The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	1020895	1028034	4682572		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1020895_1021534_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1021625_1022792_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1022788_1023697_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1023892_1024660_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1024710_1025367_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1025472_1028034_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	1408615	1419825	4682572	integrase,tail	Enterobacteria_phage(53.33%)	16	1404925:1404941	1421835:1421851
1404925:1404941	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1408615_1408816_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1408947_1409253_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1409252_1409615_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1409605_1410142_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1410269_1411094_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1411159_1411522_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_001393497.1|1412244_1412739_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1412738_1413014_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1413063_1413582_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1413608_1414049_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1414347_1414629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1414663_1415995_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|1415991_1416912_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|1416908_1417271_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1417423_1418581_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1418892_1419825_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1421835:1421851	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	1771762	1780433	4682572		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|1771762_1773157_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|1773331_1774225_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|1774597_1775683_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|1775682_1776582_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|1776639_1777521_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|1777520_1778078_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|1778074_1779322_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|1779329_1780433_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	2238205	2257416	4682572	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2238205_2238361_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2238527_2238935_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2239018_2239249_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2239545_2239695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2240131_2240464_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2240666_2240972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2240996_2241236_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2241235_2241523_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2241594_2241750_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2241966_2242218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2242284_2242563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2242564_2243614_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2243627_2244380_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2244657_2244747_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2244801_2245014_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2245314_2245530_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2246283_2246499_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2246503_2246815_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2246811_2247345_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2247341_2247839_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2248201_2248414_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2248424_2248613_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2248615_2248681_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2248759_2248915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2249086_2249260_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2249411_2249822_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2249879_2250113_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2250501_2251071_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2251021_2251984_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2251983_2252559_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2252656_2253247_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2253563_2253797_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2253865_2253979_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2254583_2255867_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2255955_2257416_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	2382002	2480302	4682572	tRNA,transposase,tail,lysis	Escherichia_phage(41.67%)	85	NA	NA
WP_000826416.1|2382002_2383211_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2383742_2384411_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2384712_2385306_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2385302_2386295_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2386418_2387399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2387390_2387930_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2387992_2388217_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|2388356_2390012_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2390236_2391580_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2391796_2392720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2392757_2394398_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2394796_2394946_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2395017_2395191_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2395435_2395966_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2397196_2398636_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2398832_2399633_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2399904_2403807_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2404007_2404613_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2404666_2405983_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|2405972_2407730_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|2407745_2408642_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|2408641_2409247_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|2409417_2411724_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2411786_2412647_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|2412854_2415266_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|2416358_2417510_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895425.1|2417718_2418946_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_010723099.1|2421637_2421703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2421806_2422397_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2422378_2423329_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2423429_2424743_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2424769_2425975_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2425974_2426397_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2426386_2427814_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2427815_2428604_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2428603_2429371_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2429367_2430438_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2430445_2430943_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2430957_2431704_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2431712_2432000_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2432011_2432941_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2433225_2435271_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2435518_2437792_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2437849_2439349_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2439584_2440490_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2440661_2440988_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2440995_2441181_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2441177_2443817_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2444024_2445014_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2445124_2445547_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2445543_2445810_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2446083_2449608_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2449974_2451108_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2451248_2451683_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2452458_2452572_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2452640_2452874_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2453190_2453781_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2453878_2454454_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2454453_2457816_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|2458138_2459119_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000091628.1|2460884_2461244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2461224_2461488_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2461625_2463083_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