The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042606	Escherichia coli strain NCYU-29-19 chromosome, complete genome	4711922	1147306	1263733	4711922	tRNA,protease,transposase,integrase	Escherichia_phage(52.0%)	87	1197461:1197520	1251384:1251555
WP_001294219.1|1147306_1148446_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000981977.1|1149961_1150423_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990333.1|1150441_1151779_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001280345.1|1153629_1154580_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1154665_1154974_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_151292556.1|1155049_1156330_+	GTPase HflX	NA	NA	NA	NA	NA
WP_151292557.1|1156415_1157675_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	6.2e-05
WP_151292558.1|1158761_1158959_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000220128.1|1164512_1164914_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_151292559.1|1164932_1165631_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012550.1|1165681_1166341_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|1166358_1166757_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_112032558.1|1166766_1167306_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_151292560.1|1168653_1170321_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1170394_1170670_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254633.1|1170818_1171148_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_151292561.1|1171329_1172079_+	esterase	NA	NA	NA	NA	NA
WP_151292562.1|1172075_1172831_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000218362.1|1175768_1176074_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_151292563.1|1176083_1176548_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1176561_1177212_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|1177221_1178076_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000492914.1|1178889_1179165_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1179491_1179887_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|1179893_1180208_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1180212_1180440_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_151292564.1|1180481_1180931_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_052929199.1|1181044_1181974_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001244357.1|1183414_1183891_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_151292565.1|1183911_1185993_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_012512729.1|1189231_1189357_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_151292566.1|1189946_1190630_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
WP_000168937.1|1192087_1192558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|1194208_1194961_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|1195382_1196408_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000171321.1|1196394_1196616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292567.1|1196636_1197413_-	AAC(3)-VI family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
1197461:1197520	attL	AACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAG	NA	NA	NA	NA
WP_151292568.1|1197526_1198210_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	3.0e-131
WP_011264039.1|1198302_1198542_+	macrolide transporter	NA	NA	NA	NA	NA
WP_151292569.1|1198687_1199551_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|1199588_1199834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|1200302_1201094_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_072078461.1|1201948_1202134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|1202273_1202606_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_151292570.1|1203659_1204919_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001067858.1|1209256_1209961_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077249982.1|1209906_1210086_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
WP_063102497.1|1210155_1210542_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084744.1|1210862_1211255_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_151292571.1|1211510_1212194_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.1e-130
WP_151292572.1|1212390_1213092_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	4.0e-131
WP_151293405.1|1213110_1213434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151292573.1|1213402_1214416_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.4e-71
WP_151292574.1|1214560_1215058_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_001336345.1|1215169_1215460_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000679427.1|1216422_1216770_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1216763_1217603_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001993321.1|1217532_1217712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292575.1|1217730_1218231_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|1218199_1219192_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151292576.1|1219515_1219791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743213.1|1222665_1222890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151292577.1|1223100_1223370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151292578.1|1223305_1224592_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|1224626_1225511_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001255015.1|1226969_1227275_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151292579.1|1227636_1228662_+|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	8.7e-74
WP_001053381.1|1228661_1229435_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_151292580.1|1229509_1230784_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000742814.1|1233538_1234564_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000171321.1|1234550_1234772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292567.1|1234792_1235569_-	AAC(3)-VI family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_151292581.1|1235682_1236387_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_000027057.1|1236629_1237490_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_151292566.1|1238968_1239652_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
WP_151292582.1|1240395_1241730_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_151292583.1|1243755_1246218_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_151292584.1|1246560_1247259_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.5e-133
