The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042839	Enterococcus sp. DA9 chromosome, complete genome	2670225	5376	19620	2670225	portal,terminase	Bacillus_phage(30.77%)	22	NA	NA
WP_002342088.1|5376_6555_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	3.2e-80
WP_002286538.1|8244_8559_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002299164.1|8661_8943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343377.1|8947_9292_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	1.7e-26
WP_002304479.1|10278_10692_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_104832643.1|10768_11065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323694.1|11061_11283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606622.1|11811_12204_-	hypothetical protein	NA	A0A2H4JBP1	uncultured_Caudovirales_phage	38.7	2.6e-10
WP_002321589.1|12187_12520_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	2.8e-10
WP_147606624.1|12519_12825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319167.1|12821_12983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606626.1|12997_13357_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_104836944.1|13353_14205_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	29.1	1.6e-25
WP_024635611.1|14221_15052_-	replication protein	NA	C9E2N2	Enterococcus_phage	44.2	1.5e-52
WP_024635610.1|15054_15741_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	2.4e-88
WP_002340820.1|15746_16418_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	5.5e-29
WP_010725024.1|16410_16752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143352961.1|17756_18059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010752313.1|18041_18224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317757.1|18442_18763_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002347912.1|18775_18961_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	53.3	3.2e-11
WP_070676688.1|19245_19620_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	43.8	3.4e-20
>prophage 2
NZ_CP042839	Enterococcus sp. DA9 chromosome, complete genome	2670225	36375	115412	2670225	tRNA,terminase,transposase,plate,capsid,head,integrase,holin,protease,tail,portal	Enterococcus_phage(44.44%)	92	72460:72495	114761:114796
WP_002346313.1|36375_39174_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002291846.1|39438_40146_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_002310283.1|40166_40949_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_073490213.1|40997_41285_-	YggT family protein	NA	NA	NA	NA	NA
WP_147606637.1|41299_41899_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_002310280.1|41912_42590_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002291854.1|42606_43848_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002291855.1|43870_45196_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_147606639.1|45351_46584_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002346310.1|46598_47687_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002314216.1|47712_49074_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002291862.1|49087_50050_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002310275.1|50075_52268_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002297992.1|52268_52670_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002345577.1|52674_53634_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002291870.1|53654_54086_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_002310272.1|54255_54624_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002291874.1|54794_55751_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002291876.1|55823_55940_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_002316937.1|55993_57676_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002286653.1|57693_58143_-	arginine repressor	NA	NA	NA	NA	NA
WP_002310269.1|58249_59068_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002310268.1|59076_59967_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002286657.1|59968_60193_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002310267.1|60197_61535_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	29.0	5.1e-26
WP_002310266.1|61535_62390_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.7	3.1e-40
WP_002286662.1|62486_62936_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002291889.1|62928_63354_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002310265.1|63599_64664_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002310264.1|64836_65082_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002310263.1|65219_65594_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_002310262.1|65676_66591_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002310261.1|66611_67415_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_147606641.1|67447_68437_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_002289455.1|68539_69031_-	PTS transporter subunit IIB	NA	NA	NA	NA	NA
WP_002334685.1|69221_72056_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
72460:72495	attL	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_024636555.1|73560_73863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147606643.1|74628_75645_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	58.8	1.6e-64
WP_147606645.1|75655_75853_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	1.7e-23
