668439_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000285960.1|1668515_1668692_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|1668786_1668918_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1669140_1669326_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1669726_1670053_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1670184_1670385_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1670426_1670792_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1671080_1671644_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1671640_1673302_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|1673365_1675303_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|1675347_1675569_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1677933_1678260_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|1678269_1678620_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1678616_1679063_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1679059_1679404_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275480.1|1679472_1680189_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_001030060.1|1680194_1680569_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1680664_1680874_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212770.1|1680925_1684168_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_000807964.1|1684160_1684502_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|1684501_1685200_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|1685210_1685954_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1685899_1686532_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1686722_1687250_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_146868604.1|1687383_1690857_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.1	0.0e+00
WP_001228290.1|1690924_1691524_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|1691675_1692980_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|1692981_1693251_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|1694365_1694488_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1694594_1695506_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_172965446.1|1696052_1697266_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001303943.1|1698292_1698571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1698998_1699145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1699281_1699929_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|1700112_1700703_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|1702209_1702860_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001261191.1|1703208_1703562_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|1703652_1704372_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_112033818.1|1704411_1704810_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1704914_1705454_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|1705483_1706227_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1706583_1707222_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1707267_1708398_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1708375_1708624_-	excisionase	NA	NA	NA	NA	NA
WP_000048484.1|1708688_1711160_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|1711255_1711444_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1711440_1711629_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|1712028_1712196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1712189_1712423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1712400_1712808_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|1712830_1713049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1713121_1713421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1713685_1714093_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|1714379_1714931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1714902_1715943_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1715854_1716397_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|1716430_1717165_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|1717161_1717326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1718024_1718783_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1719061_1719274_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1719494_1719752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|1719821_1720100_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|1720101_1721157_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|1721157_1721523_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1721519_1722209_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|1723734_1725504_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_162829202.1|1725555_1726768_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023452.1|1726858_1727128_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|1727268_1728144_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1726752:1728061	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTG	NA	NA	NA	NA
WP_001121225.1|1728368_1729019_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001345374.1|1729346_1729496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817881.1|1729614_1729857_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|1729988_1731272_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|1731360_1732821_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1732856_1733060_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	1872234	1994859	5302257	holin,lysis,terminase,protease,head,portal,integrase,transposase,tail,capsid	Stx2-converting_phage(37.25%)	114	1953741:1953757	1990089:1990105
WP_000826406.1|1872234_1873443_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|1873969_1874638_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|1874940_1875534_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|1875530_1876523_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140877.1|1877620_1878157_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1878219_1878444_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1878583_1880239_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|1880463_1881807_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|1882023_1882947_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|1882984_1884625_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1885023_1885173_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1885244_1885418_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1885662_1886193_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1886381_1887383_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|1888923_1889724_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|1889995_1893898_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1894098_1894704_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1894754_1896071_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|1896060_1897818_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|1897833_1898730_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1898729_1899335_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097801.1|1901875_1902736_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|1902966_1903557_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|1903538_1904489_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1904589_1905903_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|1905929_1907135_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1907134_1907557_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1907546_1908974_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|1908975_1909764_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1909763_1910531_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|1910527_1911598_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1911605_1912103_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1912117_1912864_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1912872_1913160_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1913171_1914101_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|1914385_1916431_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_146868615.1|1916678_1918952_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|1920731_1921637_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|1921808_1922138_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1922142_1922328_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|1922324_1924964_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1925171_1926161_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1926271_1926694_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1926690_1926957_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|1927230_1930755_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|1931121_1932255_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|1932395_1932830_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1933410_1934052_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1934133_1934763_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|1934835_1935411_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|1935523_1935793_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|1935794_1937108_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|1937172_1937772_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_112033822.1|1937842_1941340_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_096860308.1|1941682_1942315_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|1942260_1943004_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|1943009_1943708_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|1943707_1944049_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000091308.1|1945502_1945868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|1945867_1947055_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001453698.1|1949163_1949373_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030041.1|1949468_1949843_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_112033823.1|1949848_1950565_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	96.6	1.2e-125