WP_151292585.1|1247413_1249687_+	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_016153548.1|1249701_1250280_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_000480968.1|1251659_1252496_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
1251384:1251555	attR	AACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGG	NA	NA	NA	NA
WP_001082319.1|1252495_1253299_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001352025.1|1253945_1255454_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
WP_032159996.1|1255763_1256135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837933.1|1257145_1257850_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_151292586.1|1258000_1258816_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	99.3	3.9e-162
WP_001352368.1|1262524_1263733_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 2
NZ_CP042606	Escherichia coli strain NCYU-29-19 chromosome, complete genome	4711922	1635039	1774309	4711922	capsid,holin,terminase,plate,tail,head,tRNA,transposase	Shigella_phage(44.19%)	97	NA	NA
WP_000635543.1|1635039_1635462_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_144314344.1|1635475_1636186_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_151292659.1|1639791_1640196_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1640313_1641129_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_151292660.1|1649456_1650260_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.7e-38
WP_151292661.1|1652213_1652837_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|1652884_1654243_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052717.1|1654314_1655070_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_144314347.1|1656351_1657083_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	2.6e-40
WP_151292662.1|1657424_1658273_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_151292663.1|1659046_1659424_-	toxin CbtA	NA	NA	NA	NA	NA
WP_021569959.1|1659485_1659716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292664.1|1659721_1660057_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_008324517.1|1660069_1660297_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_001118040.1|1661362_1662133_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_151292665.1|1662286_1662760_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_137553541.1|1665488_1666067_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_151292666.1|1666272_1667040_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1667010_1667751_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615979.1|1667906_1668185_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001719720.1|1669759_1670080_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001169518.1|1670910_1671774_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_151292667.1|1671776_1672700_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000554757.1|1673876_1674170_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_151292668.1|1674172_1674535_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_151292669.1|1675268_1675535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329160.1|1675467_1676004_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293003.1|1676060_1677518_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001377263.1|1677807_1678236_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000749863.1|1680072_1681128_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000893278.1|1682529_1683783_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000206732.1|1685377_1685683_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_151292670.1|1685682_1686045_-	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	99.2	1.8e-66
WP_146760318.1|1686648_1686849_-	hypothetical protein	NA	U5P4J6	Shigella_phage	94.9	1.4e-28
WP_000196298.1|1687213_1687708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|1688050_1688725_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000515828.1|1689058_1689610_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001250267.1|1689785_1689965_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	2.3e-14
WP_151292671.1|1689954_1690896_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	97.8	8.9e-150
WP_151292672.1|1690892_1691387_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	91.4	9.6e-79
WP_000767096.1|1691708_1692098_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_151292673.1|1692117_1692915_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_001128050.1|1692995_1693913_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.7	3.6e-180
WP_001205452.1|1693930_1694284_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	6.4e-53
WP_001258750.1|1695292_1695694_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001120497.1|1695995_1696322_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_001157005.1|1696325_1696802_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001434542.1|1696785_1697166_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.2	2.6e-52
WP_151292674.1|1697062_1697320_+	peptidase	NA	Q8SBD8	Shigella_phage	72.0	7.8e-24
WP_000613840.1|1697341_1697911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089762.1|1698011_1698347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135197.1|1698497_1698848_+	HNH endonuclease	NA	U5P4L6	Shigella_phage	98.3	2.1e-64
WP_151292675.1|1698974_1699469_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	2.5e-87
WP_072011717.1|1699702_1701199_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_102833772.1|1701210_1701393_+	hypothetical protein	NA	Q8W630	Enterobacteria_phage	96.7	1.9e-24
WP_151292676.1|1703274_1704480_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	1.6e-223
WP_000601363.1|1704529_1704730_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000927715.1|1704732_1705056_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000779292.1|1705940_1706501_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_151292677.1|1706662_1708156_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.6	2.2e-272
WP_000090997.1|1708155_1708512_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_000571713.1|1708508_1708832_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_073514593.1|1710847_1712224_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.3	4.1e-252
WP_073514592.1|1712220_1713300_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	1.3e-205
WP_073514591.1|1713299_1713848_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	4.7e-95
WP_151292678.1|1714257_1715316_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
WP_001236015.1|1716514_1716712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048242842.1|1716680_1717286_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	86.7	7.1e-92