WP_147606647.1|75875_76169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290625.1|76206_76344_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002333072.1|76584_77955_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_147606649.1|78055_80305_-|plate	BppU family phage baseplate upper protein	plate	A6MAC6	Lactococcus_virus	40.5	1.8e-07
WP_147606651.1|80304_81087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606652.1|81103_82861_-|plate	BppU family phage baseplate upper protein	plate	A0A191KBJ0	Streptococcus_virus	38.8	5.5e-36
WP_147606654.1|82835_85682_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BMB8	Lactococcus_phage	60.6	0.0e+00
WP_147607130.1|85678_86446_-|tail	phage tail protein	tail	D7RWD9	Brochothrix_phage	45.5	9.1e-60
WP_002318903.1|89316_89604_-	hypothetical protein	NA	D7RWD7	Brochothrix_phage	44.3	2.4e-13
WP_002293018.1|89657_90026_-	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	54.8	8.6e-24
WP_002293017.1|90071_90584_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	66.3	2.2e-57
WP_147607131.1|90594_90987_-|capsid	phage capsid protein	capsid	Q77K20	Lactococcus_phage	74.6	2.4e-48
WP_010722880.1|90986_91325_-	HK97 gp10 family phage protein	NA	Q77K21	Lactococcus_phage	60.7	1.3e-31
WP_073490895.1|91691_92909_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	2.2e-68
WP_010725226.1|93242_93572_-	hypothetical protein	NA	A0A0S2MYD5	Enterococcus_phage	76.4	3.8e-39
WP_010725227.1|93583_93847_-	hypothetical protein	NA	D2J062	Enterococcus_phage	74.4	1.1e-09
WP_002322711.1|93864_94788_-|capsid	phage major capsid protein	capsid	A0A1B1V000	Enterococcus_phage	77.5	1.8e-139
WP_002322712.1|94800_95403_-	DUF4355 domain-containing protein	NA	A0A097BY91	Enterococcus_phage	52.5	1.1e-36
WP_104889530.1|95564_96485_-|head	phage head morphogenesis protein	head	A0A1L2JXH2	Streptococcus_phage	57.0	9.1e-91
WP_147606656.1|96489_97989_-|portal	phage portal protein	portal	A0A097BY86	Enterococcus_phage	78.9	8.1e-222
WP_008274581.1|98001_99300_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1B1UZZ1	Enterococcus_phage	88.6	1.3e-231
WP_002311445.1|99292_99748_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	41.4	2.7e-19
WP_147606658.1|99766_99997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606660.1|100194_100569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606661.1|100916_101315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010706374.1|101327_101741_-	ArpU family phage transcriptional regulator	NA	C9E2P5	Enterococcus_phage	79.6	6.2e-55
WP_104833045.1|101817_102114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606663.1|102125_102314_-	toxin PIN	NA	NA	NA	NA	NA
WP_147606665.1|102408_103248_+	DUF4393 domain-containing protein	NA	A0A0R6PH66	Moraxella_phage	36.4	1.7e-43
WP_147606666.1|103392_104133_-	DUF1642 domain-containing protein	NA	A0A0D3MVS9	Staphylococcus_phage	60.0	8.8e-28
WP_002322113.1|104271_105087_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.8	2.8e-83
WP_002322112.1|105083_105401_-	hypothetical protein	NA	M4NJW7	Sulfitobacter_phage	48.9	7.7e-05
WP_002333651.1|105633_105909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974467.1|105908_106214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301517.1|106210_106372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292987.1|106368_106671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104857089.1|106832_107102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606668.1|107113_107941_-	replisome organizer	NA	A0A0S2MYA8	Enterococcus_phage	54.9	3.9e-40
WP_025481093.1|107943_108171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104867298.1|108173_108860_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.9	1.9e-88
WP_002322006.1|108865_109600_-	DUF1071 domain-containing protein	NA	A0A1X9IGE5	Lactococcus_phage	48.4	2.1e-42
WP_142972305.1|109592_109934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311421.1|110259_110448_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	58.6	1.7e-07
WP_002333281.1|110468_110753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330306.1|110730_110943_-	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	54.5	2.6e-09
WP_002330307.1|110945_111722_-	bro family toxin-antitoxin system toxin component	NA	A0A0E3T9K2	Staphylococcus_phage	55.5	1.9e-73
WP_080105910.1|111777_111999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301535.1|112366_112714_+	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	61.6	9.2e-28
WP_002321996.1|112749_113145_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_016628577.1|113197_113509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147606670.1|113520_114669_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	39.8	4.4e-66
WP_002289452.1|114761_115055_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
114761:114796	attR	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_002289451.1|115067_115412_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 3
NZ_CP042839	Enterococcus sp. DA9 chromosome, complete genome	2670225	1723446	1733208	2670225	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_002290404.1|1723446_1724163_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	6.1e-34
WP_002313582.1|1724162_1725611_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	6.0e-20
WP_002308814.1|1725684_1726194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147607017.1|1726183_1726909_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_147607018.1|1727080_1729201_-	sulfatase-like hydrolase/transferase	NA	W6LM83	Streptococcus_phage	58.4	9.7e-221