WP_000133393.1|1950631_1950976_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1950972_1951419_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1951415_1951766_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1951775_1952102_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_012817878.1|1952104_1954684_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
1953741:1953757	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063099.1|1954629_1954851_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|1954895_1956833_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|1956896_1958558_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1958554_1959118_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|1959407_1959773_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|1959814_1960042_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1960410_1960635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082554.1|1960631_1961126_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
WP_000992122.1|1961423_1961957_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1962007_1962352_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_029785460.1|1962356_1962572_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000143036.1|1963008_1964859_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|1965306_1965438_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_162829202.1|1965697_1966910_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000705364.1|1967594_1968116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1968099_1968327_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1968404_1968812_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1969004_1969157_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241298.1|1969156_1969534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1969502_1969790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1970205_1970394_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1970390_1970582_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048302.1|1970675_1973147_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_000005552.1|1973219_1973471_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876990.1|1973505_1974786_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|1974805_1974916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1974973_1975993_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1976004_1977219_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1977424_1977751_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1977885_1978227_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1978261_1978822_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1978824_1979535_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1979642_1979948_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1980146_1982573_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001342196.1|1982633_1985057_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1985067_1985685_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1985686_1986541_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1986583_1987198_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|1987356_1988649_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|1988601_1989297_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|1989421_1990642_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
1990089:1990105	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|1990776_1991670_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1991776_1993030_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|1993426_1993762_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1993854_1993938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|1994037_1994859_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 9
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	2118340	2155439	5302257	holin,tRNA,terminase,head,portal,tail,plate,capsid	Enterobacteria_phage(88.57%)	44	NA	NA
WP_100206497.1|2118340_2118619_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2118629_2118908_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2118919_2119162_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000686506.1|2120695_2121655_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2121659_2121971_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2122335_2122605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2123167_2123692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2123706_2124753_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2124752_2126504_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2126658_2127495_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2127518_2128571_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2128616_2129417_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2129519_2130014_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2130013_2130214_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2130216_2130540_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2130536_2130929_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2130925_2131333_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2131470_2131938_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2131930_2132566_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001369311.1|2132577_2133144_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.1e-98
WP_001067548.1|2133161_2133491_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111942.1|2133494_2134391_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2134383_2134914_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2134916_2137049_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2137048_2137627_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2137670_2138243_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2138399_2138888_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2138900_2141708_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2141694_2141850_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2141858_2142233_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2142288_2142801_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2142800_2143985_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2144142_2145252_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2145477_2146980_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2147223_2147484_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2147674_2147815_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2148121_2148421_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2148425_2150813_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2150827_2151811_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2152094_2152139_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2152261_2152618_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2152670_2152868_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2152964_2153507_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2153510_2155439_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 10
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	2375070	2465584	5302257	holin,terminase,head,portal,integrase,transposase,tail,capsid	Escherichia_phage(32.31%)	105	2408272:2408289	2466254:2466271
WP_162829202.1|2375070_2376284_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_146868618.1|2376289_2377414_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.4	9.8e-188