WP_151292679.1|1717300_1717501_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	88.9	1.3e-05
WP_015364430.1|1717873_1718428_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	86.7	1.8e-86
WP_015364431.1|1718770_1719268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104032.1|1719867_1722621_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	26.0	3.3e-27
WP_000523418.1|1723255_1724113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001473831.1|1724234_1724453_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151292680.1|1724574_1725642_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_151292681.1|1725628_1726342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144314357.1|1730106_1731789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292682.1|1731796_1732525_-	OmpA family protein	NA	NA	NA	NA	NA
WP_151292683.1|1735091_1736801_+	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	25.9	2.1e-11
WP_144314359.1|1736790_1738218_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021579902.1|1738210_1739398_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_001303809.1|1747674_1748004_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_151292684.1|1748316_1749027_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000716398.1|1753176_1753845_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000150119.1|1753904_1754540_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_151293413.1|1754565_1755108_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_144314407.1|1755931_1756159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1756193_1756334_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000662258.1|1756960_1757062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292685.1|1762573_1763425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|1764790_1765384_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_024166601.1|1765395_1765632_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_151292686.1|1767290_1768145_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001102119.1|1768668_1769388_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000370306.1|1770818_1771514_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_151292687.1|1771756_1772425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159097.1|1772638_1774309_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	3.1e-60
>prophage 3
NZ_CP042606	Escherichia coli strain NCYU-29-19 chromosome, complete genome	4711922	2219629	2235524	4711922	protease,lysis,integrase	Enterobacteria_phage(53.85%)	29	2210069:2210083	2224646:2224660
2210069:2210083	attL	CAATATCAACCTGAT	NA	NA	NA	NA
WP_151292784.1|2219629_2220700_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|2220677_2220896_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|2220935_2221103_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000026224.1|2221191_2221473_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|2221664_2222213_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_151292785.1|2222209_2222431_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.9e-34
WP_077250124.1|2222529_2222811_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_151292786.1|2222821_2223013_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	1.6e-26
WP_000682311.1|2222985_2223168_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000100845.1|2223840_2224626_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|2224631_2224928_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
2224646:2224660	attR	CAATATCAACCTGAT	NA	NA	NA	NA
WP_001198861.1|2225115_2225280_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_144314383.1|2225352_2225721_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	8.5e-64
WP_072097297.1|2227155_2227257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053031.1|2227253_2227709_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	3.7e-61
WP_000224916.1|2227708_2227879_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_151292787.1|2228157_2228520_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	2.3e-58
WP_000971055.1|2228516_2228657_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_016246965.1|2228742_2229120_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	84.2	2.1e-54
WP_000780581.1|2229275_2229800_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_129584015.1|2231094_2231286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151293416.1|2231304_2232018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|2232222_2232438_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135261.1|2232437_2232935_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_001228702.1|2233151_2233358_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|2233386_2233539_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|2233890_2234301_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_122999095.1|2234605_2234863_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	8.9e-12
WP_000453580.1|2234978_2235524_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
>prophage 4
NZ_CP042606	Escherichia coli strain NCYU-29-19 chromosome, complete genome	4711922	3028365	3038147	4711922	lysis	Enterobacteria_phage(33.33%)	17	NA	NA
WP_120795384.1|3028365_3028479_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3028547_3028781_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000548593.1|3030181_3030388_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019138.1|3030684_3030858_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3031030_3031186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3031265_3031331_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|3031333_3031522_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3031532_3031745_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_144314183.1|3032599_3033133_-	glycoside hydrolase family protein	NA	K7PLY1	Enterobacteria_phage	92.7	1.4e-96
WP_000189921.1|3033129_3033441_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
WP_000839590.1|3033445_3033661_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066485.1|3034414_3034630_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_151293003.1|3035304_3036057_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	8.2e-130
WP_024212263.1|3036070_3037120_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	3.3e-113
WP_032140164.1|3037121_3037400_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980999.1|3037466_3037718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887486.1|3037934_3038147_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