2463279_2463465_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2463552_2464113_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2464135_2464882_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2464888_2465746_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2465758_2466181_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2466203_2466500_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2466623_2467100_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2467553_2467709_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2467705_2468194_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2468635_2468857_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2468856_2469027_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2469101_2469377_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2469478_2472079_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2472071_2472881_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2472937_2473132_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2473124_2473334_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2473412_2473628_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2473629_2474865_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2474916_2475852_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2475980_2477354_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2477831_2478815_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2479069_2480302_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	2673662	2685981	4682572	integrase,portal,tail,plate	Shigella_phage(33.33%)	20	2668982:2668995	2687007:2687020
2668982:2668995	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_001295666.1|2673662_2673986_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2674088_2674253_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2674486_2675320_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|2675426_2675981_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_172619140.1|2676327_2676543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010723096.1|2677115_2677529_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000383574.1|2678162_2678747_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2678737_2679529_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2679455_2679929_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2679928_2680111_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2680122_2681490_-	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2681479_2681659_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2681834_2682392_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2682435_2682636_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2682726_2683401_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2683575_2683884_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2683821_2684163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2684279_2684591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2684627_2684873_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2684853_2685981_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
2687007:2687020	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	3082859	3129709	4682572	portal,protease,transposase,lysis,holin,integrase,head,tail,terminase,capsid	Enterobacteria_phage(74.24%)	66	3106617:3106632	3131417:3131432
WP_088895425.1|3082859_3084088_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000162952.1|3085099_3086332_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3086460_3087045_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3087044_3089369_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3089433_3090054_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3090115_3093514_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3093574_3094207_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3094143_3094887_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3094892_3095591_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3095590_3095920_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3095916_3098478_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3098470_3098905_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3098886_3099309_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3099324_3100065_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3100072_3100468_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3100464_3101043_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3101054_3101408_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3101419_3101818_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3101859_3102885_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3102940_3103273_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3103282_3104602_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3104582_3106184_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3106180_3106387_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3106383_3108309_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3106617:3106632	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3108283_3108829_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|3109217_3109412_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3109576_3109783_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|3110068_3110479_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|3110768_3111062_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3111152_3111335_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3111551_3112028_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3112011_3112335_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_001235459.1|3113011_3113635_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3113631_3114297_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3114274_3114481_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3114477_3115089_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3115081_3115252_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3115248_3115431_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3115397_3115571_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3115567_3116440_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3116436_3116877_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3116950_3117241_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3117237_3117939_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3117935_3118835_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3118867_3119161_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3119279_3119480_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3119580_3120294_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3120406_3121246_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3121261_3121696_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3122160_3122484_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3122484_3122967_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3123233_3123434_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3123616_3123985_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3124057_3124222_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3124190_3124334_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3124408_3124705_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3124710_3125496_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3125492_3126173_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3126169_3126352_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3126324_3126516_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3126907_3127129_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3127125_3127674_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3127865_3128147_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3128235_3128403_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3128442_3128661_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3128638_3129709_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3131417:3131432	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	3327947	3372309	4682572	protease,integrase,transposase,lysis,terminase	Enterobacteria_phage(56.0%)	47	3351022:3351068	3372323:3372369