WP_000879833.1|2378805_2379603_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2379612_2380164_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2380332_2380665_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2380998_2381313_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|2381526_2383185_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2383177_2384173_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2384165_2384852_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|2384851_2386225_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2386243_2386687_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620092.1|2386683_2387811_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2387915_2388380_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2388384_2389389_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2389385_2389799_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2389801_2390167_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2390166_2390904_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2390913_2391183_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2391190_2391976_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2392265_2392889_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2392932_2393121_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2393283_2393511_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2393808_2394624_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2394620_2396315_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|2396485_2396668_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2396746_2397664_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2397836_2398757_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2398745_2399216_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2399196_2400615_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2400681_2401377_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2401416_2401782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172965447.1|2402348_2403194_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.8	2.4e-69
WP_172965448.1|2403196_2404410_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.9e-168
WP_000218214.1|2405415_2406267_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2406374_2407733_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2407732_2408404_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
2408272:2408289	attL	AATCATCCTTCAGCGCAA	NA	NA	NA	NA
WP_000920136.1|2408536_2408950_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2409058_2410063_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2410063_2410699_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_167587660.1|2410955_2411606_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2411948_2412479_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2413713_2414727_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2415132_2415402_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|2415403_2416717_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|2416781_2417381_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|2417448_2420925_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|2421171_2421804_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2421749_2422493_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2422498_2423197_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2423196_2423526_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_146868625.1|2423522_2426135_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	95.7	0.0e+00
WP_000533440.1|2426115_2426529_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2426555_2426978_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2426991_2427744_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2427751_2428147_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2428143_2428677_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2428692_2429046_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2429038_2429422_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2429473_2430502_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2430559_2430907_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2430943_2432449_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2432438_2434031_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2434027_2434234_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2434217_2436146_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2436117_2436624_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2437050_2437275_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2437356_2437671_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2438196_2438382_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2438899_2439433_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_162829202.1|2439863_2441077_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000284516.1|2441308_2441524_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2441600_2441873_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2441913_2442093_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_024222300.1|2442230_2444168_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2444646_2445078_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2445165_2445591_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2445587_2445938_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2445968_2447582_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2448067_2448781_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2448915_2449113_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2449336_2449891_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2449899_2450259_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2450271_2451321_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2451322_2451595_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2451716_2452061_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2452180_2452393_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2452626_2453184_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2453185_2453404_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2453531_2453843_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2453835_2454063_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2454059_2454341_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2454373_2455090_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2455111_2455858_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2455864_2456935_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2457006_2457432_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2457415_2457697_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2457796_2458216_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2458481_2458634_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2458645_2459284_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2459284_2459494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2460064_2460253_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2460249_2460441_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048405.1|2460533_2462921_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001300307.1|2463156_2463954_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2464309_2465584_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2466254:2466271	attR	TTGCGCTGAAGGATGATT	NA	NA	NA	NA
>prophage 11
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	2469975	2546247	5302257	holin,lysis,terminase,coat,head,portal,integrase,transposase	Enterobacteria_phage(46.48%)	95	2476938:2476952	2547926:2547940
WP_172965449.1|2469975_2471189_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.9e-168
WP_000405068.1|2472518_2473661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429746.1|2473746_2474022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000722538.1|2474032_2474563_-	lipoprotein	NA	NA	NA	NA	NA
WP_162829202.1|2475012_2476225_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
2476938:2476952	attL	AGCATCGCCAATCTG	NA	NA	NA	NA
WP_001060244.1|2478764_2480219_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532913.1|2480561_2481278_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011007.1|2483667_2484618_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011461.1|2484719_2485637_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986337.1|2486094_2487030_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193804.1|2487091_2488171_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|2488182_2488926_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2488922_2489468_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_096861628.1|2491765_2492527_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_000775497.1|2492662_2493346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2493361_2493772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234505.1|2493992_2494814_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
WP_000860076.1|2494895_2495375_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2495390_2495867_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2495935_2496157_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285585.1|2496230_2496599_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988599.1|2497057_2497252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2497264_2497378_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016348.1|2497866_2498049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2498149_2498479_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001105393.1|2499907_2500381_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001369224.1|2500495_2501662_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