WP_002308823.1|1729429_1730608_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	49.2	6.0e-103
WP_002308824.1|1730623_1731376_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	35.9	1.3e-26
WP_002290411.1|1731398_1731884_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_147607019.1|1731954_1733208_-	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	1.7e-23
>prophage 4
NZ_CP042839	Enterococcus sp. DA9 chromosome, complete genome	2670225	2281765	2290804	2670225		Synechococcus_phage(16.67%)	9	NA	NA
WP_002309479.1|2281765_2282344_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.3e-26
WP_033627216.1|2282340_2283384_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	2.9e-61
WP_073490706.1|2283415_2284855_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	9.1e-53
WP_073490707.1|2284839_2287062_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	7.7e-152
WP_002313846.1|2287062_2287734_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002309490.1|2287735_2287990_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002313847.1|2287989_2288718_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	40.9	1.1e-41
WP_002309492.1|2288973_2289351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147607083.1|2289508_2290804_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.0e-18
>prophage 1
NZ_CP042838	Enterococcus sp. DA9 plasmid unnamed3	36294	2977	30085	36294	terminase,portal,capsid,head,holin,tail,protease	Enterococcus_phage(37.5%)	31	NA	NA
WP_086314952.1|2977_4255_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	69.2	7.5e-168
WP_099746308.1|4265_4463_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	84.4	7.8e-24
WP_002322123.1|4478_4721_-|holin	holin	holin	D2J075	Enterococcus_phage	68.4	2.1e-23
WP_147606603.1|4784_7664_-	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	54.7	6.4e-98
WP_147606605.1|7687_9979_-	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.1	2.3e-90
WP_147606606.1|9988_10726_-|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	31.9	2.6e-19
WP_147606608.1|10776_14493_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.7	1.5e-67
WP_002305377.1|14509_14692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299170.1|14694_15057_-	hypothetical protein	NA	R4IBH8	Listeria_phage	31.9	3.0e-05
WP_002318244.1|15078_15684_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.2	6.7e-34
WP_147606610.1|15695_16100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606612.1|16092_16494_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	34.1	3.0e-14
WP_147606614.1|16483_16837_-|head,tail	head-tail adaptor protein	head,tail	A0A1B1P760	Bacillus_phage	38.5	8.0e-11
WP_104880755.1|16826_17138_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	41.2	2.7e-10
WP_147606616.1|17134_18010_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	4.3e-130
WP_002318250.1|18019_19180_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.4	2.7e-100
WP_147606618.1|19179_19866_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	42.2	1.8e-30
WP_002342088.1|19828_21007_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	3.2e-80
WP_147606620.1|21026_22721_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.9	5.5e-150
WP_002286538.1|22698_23013_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_002343377.1|23400_23745_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	1.7e-26
WP_002304479.1|24731_25145_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_104832643.1|25221_25518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323694.1|25514_25736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606622.1|26264_26657_-	hypothetical protein	NA	A0A2H4JBP1	uncultured_Caudovirales_phage	38.7	2.6e-10
WP_002321589.1|26640_26973_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	2.8e-10
WP_147606624.1|26972_27278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319167.1|27274_27436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147606626.1|27450_27810_-	DUF1064 domain-containing protein	NA	A0A1P8BMB7	Lactococcus_phage	51.4	8.1e-19
WP_104836944.1|27806_28658_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	29.1	1.6e-25
WP_147606631.1|29506_30085_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.3	2.5e-78
>prophage 1
NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	159791	43702	63118	159791	transposase,bacteriocin	Streptococcus_phage(25.0%)	16	NA	NA
WP_143162214.1|43702_44389_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	1.0e-126
WP_099119708.1|44785_44842_-|bacteriocin	LsbB family leaderless bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002318791.1|44908_45250_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002313088.1|45250_45466_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_147607156.1|45689_45827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222573.1|45908_46868_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.0e-32
WP_002354485.1|47824_48511_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_147607144.1|49151_50183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147607145.1|50331_50946_+	hypothetical protein	NA	H8ZJH4	Ostreococcus_tauri_virus	61.3	5.1e-05