WP_001300563.1|3327947_3329060_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3329136_3329289_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3329741_3330860_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3330925_3331174_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3331238_3331607_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3331700_3332354_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3332461_3333709_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3333789_3335166_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3335267_3338411_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3338422_3339646_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3339661_3339994_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3340151_3341525_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3341681_3342365_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3342354_3343797_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3343946_3346184_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3346170_3349143_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3349143_3350034_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3350216_3350978_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3351022:3351068	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3351491_3352445_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_026089880.1|3354345_3354972_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|3355026_3355770_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3355744_3356290_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3356678_3356873_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3357037_3357244_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3357529_3357940_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3358230_3358524_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3358614_3358797_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3359013_3359511_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3359510_3359726_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3360298_3361366_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3361370_3362387_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3362784_3363168_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3363253_3363394_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3363390_3363753_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3363749_3364040_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3364032_3364203_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3364202_3364658_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3364654_3364756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3364872_3365670_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3365679_3366231_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3366695_3368222_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3368279_3368429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3368476_3368809_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3369119_3370282_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3370344_3370440_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3370762_3371026_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3371145_3372309_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3372323:3372369	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP042867	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682572	3605627	3657100	4682572	integrase,transposase,holin	Acinetobacter_phage(28.57%)	46	3597055:3597071	3659383:3659399
3597055:3597071	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|3605627_3607661_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3607789_3608377_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3608390_3609863_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3609876_3611547_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3611759_3612428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3612670_3613366_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3613358_3614786_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3614796_3615516_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3616042_3616897_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3617122_3618448_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3618556_3618793_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3618804_3619398_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|3620670_3621833_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000662258.1|3623881_3623983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3624346_3624610_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3624609_3624750_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3624784_3625012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3625835_3626378_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3626452_3627040_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3627097_3627766_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3627791_3630317_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001310578.1|3630306_3631950_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3631918_3632629_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3632941_3633271_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3633518_3634133_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3634550_3635240_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3635236_3636193_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3636189_3638388_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3638397_3639354_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|3639332_3639743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3640027_3641428_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3641544_3641985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3641981_3642206_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|3642324_3643179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|3643205_3643904_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|3644175_3644802_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|3644892_3645624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|3646818_3647823_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|3647961_3648720_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|3648724_3650335_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|3650346_3651729_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|3651955_3653923_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|3653937_3654846_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|3655140_3656295_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|3656388_3656739_+	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_000015532.1|3656761_3657100_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
3659383:3659399	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP042868	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	279992	1053	54233	279992	protease,transposase,integrase	Enterobacteria_phage(24.0%)	53	17455:17514	25863:26424
WP_001067855.1|1053_1758_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073972769.1|1793_2339_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.6	2.2e-31
WP_004197546.1|2368_3235_-	class A beta-lactamase SCO-1	NA	A0A1B0VBP7	Salmonella_phage	42.0	5.3e-56
WP_004197531.1|3396_4596_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_004197529.1|5481_6156_+	recombinase family protein	NA	NA	NA	NA	NA
WP_004197526.1|6157_6484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197540.1|6519_7797_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
WP_004197551.1|7802_8231_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|8326_8599_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|8723_9483_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_004197549.1|10375_10561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832797.1|10626_11765_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
WP_000587836.1|11817_12111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557452.1|12123_12984_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_000027061.1|13125_13986_-	class A extended-spectrum beta-lactamase TEM-10	NA	Q1MVP3	Enterobacteria_phage	99.3	8.6e-160
WP_001235713.1|14168_14726_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|15491_16196_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|16325_17141_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|17247_17952_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
17455:17514	attL	CTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAG	NA	NA	NA	NA
WP_001324342.1|18726_20250_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|20236_21022_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|21197_21698_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|21825_22665_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|22658_23006_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|23169_23961_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|24109_25123_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_021529705.1|25954_28960_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
25863:26424	attR	CTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAACGTTTTCTGCCTCTGACGCCTCTTTTAATGGTCTCAGATGTCCTTTGGTCACCAGTTCTGCCAGCGTGAAGGAATAATGGCCGAGCATATTGATATGTCCGTGGCAAAGCGGGGAGAGGCGTGCGATATCTTCATCATTCAGTGTTTCACCCTGCGCCCGGAGATGATCCAGGGCTGCCTGCATATAAATAGTGTTCCATAACACGACGGCGTTAGTGACCAGCCCCAGTGTGCCCAGTTGATCTTCCTGACCGTCGGTATATCGTTTTCTTATCTCACCTTTTTGACCGTGACAGATGGCTCTGGCAACGGCATGGCGACTTTCTCCCCGATTAAGCTGGGTCAGAATGCGCCGGCGGTAATCTTCATCATCAATATAATTAAGCAGATACAGCGTTTTGTTGATGCGCCCCACTTCAATGATTGCCTGAGTCAGTCCGGAAGGACGTTCACTTTTCAGCA	NA	NA	NA	NA
WP_001235713.1|29123_29681_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_014454105.1|29914_30469_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|30538_31327_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|31386_32211_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|32910_33771_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_172619141.1|33886_34549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|34670_35555_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_014386535.1|36808_37267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124036893.1|37320_37506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196917.1|38171_38384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118062.1|38477_38756_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004196937.1|39303_39687_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004196907.1|40096_41635_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|41683_42031_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_004196883.1|42027_42432_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_004196929.1|42828_43311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196935.1|43689_45189_-	kinase	NA	NA	NA	NA	NA