WP_136721030.1|2502515_2503424_+	acyltransferase	NA	NA	NA	NA	NA
WP_136721029.1|2503464_2505402_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A140G5Z9	Enterobacteria_phage	88.7	1.2e-270
WP_001407254.1|2505504_2505792_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085227.1|2505806_2506028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069044833.1|2506027_2506756_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.4	1.5e-80
WP_162829202.1|2507095_2508308_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024191015.1|2508868_2509042_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_032152582.1|2509165_2509417_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	68.6	2.1e-10
WP_021575669.1|2509467_2510106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|2511486_2512700_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_095794581.1|2513269_2514742_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.8	8.2e-142
WP_021560730.1|2514751_2515426_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	69.3	1.5e-53
WP_021528605.1|2515400_2515880_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	8.4e-64
WP_146868628.1|2515879_2516728_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	3.3e-103
WP_146868630.1|2516727_2518146_-	hypothetical protein	NA	Q716G7	Shigella_phage	99.6	7.1e-276
WP_001140510.1|2518155_2518617_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_040072350.1|2518597_2518786_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	96.8	7.2e-27
WP_040072349.1|2518827_2520081_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	99.5	1.3e-236
WP_040072348.1|2520099_2520993_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	7.4e-130
WP_000818367.1|2521083_2523282_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_000200766.1|2523283_2524699_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_001436504.1|2524695_2525118_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000205033.1|2525141_2525321_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
WP_000139136.1|2525330_2525618_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
WP_000807789.1|2525621_2525864_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_001139676.1|2526171_2526324_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_146868632.1|2526311_2526779_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	94.8	6.7e-74
WP_000229396.1|2526775_2527252_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000783734.1|2527235_2527559_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001377516.1|2527669_2527852_+	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.2e-26
WP_001235464.1|2527993_2528617_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	99.5	5.2e-114
WP_000994516.1|2528613_2528802_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008180.1|2528798_2529161_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	100.0	9.2e-63
WP_000002230.1|2529157_2529448_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001283996.1|2529448_2529667_-	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	4.3e-23
WP_000566871.1|2529659_2529830_-	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_001254257.1|2529826_2530009_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000153271.1|2530005_2530533_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
WP_001303571.1|2530529_2530976_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2530932_2531169_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2531179_2531395_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2531527_2531806_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|2531875_2532145_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_162829202.1|2532541_2533754_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000065668.1|2534883_2535783_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|2535775_2535922_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438527.1|2535954_2536251_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000067727.1|2536392_2536608_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_016242500.1|2536683_2537379_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000088201.1|2537724_2537997_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000167579.1|2538055_2538526_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	8.2e-88
WP_001183771.1|2538720_2538891_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000050554.1|2538966_2539137_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_162829202.1|2539495_2540709_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_136751564.1|2541065_2541449_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	1.2e-65
WP_001111307.1|2541472_2541766_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	3.2e-50
WP_136721026.1|2541776_2541890_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	97.3	1.3e-12
WP_000109677.1|2541940_2542240_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.1e-56
WP_001033097.1|2542241_2542796_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	87.7	1.0e-57
WP_001261535.1|2542795_2542972_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	96.6	4.5e-23
WP_000797282.1|2542968_2543157_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000951710.1|2543158_2543368_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_172965450.1|2543364_2543691_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	87.3	3.3e-27
WP_001369222.1|2543708_2544167_+	hypothetical protein	NA	Q9G077	Enterobacteria_phage	98.8	7.1e-44
WP_000002108.1|2544159_2544444_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	9.1e-50
WP_000227131.1|2544515_2544815_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	3.0e-51
WP_000132739.1|2544896_2545088_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007947.1|2545068_2546247_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
2547926:2547940	attR	AGCATCGCCAATCTG	NA	NA	NA	NA
>prophage 12
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	2740693	2809579	5302257	holin,lysis,terminase,protease,integrase,transposase,capsid	Enterobacteria_phage(17.24%)	64	2778634:2778669	2810519:2810554
WP_000101907.1|2740693_2741935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2742431_2742638_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2742592_2744401_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2744616_2744856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2744828_2745062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2745054_2745288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2745293_2745593_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2745589_2746990_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2747190_2747436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2747566_2747761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2747764_2747926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2748053_2748542_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_000006073.1|2748553_2748715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001369202.1|2748704_2749628_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2753004_2753652_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2753686_2754739_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2754735_2755293_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2755289_2757233_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|2757229_2757709_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2757705_2757915_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2757911_2758649_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2758690_2759353_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2759349_2759967_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2759985_2760588_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2760597_2761047_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2761043_2761907_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2761893_2762589_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2762595_2765082_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2765078_2765342_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2765331_2765826_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2766234_2766723_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2766871_2768518_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2768735_2770379_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2770454_2771105_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2771104_2772169_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2772242_2773298_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2773409_2774501_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2775239_2777912_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2777928_2778579_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2778634:2778669	