WP_142432546.1|51459_52365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142432547.1|52448_53231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147607157.1|53674_55561_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	33.4	2.4e-77
WP_147607146.1|55573_58477_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	29.3	8.1e-93
WP_147607147.1|58466_59738_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_147607148.1|59727_61590_+	DEAD/DEAH box helicase family protein	NA	I3VYY6	Thermoanaerobacterium_phage	24.2	3.7e-22
WP_002323245.1|61945_63118_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
>prophage 2
NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	159791	66738	131092	159791	transposase,integrase	Streptococcus_phage(47.83%)	57	67944:67971	98743:98770
WP_147607149.1|66738_67917_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
67944:67971	attL	ATTTACACAAAATTATTGACGCTCCCAA	NA	NA	NA	NA
WP_002292150.1|68695_69268_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
WP_002292156.1|69412_70117_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_073438625.1|70143_70434_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002292161.1|70580_70814_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002319350.1|71011_72916_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	3.8e-99
WP_002319351.1|73603_74221_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002307628.1|74458_75010_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.7	2.9e-31
WP_121686712.1|75128_75815_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_002292678.1|76022_76352_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002300557.1|76341_76629_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292680.1|76914_77772_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|77772_78321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147607150.1|79485_80166_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_002375441.1|80949_84177_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_002375439.1|84178_84910_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002375438.1|84974_86462_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_002375436.1|86548_87745_+	class C sortase	NA	NA	NA	NA	NA
WP_002375434.1|87741_88863_+	class C sortase	NA	NA	NA	NA	NA
WP_002314385.1|88986_89674_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	2.9e-126
WP_104885939.1|89704_89974_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104885615.1|90315_92244_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.4	6.8e-96
WP_104885614.1|92500_93064_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	47.5	3.2e-38
WP_104885613.1|93258_93546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104885612.1|93535_93865_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002339771.1|95344_96382_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002335374.1|96407_97346_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_147607151.1|97526_98717_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	3.6e-23
WP_002292150.1|99249_99822_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
98743:98770	attR	ATTTACACAAAATTATTGACGCTCCCAA	NA	NA	NA	NA
WP_025481494.1|99966_100671_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002320187.1|100898_101237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292161.1|102223_102457_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_016628643.1|102654_104559_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	4.1e-101
WP_002329962.1|104828_105065_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	73.8	7.6e-18
WP_002329961.1|105061_105271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002341318.1|105578_105941_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	43.6	8.4e-16
WP_002341317.1|105957_106575_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002354485.1|106709_107396_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002329956.1|108178_108676_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002329955.1|108696_109515_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002329954.1|109511_110342_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_016629115.1|110518_113044_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_144169094.1|113131_113437_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_147607152.1|113556_114243_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_094889737.1|114729_115856_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	53.7	4.3e-74
WP_010731429.1|116071_117847_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_002405179.1|117877_118480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033918032.1|119664_121260_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.9	1.5e-125
WP_094889738.1|121249_122461_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.7	9.1e-14
WP_049142574.1|122474_125624_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.1	1.1e-21
WP_142432376.1|125714_126401_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	4.2e-125
WP_002344897.1|126529_126886_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002344896.1|126875_127142_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344895.1|127300_128302_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_008271463.1|129525_129771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|129868_130090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|130411_131092_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