WP_004196924.1|45216_46950_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|46949_47990_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|48082_48721_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|48721_49363_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026588.1|49387_50026_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|50502_50961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196894.1|50963_52187_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196886.1|52197_53154_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004196911.1|53153_54233_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	3.9e-40
>prophage 2
NZ_CP042868	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	279992	66811	119829	279992	transposase	Pseudomonas_phage(25.0%)	48	NA	NA
WP_001352368.1|66811_68020_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_004178082.1|68488_69976_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_147633750.1|70288_71500_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|71943_72264_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|72256_72643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|72650_73337_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|73314_73938_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|74019_75225_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|75337_75931_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|76444_77653_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004197614.1|78475_79078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197616.1|80069_81341_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_004197615.1|81523_82018_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.0	4.2e-18
WP_069335023.1|82127_82946_+	DNA repair protein	NA	NA	NA	NA	NA
WP_004026629.1|83348_83747_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001567369.1|84333_84966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|84994_86398_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|86509_88042_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_001567369.1|88218_88851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|88879_90283_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_023332914.1|90475_91963_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_004196316.1|92398_92713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196342.1|92721_93231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196329.1|93220_93661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181937.1|93690_94347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181934.1|94620_95223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196349.1|95225_95741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045289292.1|97271_98627_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_045289282.1|98670_99708_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004026315.1|100073_100616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181918.1|100633_101158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196341.1|101350_102106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|102703_103168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935928.1|103167_103956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935926.1|103969_106918_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_045289280.1|106907_109034_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_042935923.1|109036_110134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026331.1|110146_110821_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004883400.1|110829_111966_+	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.2	5.7e-10
WP_042935920.1|111968_112742_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	46.7	1.5e-09
WP_042935918.1|112795_113152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935952.1|113693_113927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935949.1|114005_114353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061891936.1|114508_115576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060589151.1|116265_116643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181899.1|116840_117815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181898.1|118417_118576_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004883380.1|118647_119829_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042868	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	279992	134586	143180	279992	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000412211.1|134586_135246_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|135446_135824_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|136134_137139_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|137217_140184_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001067855.1|140476_141181_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|141217_141874_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|141870_142380_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_001067855.1|142475_143180_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP042868	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	279992	217656	224848	279992		Burkholderia_phage(33.33%)	10	NA	NA
WP_004196710.1|217656_218235_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|218225_218540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196691.1|218664_219075_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	1.7e-41
WP_004196726.1|219259_219619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|219849_220293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|220546_220807_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004196690.1|220839_221274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|221270_222014_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_075043065.1|222170_223556_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026461.1|223645_224848_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 5
NZ_CP042868	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	279992	232454	272618	279992	transposase	Escherichia_phage(31.58%)	42	NA	NA
WP_000019450.1|232454_233435_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004026446.1|233879_235124_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_004181839.1|238581_238935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196715.1|239254_240046_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
WP_004181841.1|241019_242108_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
WP_001352368.1|243888_245097_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_004181842.1|245471_246002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026437.1|246079_246286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181843.1|246369_246849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181845.1|247924_248218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197191.1|248256_248838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181860.1|249227_250097_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_004026417.1|250150_250471_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|250551_250866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|250986_251238_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|251403_251622_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_040209848.1|251714_252212_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
WP_004197241.1|252208_252397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|252874_253102_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004197234.1|253098_253743_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_004197228.1|254159_254546_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004197183.1|254825_255041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026408.1|255244_255460_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_032451279.1|256696_256891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|257209_258190_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004197220.1|258391_258598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|258681_258954_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_162138575.1|259017_259179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147633751.1|259234_259501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|259546_260527_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004197199.1|261175_261700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|261763_262531_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_004197181.1|262982_263432_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	40.7	1.3e-18
WP_004026394.1|263501_264110_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_004026393.1|264397_264853_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026392.1|264913_265078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197197.1|265737_266979_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_004197179.1|267426_267822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197185.1|267831_268239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197239.1|268268_268679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|269049_270054_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|271613_272618_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