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876014.1|2778778_2781628_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2781902_2782679_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2782683_2784333_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|2784333_2788728_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2789529_2790852_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145680.1|2791545_2792184_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_162829202.1|2792221_2793434_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000881316.1|2793474_2793999_-	Rha family transcriptional regulator	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_000092247.1|2794148_2794586_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2794582_2795080_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2795079_2795295_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2795437_2795836_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2795916_2796075_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2797167_2797791_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001223927.1|2798448_2799051_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2799025_2799592_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2800139_2801072_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2801110_2801938_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2802441_2802624_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2802780_2803125_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2803230_2803449_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2803426_2804497_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2804491_2805118_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2805114_2806803_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2806951_2809579_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2810519:2810554	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 13
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	2898254	2989084	5302257	holin,lysis,tRNA,bacteriocin,terminase,portal,integrase,transposase,tail,capsid	Escherichia_phage(78.38%)	103	2929806:2929830	2989279:2989303
WP_001283576.1|2898254_2899067_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2899066_2900080_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2900145_2901282_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2901380_2902376_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2902372_2903551_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2903834_2905055_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|2905213_2907220_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2907340_2907619_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2907652_2908201_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2908200_2909010_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2909009_2909834_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2909837_2910923_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2910957_2911890_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2912055_2912607_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2912679_2913531_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2913532_2914072_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2914068_2914557_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2914553_2915063_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|2915078_2915831_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112824.1|2915850_2918496_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2918577_2919141_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2919824_2920310_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|2920512_2922657_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2922656_2923967_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2924146_2924431_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2924802_2926143_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2926509_2927568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2927749_2928505_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2928798_2929731_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2929806:2929830	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000331692.1|2929952_2938334_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|2938403_2939669_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|2939679_2939931_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|2939940_2940387_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|2940389_2941046_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2941139_2941541_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2941597_2941738_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|2941970_2942705_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|2942795_2943413_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2943418_2943697_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|2943711_2944980_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|2944976_2946602_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|2946896_2947085_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|2947224_2947494_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|2947495_2949433_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207926.1|2949429_2950080_-	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000829200.1|2950079_2950643_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|2950626_2951088_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|2951137_2951527_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|2951582_2952797_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|2952820_2953828_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|2953985_2956130_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|2956129_2957836_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|2957816_2958623_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001301714.1|2958678_2958882_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|2959031_2959325_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|2959356_2959821_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|2959828_2959978_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2959977_2960547_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087729.1|2960821_2961355_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072901.1|2961359_2961575_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290210.1|2961652_2961898_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000143458.1|2961938_2962118_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874428.1|2962252_2964190_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|2964675_2964945_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2964956_2965916_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2966298_2966451_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204844.1|2966699_2967134_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|2967126_2967321_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001187434.1|2967317_2967881_-	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000402093.1|2967888_2968338_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001193567.1|2968337_2969309_-	toprim domain-containing protein	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|2969298_2970819_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|2970812_2971190_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|2971356_2971551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171145.1|2971713_2971953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000162431.1|2972058_2972778_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
WP_000939555.1|2972873_2974343_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
WP_025404424.1|2974339_2975293_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
WP_000331648.1|2975473_2975944_+	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
WP_001292087.1|2975943_2976324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706115.1|2976941_2977727_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.0e-139
WP_000917252.1|2977797_2978010_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934196.1|2978021_2978303_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	3.0e-45
WP_000995345.1|2978323_2978605_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|2978621_2979572_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187065.1|2979568_2980249_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.6	6.0e-132
WP_000682306.1|2980245_2980428_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|2980400_2980592_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_001444000.1|2980602_2980884_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000774248.1|2980982_2981204_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|2981200_2981974_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|2982125_2982314_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_146868640.1|2982315_2982531_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	98.6	6.7e-37
WP_001142590.1|2982532_2982751_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|2982752_2983040_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_146868642.1|2983043_2983667_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	95.7	1.4e-114
WP_000203834.1|2984022_2984661_+	antA/AntB antirepressor family protein	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_054421941.1|2985145_2985772_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	99.5	1.8e-122
WP_001291844.1|2985731_2985944_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_162829202.1|2986059_2987273_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_146868644.1|2987274_2987670_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	1.1e-45
WP_000453637.1|2987748_2987931_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|2987914_2989084_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
2989279:2989303	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 14
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	3218772	3275742	5302257	tRNA,transposase,tail	Enterobacteria_phage(61.11%)	50	NA	NA
WP_001298974.1|3218772_3219510_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3219641_3220976_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3221185_3222067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3222170_3222758_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3222813_3223197_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3223500_3224190_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3224237_3225275_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3225481_3225901_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3225969_3226668_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3226699_3229360_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3229473_3230829_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3230874_3231198_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3231194_3232493_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3238345_3240919_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3241048_3241780_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3241776_3242757_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3242891_3243629_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3243899_3244241_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3244344_3244392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3244490_3245651_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3245693_3246815_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3246825_3247896_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3248105_3248471_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3248620_3249139_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3249128_3250355_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3250370_3250853_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3250929_3251277_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3251318_3252086_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3252116_3252665_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3252683_3252932_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3253180_3254542_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3254708_3255500_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3255520_3256807_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3256861_3257455_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3257577_3258456_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3258541_3260203_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3260351_3260693_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3260754_3261045_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3261034_3261511_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3261642_3262125_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3262973_3263222_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3263589_3263859_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000279058.1|3263860_3265183_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001230455.1|3265247_3265847_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|3265914_3269391_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|3269637_3270270_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3270215_3270959_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3270964_3271663_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3271662_3271992_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_162829202.1|3274528_3275742_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 15
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	3352291	3359431	5302257		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3352291_3354853_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3354958_3355615_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3355665_3356433_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3356628_3357537_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3357533_3358796_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3358792_3359431_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 16
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	4887253	4933479	5302257	holin,tRNA,terminase,head,transposase,tail,capsid	Enterobacteria_phage(33.33%)	49	NA	NA
WP_000956557.1|4887253_4887787_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|4887983_4888157_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|4888204_4888486_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4888522_4889095_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4889094_4889829_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4889831_4890023_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_171844465.1|4890075_4890354_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.4	1.2e-30
WP_000145671.1|4890638_4891112_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4891108_4891459_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4891449_4891986_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4892113_4892938_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4893003_4893366_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4894069_4894762_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4894859_4895120_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4895112_4895664_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4897176_4897929_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4898238_4898391_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|4899208_4901059_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_024164617.1|4901498_4901714_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075117.1|4901713_4901911_+	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_162829202.1|4901916_4903129_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001208681.1|4903740_4903926_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4904453_4904768_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958398.1|4905668_4906232_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4906228_4907890_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4907953_4909891_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4909935_4910157_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4912520_4912847_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4912856_4913207_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4913203_4913650_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4913646_4913991_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4914057_4914774_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4914779_4915154_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4915249_4915459_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4915510_4918753_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4918745_4919087_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4919086_4919785_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4919795_4920539_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4920484_4921117_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_146868665.1|4921352_4924829_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|4924897_4925521_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4925585_4926899_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4926900_4927170_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4927330_4927753_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4927882_4928941_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4929019_4929670_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4929852_4930443_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4930944_4931193_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|4932441_4933479_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 17
NZ_AP019761	Escherichia coli O111:H- strain 110512	5302257	5048115	5111973	5302257	tRNA,integrase,transposase,protease	Vibrio_phage(12.5%)	60	5089849:5089878	5115340:5115369
WP_000811566.1|5048115_5048391_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|5048507_5050133_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|5050216_5051380_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|5051382_5052021_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5052030_5052429_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|5052446_5053106_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5053156_5053855_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5053873_5054275_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|5054401_5055133_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|5055312_5057673_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|5057711_5058137_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5058341_5059640_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5059743_5059941_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5060022_5061027_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5061029_5062289_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460353.1|5062374_5063655_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|5063731_5064040_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|5064125_5065076_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|5065068_5066916_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|5066925_5068263_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|5068281_5068743_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|5068714_5070262_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|5070260_5071400_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|5071382_5071436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|5072294_5072840_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|5072934_5073987_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|5074083_5075052_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|5075073_5078397_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|5078425_5078740_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|5078736_5079051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|5079102_5080605_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|5080823_5081801_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|5082125_5083934_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|5083926_5084661_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|5084671_5085067_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|5085077_5085437_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|5085499_5086633_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_146868667.1|5086721_5087255_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	54.4	1.0e-46
WP_000118482.1|5087251_5087569_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|5087750_5087897_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|5088007_5088133_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|5088184_5088751_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|5088792_5089821_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
5089849:5089878	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
WP_001008073.1|5090210_5091080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|5091283_5091637_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|5091774_5093421_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_063270118.1|5093464_5093758_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	1.9e-10
WP_000015837.1|5094033_5095290_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|5095305_5095782_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|5096118_5097555_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|5097672_5098974_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|5099089_5099428_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|5099403_5101101_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|5101137_5101713_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|5102092_5103358_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000631719.1|5105019_5105367_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|5107688_5108237_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001453071.1|5108809_5108983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|5110375_5111589_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001254202.1|5111682_5111973_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5115340:5115369	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_AP019763	Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence	78470	23403	76996	78470	transposase	Escherichia_phage(25.0%)	57	NA	NA
WP_162829202.1|23403_24616_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001369729.1|26398_26521_-	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_000002783.1|26507_27098_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_000146670.1|27087_28515_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|28514_29219_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399800.1|29229_29796_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012104.1|29817_30129_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000994781.1|30143_30503_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001309237.1|30535_30931_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000283394.1|31029_31719_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001151524.1|31905_32289_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001234469.1|33508_34330_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|34450_34738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032351767.1|34970_35159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427866.1|35081_35306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|35659_35818_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299721.1|35897_36086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276234.1|36097_36817_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845949.1|36813_37248_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145472.1|37302_39261_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
WP_000006004.1|39319_39553_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_000290792.1|39608_40136_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
WP_032175643.1|40363_40558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077694982.1|40608_40905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170683.1|41665_43027_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|43078_43309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|44346_44538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271680.1|44534_44957_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072106536.1|45003_45306_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000091308.1|45678_46044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|46043_47231_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000086162.1|47337_47709_-	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_077629034.1|48093_48996_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921961.1|49268_50228_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_000445936.1|50227_50623_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001172748.1|51582_51972_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_162829242.1|52997_54210_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001034091.1|54530_58496_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_000997720.1|59002_59257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091308.1|59395_59761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|59760_60948_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000859016.1|61151_61391_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001344604.1|61403_61664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130993.1|62366_63224_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365571.1|63216_63291_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083826.1|63525_63783_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766809.1|64022_64610_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001369435.1|64647_64857_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233838.1|64902_65364_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001369432.1|65608_65821_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|66563_66944_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000998093.1|67338_68877_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
WP_001302181.1|69180_70179_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550555.1|70252_71974_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|72067_73174_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|73173_73995_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_146868692.1|75808_76996_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
